Атрофический гастрит что такое: Гастрит атрофический — Лечение в многопрофильной семейной клинике «К медицина»

Содержание

Как быстро атрофический гастрит переходит в рак? Часто задаваемые вопросы по медицине и здоровью: ответы врачей

Хронический атрофический гастрит (ХАГ) — это воспалительное состояние, характеризующееся потерей железистых структур желудка, которые заменяются соединительной тканью (неметапластическая атрофия) или железистыми структурами, не подходящими для локализации (метапластическая атрофия). Это заболевание является очень серьезным и опасным, в результате чего оно может увеличивать риск новообразований. Однако как быстро атрофический гастрит переходит в рак?

Некоторые изменения, которые считаются предраковыми, могут произойти во внутренней оболочке желудка.

При атрофическом гастрите нормальных железистых клеток желудка либо меньше, либо нет. Существует также некоторая степень воспаления при котором клетки желудка повреждаются клетками иммунной системы. Атрофический гастрит часто вызывается инфицированием бактериями H.pylori. Это также может быть вызвано аутоиммунной реакцией, при которой иммунная система человека атакует клетки, выстилающие желудок. У некоторых людей с этим заболеванием развивается злокачественная анемия или другие проблемы с желудком, включая рак.

Еще одно возможное предраковое изменение — кишечная метаплазия. В этом состоянии клетки, которые обычно выстилают желудок, заменяются клетками, которые выглядят как клетки, которые обычно выстилают кишечник. Люди с этим заболеванием также часто страдают хроническим атрофическим гастритом. Это также может быть связано с инфекцией H.pylori.

И атрофический гастрит, и кишечная метаплазия могут привести к слишком малому количеству железистых клеток, которые обычно выделяют вещества, которые помогают защищать клетки внутренней оболочки желудка. Повреждение ДНК внутри этих клеток может иногда приводить к дисплазии, при которой клетки становятся больше и имеют очень ненормальный вид (больше напоминающие раковые клетки). В некоторых случаях дисплазия может прогрессировать до рака желудка.

Рак желудка, как и другие виды рака, вызывается изменениями ДНК внутри клеток. Нельзя сказать насколько быстро и с какой вероятностью атрофический гастрит переходит в рак. Однако в среднем по статистике у 10% людей с данным видом гастрита в течении 10-15 лет может развиться рак желудка.

Источники

Atrophic Gastritis Increases the Risk of Gastric Cancer in Asymptomatic Population in Korea / NCBI (англ.)

Risk for gastric neoplasias in patients with chronic atrophic gastritis: A critical reappraisal / National Center for Biotechnology Information (англ.)

What Causes Stomach Cancer? / Cancer.org (англ.)

Онлайн: 08:00 — 21:00, без выходных

Хронический атрофический гастрит: факторы риска и скрининг пациентов (обзор литературы)

Евстигнеев, И.В. (2018) Хронический атрофический гастрит: факторы риска и скрининг пациентов (обзор литературы). Український журнал медицини, біології та спорту, Т. 3 (№ 7). pp. 214-218. ISSN 2415-3060 (Print), 2522-4972 (Online)

Abstract

В обзоре освещены основные аспекты скрининга раннего рака желудка (EGC), включая сбор анамнеза и использование комбинированного определения в сыворотке крови антител класса IgG к H. pylori и пепсиногена (PGI, PGI/PGII) методом АВС для скрининга хронического атрофического гастрита (ХАГ) и EGC. Неинвазивный скрининг в популяции используется для выявления среди населения пациентов с высоким риском развития ХАГ и EGC с целью дальнейшего эндоскопического и морфологического исследования. По результатам неинвазивного скрининга пациенты определяются в группы A, B, C, D. Группа А не нуждается в дальнейшем эндоскопическом и морфологическом обследовании. В группах B, C, D эти обследования проводятся соответственно 1 раз в 3, 2 года и ежегодно. Подчеркнута роль H. pylori как канцерогена первого порядка, однако эрадикация наиболее эффективна до развития выраженных необратимых изменений в слизистой оболочке желудка. Антихеликобактерная терапия в большей степени уменьшает атрофию в слизистой оболочке тела желудка, в определенной мере уменьшая хроническое воспаление. Воздействие на все механизмы воспалительного процесса в слизистой оболочке − важная стратегическая задача в уменьшении прогрессирования атрофических изменений в слизистой оболочке. Отмечено, что эрадикация H. pylori наиболее эффективна в замедлении прогрессирования канцерогенеза, если проводится до развития стадии H. pylori-ассоциированного атрофического гастрита и/или дисплазии. Сочетанное использование неинвазивных и инвазивных методов в выявлении хронического атрофического гастрита и EGC позволяет выявить в популяции группы повышенного риска и проводить целенаправленно эндоскопическое и морфологическое исследование. Стратегия использования этих методов позволяет осуществлять эффективную профилактику и выявление хронического атрофического гастрита, дисплазии, раннего рака желудка.

Item Type: Article
Additional Information: DOI: 10.26693/jmbs03.07.214
Uncontrolled Keywords: антитіла до H. pylori, пепсиноген, атрофічний гастрит, скринінг раку шлунка; антитела к H. pylori, пепсиноген, атрофический гастрит, скрининг рака желудка; antibodies to H. pylori, pepsinogen, atrophic gastritis, gastric cancer screening.
Subjects: Internal Medicine
Divisions: Departments > Department of Internal Medicine 3 (formerly — hospital therapy 2)
Depositing User: Елена Шрамко
Date Deposited: 22 Nov 2019 15:05
Last Modified: 22 Nov 2019 15:05
URI: http://repo.dma.dp.ua/id/eprint/4569

Actions (login required)

View Item

Клинические исследование Хронический атрофический гастрит: Talcid®, Рецепт китайской медицины, Плацебо, Составные азимтамидные таблетки, покрытые энтьерическим покрытием — Реестр клинических исследований

Тип вмешательства: Drug

Название вмешательства: Talcid®

Описание: Talcid® is allowed to be taken when patients feel stomach pain, acid reflux or heartburn. Continuous taking time should not exceed one week.

Тип вмешательства: Препарат, средство, медикамент

Название вмешательства: Рецепт китайской медицины

Описание: Рецепт применения китайской медицины состоит из пинеллии 9 г, радикса scutellariae 10 г, корневища коптидиса 8 г, корневища зингибериса 10 г, радикса куркумы 10 г, корневища атрактилодиса 10 г, жаренного пигголового атрактилодеса, корневища 10 гитов, радикса аридной железы 15, щели salvia miltiorrhiza bge 10 г, стебель благородного дендробия 10 г, Radix pseudostellariae 10 г, фруктус aurantii immaturus 10 г, кора магнолии лекарственной 10 г, корище куркумы 10 г, имбирь 3 г, мармелад 6 г. Пациенты принимают по 200 мл каждый раз два раза в день. Продолжительность лечения 24 недели.

Этикетка Arm Group: Рецепт китайской медицины

Тип вмешательства: Препарат, средство, медикамент

Название вмешательства: Плацебо

Описание: Плацебо — это имитация гранулы рецепта китайской медицины. Пациенты принимают по 200 мл каждый раз два раза в день. Продолжительность лечения 24 недели.

Этикетка Arm Group: плацебо

Тип вмешательства: Препарат, средство, медикамент

Название вмешательства: Составные азимтамидные таблетки, покрытые энтьерическим покрытием

Описание: Таблетки с азимтамидом, покрытые энтьериком, одобрены Управлением по санитарному надзору за пищевыми продуктами и медикаментов Китая. Эти таблетки разрешено принимать при ощущении полноты, отрыжки или анорексии. Время непрерывного приема не формат одной недели.

Хронический атрофический гастрит у детей

Анализ имеющейся педиатрической литературы и многолетние собственные наблюдения невольно заставляют поставить вопрос: существует ли вообще хронический атрофический гастрит у детей, поскольку морфологическое понятие «атрофия слизистой оболочки» связывается прежде всего с патологией взрослых. Если нет, то это означает, что кроме деструктивных процессов слизистой оболочки желудка (СОЖ) (эрозивно-язвенные поражения) в детском возрасте других форм хронического воспалительного процесса в желудке (поверхностный гастрит) не встречается, т.к. все варианты эритематозной гастропатии (эндоскопическая характеристика состояния СО желудка), соответствующие понятию «хронический поверхностный гастрит», трактуются в настоящее время как проявления функциональной диспепсии. Это привело к практическому вытеснению диагноза «хронический поверхностный гастрит» и подмене его диагнозом «функциональная диспепсия» (ФД) [2, 3]. Нет нужды говорить, что с морфологической точки зрения это является нонсенсом. Чтобы более определенно трактовать сущность функциональной диспепсии, некоторые исследователи [5] предложили даже выделять две основные формы функциональной диспепсии: ФД без морфологических изменений и ФД с морфологическими изменениями.

Если принять во внимание, что хронический гастрит с морфологической (и клинической) точки зрения представляет собой стадийный процесс, который развивается от поверхностных до атрофических изменений и соответственно от повышенной до пониженной кислотности, то правомерно считать, что в детском возрасте преобладают начальные (поверхностные) формы заболевания, сопровождающиеся повышенной кислотностью, а у взрослых — атрофические формы с низкой кислотностью. Иными словами, во-первых, для формирования хронического атрофического гастрита (ХАГ) необходимо время, во-вторых — именно ХАГ является завершающей (классической) формой ХГ, тогда как остальные морфологические варианты (поверхностный, с поражением желез без атрофии) — промежуточными стадиями, которые необоснованно относят к ФД.

Итак, диагноз хронического гастрита в современных условиях можно поставить в двух случаях: при наличии эрозивных изменений слизистой оболочки (что в детском возрасте встречается не так уж редко) или атрофических изменений СО. При этом в первом случае диагноз может основываться на результатах эндоскопического исследования, во-втором — требуется морфологическое исследование биоптата СО желудка. Эндоскопическое исследование в педиатрической практике является рядовым, морфологическое — эксквизитным. Может быть, именно поэтому существует представление об отсутствии или исключительной редкости атрофического гастрита в детском возрасте.

Атрофия СО фундального отдела или тела желудка с позиций классической патоморфологии представляет собой «необратимую утрату желез желудка с замещением их фиброзной тканью или метаплазированным эпителием». Такое состояние формируется «на протяжении десятилетий, когда хронический гастрит переходит в гастрит атрофический» [14]. P. Sipponen [20] определил хронический гастрит как опосредованный возрастом прогрессирующий процесс, в результате которого происходит «постепенная утрата желез, завершающаяся тотальной атрофией слизистой оболочки»: В МКБ-10 атрофия СО желудка представлена всего лишь одной нозологической формой, имеющей название «хронический атрофический гастрит» (К.29.4).

 Чаще всего атрофия является следствием разрушительного действия на слизистую оболочку желудка, париетальные и главные клетки длительного воспалительного процесса под влиянием инфекцииH.pylori, но может развиться в результате аутоиммунного процесса или длительно текущего рефлюкс-гастрита. Железистая ткань постепенно замещается фиброзной [18, 21]. Сопутствующими факторами на фоне Нр-инфекции являются несбалансированное питание (прежде всего избыток поваренной соли), прием нестероидных противовоспалительных препаратов, курение.

Уже простое перечисление этих факторов свидетельствует о том, что они играют свою роль также в детском и подростковом возрасте: H.pylori-инфекция распространена значительно — у детей с 12-летнего возраста инфицированность практически не отличается от инфицированности взрослых, аллергические и аутоаллергические процессы достаточно часты, дуоденогастральный рефлюкс нередко сопровождает гастродуоденальную патологию, да и курение не столь уж редко, особенно в подростковом возрасте.

Трудно предположить, что перечисленные факторы оказывают патогенное влияние и приводят к развитию атрофического гастрита у взрослых и не сказываются на детях. Следовательно, в детском возрасте имеются все условия для развития атрофического процесса СО желудка, и эти изменения необходимо только выявлять.

О.Я. Бабак [1] отмечает, что естественное течение атрофического гастрита может протекать по двум основным вариантам. Первый — длительно существующий ХГ приводит к значительному снижению кислотообразующей функции желудка, требующему заместительной терапии, без которой будут наблюдаться признаки нарушения пищеварительной функции. Второй вариант — в результате длительного хронического персистирующего воспаления в СО желудка, характерного для H.pylori-ассоциированного гастрита, происходит нарушение клеточного обновления в желудке, что способствует появлению клеток-мишеней для влияния на них канцерогенных веществ, в дальнейшем — к клеточным мутациям. В результате нормальный клеточный эпителий желудка замещается метапластическим, диспластическим и нео­пластическим. Иными словами, атрофический гастрит может по праву считаться предраковым состоянием. Детскому и подростковому возрасту, по-видимому, более присущ первый вариант с постепенным снижением кислотообразующей функции желудка.

Ю.А. Лысиков, Т.А. Малицына и Е.А. Рославцева [9] считают, что атрофические гастриты у детей являются актуальной клинической проблемой, которая до конца не решена по сей день. Авторы приходят к выводу, что микроатрофию различных отделов СО желудка у детей можно выявить только при морфологическом исследовании. Она выражается в уменьшении толщины СО, толщины зоны слизистого эпителия и глубины желез. Атрофия желез заключается в уменьшении численности клеток, продуцирующих пепсины, и париетальных клеток, выделяющих соляную кислоту. Атрофия может затрагивать одну или обе популяции клеток, что приводит к нарушению или уменьшению секреции пепсинов и соляной кислоты. Л.М. Мосийчук и М.Ю. Зак [11] показали, что использование в клинической практике определения уровня G-17 (гастрин) и РG-1 (пепсиноген-1) в сыворотке крови может способствовать (наряду с гастробиопсией) верификации атрофического процесса в желудке. Методика основывается на том, что гастрин-17 (G-17) синтезируется в G-клетках, расположенных в антральном отделе желудка и снижение его уровня в крови может свидетельствовать об атрофических процессах в антральном отделе желудка, Пепсиноген-1 (PG-1) синтезируется в главных клетках, расположенных в фундальном отделе желудка. Снижение уровня PG-1 может свидетельствовать об атрофических процессах в фундальном отделе желудка. Авторы подтверждают точку зрения F. Di Mario, L.G. Cavallaro [17], что на первом этапе больным с диспептическими жалобами необходимо проводить анализ серологических маркеров, а в случае изменения их содержания — эндоскопическое исследование с гастробиопсией. Последнее положение особенно интересно для педиатрической практики, т.к. позволяет ограничить, а иногда и исключить необходимость эндоскопического исследования.

Ряд исследователей [16, 17, 19] подтверждают взаимо­связь между снижением уровня в сыворотке крови G-17 и PG-1 и увеличением степени атрофии СО соответственно антрального отдела и тела желудка.

Выше уже подчеркивалось, что непременным условием верификации атрофического процесса является фиброскопия с гастробиопсией; при этом в терапевтической практике современные требования определяют необходимость взятия не менее пяти биоптатов — трех из антрального отдела и двух из тела желудка, хотя это далеко не всегда позволяет выявить атрофию, которая обычно носит очаговый характер и не всегда, даже при условии взятия пяти биоптатов, попадает в поле зрения патоморфолога [11].

Не это ли обстоятельство является ключевым в плане диагностики хронического атрофического гастрита у детей? Морфологическое исследование СО в педиатрической практике вообще является достаточно редким, проводится только в специализированных учреждениях по специальным показаниям. При этом обычно ограничиваются взятием двух (а иногда и одного) биоптатов. Неудивительно, что в таких условиях атрофия выявляется редко и диагноз «хронический атрофический колит» является эксквизитным. Иными словами, чтобы установить частоту развития хронического атрофического гастрита у детей, необходимы более массовые морфологические исследования с большим числом биоптатов в каждом случае, чего трудно ожидать в ближайшее время в силу хоть и минимальной, но все же инвазивности процедуры, с одной стороны, и необходимости достаточно дорогостоящих морфологических исследований — с другой.

Поделиться своими наблюдениями о выявлении ХАГ в детском возрасте могут только специализированные детские гастроэнтерологические отделения, годами наблюдающие детей с гастродуоденальной патологией и накопившие сведения об эндоскопических и (пусть в редких случаях) морфологических исследованиях. Однако таких сведений в педиатрической литературе явно недостаточно.

Наиболее полную информацию о состоянии проблемы хронического гастрита у детей, в том числе атрофического гастрита, можно получить при анализе ежегодных конференций «Актуальные вопросы абдоминальной патологии у детей», проводимых в Москве или Санкт-Петербурге, в которых принимают активное участие многие практикующие детские гастроэнтерологи России и стран СНГ и практически все профессора, занимающиеся изучением заболеваний пищеварительной системы у детей. По материалам этих конференций издаются солидные сборники, последний ХVII издан в 2010 году.

Анализ публикуемых сообщений показывает, что проблеме хронического гастрита (гастродуоденита) у детей уделяется значительное внимание. И если говорить о трансформации представлений о хроническом гастрите, то основным положением стал пересмотр трактовки минимальных (поверхностных) изменений слизистой оболочки желудка. Начальные поверхностные изменения, которые эндоскопически характеризовались как эритематозная гастропатия, а морфологически — как поверхностный гастрит, перестали считать доказательством наличия воспалительного процесса, полагая, что, поскольку клинические проявления заболевания определяются не наличием эритематозной гастропатии, последнюю следует расценивать как функциональную диспепсию. С точки зрения классической патоморфологии это нонсенс, и патоморфологи никогда не согласятся с подобной трактовкой, но такой подход привел практически к вытеснению диагноза «хронический поверхностный гастрит» из клинической практики. Однако, как ни относиться к подобной трактовке диагноза, очевидно, что к хроническому атрофическому гастриту это не имеет отношения.

О функциональной диспепсии (она же морфологически хронический поверхностный гастрит) пишут очень много, в то же время хроническому атрофическому гастриту посвящены лишь отдельные сообщения.

Л.Н. Малямова, А.М. Чередниченко, С.Ю. Медведева из Екатеринбурга [10], подчеркивая, что вопрос о возможности развития атрофических изменений слизистой оболочки желудка как завершающего этапа длительно текущего воспалительного процесса у детей остается дискуссионным, приводят результаты гистологического исследования СО антрального отдела желудка у 106 детей с хроническим гастритом (гастродуоденитом) с эрозиями, 84 детей — без эрозий и 50 больных с язвенной болезнью. Результаты исследования показали, что только у 3,3 % больных при гистологическом исследовании препаратов антрального отдела желудка атрофические изменения не выявлены. У 22,8 % детей атрофические изменения слизистой оболочки были выражены незначительно: склероз базальных отделов СО желудка имел очаговый характер, при этом объем железистого эпителия был сохранен. У большинства же больных (67,6 %) атрофические изменения СО трактовались как умеренно выраженные, при этом имели место так называемые стромальные изменения в виде гиперплазии ретикулиновых волокон, разрастания гладкомышечных клеток и редко — эластических волокон. Наряду с диффузным склерозом базальных отделов СОЖ имел место и интерстициальный (межуточный) склероз собственной пластинки, а также очаговая атрофия желез, сопровождающаяся уменьшением объема железистого эпителия. И наконец, в ряде случаев (6,2 %) гистологические изменения указывали на выраженную атрофию СО антрального отдела. Последнее касалось прежде всего железистого эпителия, объем которого был значительно уменьшен. Атрофические изменения слизистой оболочки желудка характеризовались не только развитием интерстициального склероза базальных отделов СО, но и замещением высокодифференцированного эпителия метапластическим эпителием, свидетельствующим о нарушении клеточной регенерации с развитием тонкокишечной метаплазии.

Авторы приходят к выводу, что многолетнее течение хронического гастрита (без эрозий, с эрозиями) сопровождается не только активным воспалительным процессом, но и атрофическими изменениями СО, которые сохраняются на фоне проводимой базисной терапии, что требует поиска более эффективных мер реабилитации этих больных.

Атрофические изменения СОЖ выявлены у 10 % наблюдаемых больных московскими исследователями И.В. Сичинавой и соавт. [15]. Атрофические изменения в антральном отделе желудка выявлены у 54,8 % больных и в фундальном — у 25 % детей, проживающих в условиях Курской магнитной аномалии [6]. Л.П. Парменова [13] отмечает, что клинические и морфологические проявления ХГ у детей зависят от основного этиологического фактора и длительности заболевания: при гипоацидности, декомпенсации ощелачивания в антральном отделе желудка при активном процессе атрофия СО антрального и фундального отделов желудка встречается у 30 % детей.

В то же время В.П. Новикова из Санкт-Петербурга [12] лишь у 2 больных из 51 выявила признаки атрофии СОЖ антрального отдела желудка, а белорусские авторы С.Э. Загорский и О.Н. Назаренко [8] из 44 детей с эрозивно-язвенными поражениями желудка и двенадцатиперстной кишки лишь у 1 выявили атрофические изменения СОЖ и у 1 — кишечную метаплазию, что позволило авторам сделать вывод о том, что атрофические и метапластические изменения СОЖ не характерны для детского и подросткового возраста. А.В. Бурлуцкая [4] выявила атрофический гастрит у 17 детей, что составило лишь 2,5 % от общего числа обследованных.

Таким образом, частота ХАГ в детском возрасте, по данным разных авторов, весьма вариабельна, но возможность развития этого заболевания в детском возрасте практически признается всеми авторами.

Имеющиеся в литературе немногочисленные свидетельства о возможности развития ХАГ в детском возрасте подтверждаются исследованиями кафедры педиатрической гастроэнтерологии и нутрициологии Харьковской медицинской академии последипломного образования, проведенными в последние годы [7].

Под наблюдением в детском городском гастроэнтерологическом отделении г. Харькова находились 79 больных, у которых на основании клинического и эндоскопического исследования был установлен диагноз хронического гастрита, в том числе у 2 детей — эрозивный процесс.

Во время проведения фиброгастроскопического исследования у всех детей проводилась прицельная био­псия с наиболее измененных участков антрального отдела желудка (обычно два биоптата).

Гистологическое исследование, проведенное на кафедре патологической анатомии ХМАПО, подтвердило наличие воспалительных изменений СО желудка у 74 из 79 больных (93 ± 3).

Из 74 детей у 25 (34 ± 6 %) отмечался поверхностный гастрит, который характеризовался наличием умеренной лимфоидно-плазматической инфильтрации с небольшим количеством макрофагов, эозинофилов, сегментоядерных лейкоцитов. Толщина СО и структура железистого слоя были сохранены. Активность процесса выявлена у 7 из 28 больных (25,0 ± 8,0 %). Это подтверждалось наличием инфильтрации эпителия и собственного слоя полиморфно­ядерными лейкоцитами на фоне свойственной хроническому гастриту инфильтрации плазматическими клетками и лимфоцитами, а также повреждением эпителия.

У остальных 49 детей (66 ± 6,0 %) морфологически выявлены различные формы атрофического гастрита, что свидетельствует о частоте этой формы заболевания у детей, даже при анализе биопсийного материала только СО антрального отдела желудка.

Начальный атрофический гастрит отмечался у 32 (65 ± 7 %) детей, у 29 из них (91 ± 5 %) выявлено активное воспаление.

При начальном атрофическом гастрите воспалительный инфильтрат локализовался между железами. В строме определялось значительное количество нейтрофильных лейкоцитов, лимфоцитов, плазмоцитов. Встречались отдельные эозинофильные лейкоциты. В поверхностном эпителии определялось снижение секреции мукоида. Наряду с дистрофическими процессами наблюдалась умеренно выраженная дисплазия, особенно в шеечной части желез. На фоне часто встречающейся фовеолярной гиперплазии у 28,3 % больных наблюдалась наиболее высокая степень обсеменения Нр (+++), которая сопровождалась значительной активностью воспалительного процесса.

Умеренная атрофия слизистой оболочки выявлена у 17 больных (35 ± 7 %), из них у 11 (65 ± 12 %) процесс носил активный характер. У больных отмечались патологические изменения в эпителии пилорических желез со снижением количества ШИК-положительных соединений. При этом уменьшалось и количество пилорических желез. В строме определялась инфильтрация лимфоцитами, плазмоцитами, незначительным количеством сегментоядерных лейкоцитов, выявлялись лимфоидные фолликулы.

Сопоставление возраста детей и длительности заболевания с частотой выявления ХАГ показало, что заболевание чаще отмечается у детей старшего возраста, и его длительность составляет не менее 3 лет.

Выводы

1. Хронический атрофический колит у детей не является исключительно редким заболеванием, во всяком случае, встречается чаще, чем диагностируется. Частота ХАГ у детей увеличивается с возрастом и длительностью заболевания.

2. Частота выявления ХАГ зависит от уровня применяемых исследований. Эндоскопические признаки, которые считаются характерными для хронического атрофического гастрита (сглаженность складок слизистой оболочки, их отсутствие на определенных участках, уменьшение размеров желудка), малоинформативны и не дают достаточных оснований для диагностики этой формы заболевания.

3. ХАГ — диагноз морфологический, причем информативность гистологического исследования прямо коррелирует с наличием биопсионного материала из различных отделов желудка (три из антрального отдела и два из тела желудка), что в педиатрической практике практически не делается; диагноз устанавливается на основании одной, редко — двух биопсий, что, безусловно, снижает информативность заключения.

4. Морфологические изменения при ХАГ неоднородны. Умеренная степень атрофии характеризуется наличием не более одного конечного отдела главных желез, которые открываются в одну желудочную ямку, с увеличенным количеством добавочных клеток в составе главных желез, что приводит к развитию пилорической метаплазии желез. В собственной пластинке слизистой оболочки определяются воспалительные изменения и умеренно выраженный фиброз. В некоторых случаях наблюдается умеренная степень атрофии СО тела желудка одновременно с развитием кишечной метаплазии покровно-ямочного эпителия.

Выраженная атрофия СО тела желудка характеризуется резким снижением количества главных желез и ­удлинением желудочных ямок, что иногда сопровождается развитием фовеолярной гиперплазии СО. Качественный состав главных желез изменяется в сторону преобладания добавочных клеток с развитием пилоризации желез. В собственной пластинке СО наблюдаются воспалительные изменения и выраженный фиброз.

5. Перспективным для детской гастроэнтерологии в плане диагностики ХАГ следует считать определение гастрина-1 (G-17) и пепсиногена-1 (PG-1) в сыворотке крови. Информативность этих показателей в плане подтверждения наличия атрофического процесса в СО желудка доказана исследованиями зарубежных и отечественных гастроэнтерологов-терапевтов.

6. Патогенетические особенности ХАГ определяют необходимость дифференцированного подхода к лечению больных, которое должно отличаться от лечения поверхностных и деструктивных форм заболевания и быть направлено прежде всего на стимуляцию репаративных процессов и восстановление желудочной секреции.

Bibliography

1. Бабак О.Я. Атрофический гастрит: прогнозы и перспективы // Здоровье Украины. — 2006. — № 21 (1). — С. 1-3.

2. Белоусов Ю.В. Функциональная диспепсия или хронический гастрит // Здоровье Украины. — 2009. — № 6 (1). — С. 44-45.

3. Белоусов Ю.В., Белоусова О.Ю. Секреторно-моторные взаимо­связи органов гастродуоденальной зоны у детей // Врачебная практика. — 2002. — С. 84-88.

4. Бурлуцкая А.В., Карпенко Л.В., Левицкая Н.В. Структура заболеваемости верхних отделов желудочно-кишечного тракта у детей г. Краснодара по данным детского стационара // Актуальные проблемы абдоминальной патологии у детей. Материалы ХIII Конгресса детских гастроэнтерологов России. — Москва, 2006. — С. 104-105.

5. Волошин К.В. Функціональна диспепсія у дітей: критерії діагностики та диференційної діагностики: Автореф. дис… канд. мед. наук. — Харків, 2010. — 20 с.

6. Гурова М.М., Гусева С.П., Дутлова Е.Д., Ляляева Т.В. Эндоскопические и морфологические особенности хронических гастродуоденитов у детей, проживающих в условиях Курской магнитной аномалии // Актуальные проблемы абдоминальной патологии у детей. Материалы ХI Конгресса детских гастроэнтерологов России. — Москва, 2004. — С. 184-185.

7. Денисюк Т.А. Секреторно-моторні взаємозв’язки у дітей з хронічною Helicobacter pylory-асоційованою гастродуоденальною патологією та ефективність ерадикаційної терапії з використанням вітчизняних препаратів: Автореф. дис… канд. мед. наук. — Харків, 2010. — 20 с.

8. Загорский С.Э., Назаренко А.Н. Морфологические особенности эрозивно-язвенных поражений желудка и двенадцатиперстной кишки у детей и подростков // Актуальные проблемы абдоминальной патологии у детей. Материалы ХVII Конгресса детских гастроэнтерологов России и стран СНГ. — Москва, 2010. — С. 86-87.

9. Лысиков Ю.А., Малицына Т.А., Рославцева Е.А. Трудности в диагностике атрофических гастритов у детей // Педиатрия. — 2006. — № 6. — С. 1-3.

10. Малямова Л.Н., Чередниченко А.М., Медведева С.Ю. Дискуссионные вопросы прогрессирования морфологических изменений слизистой оболочки желудка у детей с хроническими заболеваниями гастродуоденальной области // Актуальные проблемы абдоминальной патологии у детей. Материалы ХI Конгресса детских гастроэнтерологов России. — Москва, 2004. — С. 132-134.

11. Мосійчук Л.М., Зак М.Ю. Оптимізація діагностики хронічного атрофічного гастриту сучасними неінвазивними методами // Сучасна гастроентерологія. — 2010. — № 4 (54). — С. 52-56.

12. Новикова В.П., Мельникова И.Ю., Струков Е.Л., Антонов П.В. Морфологическая картина слизистой оболочки желудка у детей с хроническим гастродуоденитом в сочетании с аутоиммунным тиреоидитом // Актуальные проблемы абдоминальной патологии у детей. Материалы 8-й конференции «Детская гастроэнтерология 2001». — Москва, 2001. — С. 72-73.

13. Парменова Л.П. Клинические и морфологические особенности хронического гастрита у детей // Актуальные проблемы абдоминальной патологи у детей. Материалы ХII Конгресса детских гастроэнтерологов России. — Москва, 2005. — С. 208-209.

14. Пюрвеева К.В., Лапина Т.Л., Ивашкин В.Т. Значение сывороточных показателей пепсиногена-1, пепсиногена-2 и гастрина-17 в диагностике атрофического гастрита // Российский журнал гастроэнтерол., гематолог., колопроктол. — 2005. — № 3. — С. 48-51.

15. Сичинава И.В., Новикова А.В., Каганов Б.С., Шерешевская А.Я. и соавт. Течение хронического гастрита у детей // Актуальные проблемы абдоминальной патологии у детей. Сборник материалов 7-й конференции «Детская гастроэнтерология-2000». — Москва, 2000. — С. 107-108.

16. Chae H., Lee J.H., Lim J. Clinical utility of serum pepsinogen levels as a screening Test of atrophic gastritis // Korean J. Lab. Med. — 2008. — Vol. 28 (3). — P. 201-206.

17. Di Mario E., Cavallaro L.J. Non-invasive tests in gastric di­sease // Dig. Liver. Dis. — 2008. — Vol. 40 (7). — P. 523-530.

18. Fox J.G., Wang T.S. Inflamattion, atrophy, and gastric cancer // J. Clin. Invest. — 2007. — Vol. 117. — P. 60-69.

19. Leverin C., Jacobsson S., Lindstedt G. Serum biomarkers for atrophic gastritis and antibodies against Helicobacter pylori in the elderly: Implications for vitamin B12, foliac acid and iron status and response to oral vitamin therapy // Scand. J. Gastroenterol. — 2008. — Vol. 43 (9). — P. 1050-1056.

20. Sipponen P. Atrophic gastritis as premalignant condition // Ann. Med. — 1989. — Vol. 21. — P. 287-290.

21. Vannelia L., Lahner E., Osborn J. Risk factor for progression to gastric neoplastic lesions in patients with atrophic gastritis // Aliment. Pharmacol. Thier. — 2010. — Vol. 18. — P. 33-37.

Атрофический гастрит — причины, симптомы, диагностика и лечение

Атрофический гастрит – это хронический гастрит типа А, при котором уменьшается количество желудочных желез, снижается кислотообразующая функция. Считается предраковым состоянием. Проявляется тяжестью и тупыми болями в желудке, тошнотой, изжогой, диспепсическими явлениями, анемией. Наиболее значимыми методами диагностики являются: гастроскопия с забором и гистологией биоптатов, различные исследования для определения наличия хеликобактерной инфекции. Менее информативны гастрография, УЗИ органов брюшной полости. Так как 90% атрофий желудка связаны с воздействием хеликобактерий, специфическое лечение включает в себя эрадикацию инфекции. Назначается заместительная и симптоматическая терапия, санаторное лечение и физиотерапия.

Общие сведения

Атрофический гастрит – хроническое прогрессирующее воспаление слизистой желудка, в результате которого полностью утрачиваются обкладочные железы желудка, происходит постепенная атрофия с последующей метаплазией участков слизистой. Основным признаком, который указывает на высокую вероятность рака, является не вид перестройки клеток, а площадь процесса – при распространенности метаплазии на 20% площади слизистой желудка и более вероятность развития рака практически 100%.

По наблюдениям специалистов в сфере практической гастроэнтерологии, хронический атрофический гастрит в 13% случаев заканчивается развитием онкологической патологии. По сравнению с неатрофическим процессом вероятность такого осложнения при атрофическом гастрите в пять раз выше. Основной задачей гастроэнтерологов сегодня является разработка новых, простых и неинвазивных методов достоверной диагностики атрофии, а также ранней диагностики рака желудка. Замечено, что своевременная диагностика и полная эрадикация инфекционного процесса уже через пять лет приводят к восстановлению слизистой желудка и значительному уменьшению площади метаплазии.

Атрофический гастрит

Причины

Основными причинами развития атрофического гастрита являются длительно текущая хеликобактерная инфекция и аутоиммунный процесс, при котором собственные антитела повреждают G-клетки желудка (они являются основной составляющей обкладочных желез). Атрофии железистого эпителия могут способствовать различные сопутствующие заболевания и состояния: бесконтрольный прием медикаментов, алкоголизм, стрессы и выраженное физическое переутомление, различные профессиональные вредности, наследственные особенности работы ЖКТ, тяжелые фоновые заболевания.

Патогенез

H.pylori вызывает хроническое повреждение клеток, ослабляя местные защитные свойства слизистой желудка, что в результате позволяет токсинам и свободным радикалам беспрепятственно проникать в ткани и повреждать ядра клеток. В финале этого процесса клетки приобретают свойства нескольких типов тканей – так называемые гибридные клетки, которые имеют свойства предраковых. Данный процесс называется кишечная метаплазия. Вначале эти участки слизистой приобретают вид тонкокишечного эпителия, затем толстокишечного. Чем дальше зашел процесс метаплазии, тем больше вероятность развития аденокарциномы желудка. На сегодняшний день хеликобактерная инфекция включена в список биологических канцерогенов, ведь без надлежащего лечения она рано или поздно приводит к раку желудка.

Механизм развития аутоиммунного процесса несколько иной. При этом в организме из-за нарушения иммунитета начинают образовываться антитела, которые распознают собственные ткани желудка как чужеродные. Чаще всего антитела вырабатываются к G-клеткам и фактору Касла, который отвечает за всасывание витамина В12. Из-за этого постепенно снижается кислотность желудка, клетки перестраиваются и начинают производить слизь вместо соляной кислоты. В желудке перестают всасываться железо и витамины, развивается тяжелая пернициозная анемия. Если же аутоиммунному гастриту сопутствует хеликобактерная инфекция, предраковое состояние разовьется гораздо быстрее.

Симптомы атрофического гастрита

Патология развивается медленно, поражение при этом начинается со дна желудка, переходя на его тело, а затем и на остальную слизистую. В начале заболевания особой симптоматики может и не быть, что затрудняет диагностику и мешает раннему началу лечения. После развития полной клинической картины у пациента могут выявляться несколько симптомокомплексов.

Анемический синдром развивается из-за нарушения всасывания железа и витаминов (особенно В12, фолиевой кислоты) в полости желудка. Проявляется он выраженной слабостью, утомляемостью, сонливостью, постоянной усталостью (порой даже нарушается обычная деятельность пациента). Кожные покровы и слизистые бледнеют. Пациент отмечает постоянные боли в языке, жжение, слизистая языка становится лаковой. Также больной предъявляет жалобы на нарушения чувствительности в конечностях, обычно симметричные. Характерны сухие волосы и ломкие ногти, беспокоит одышка при незначительных нагрузках, колющие боли в сердце.

Диспепсический синдром проявляется выраженной тяжестью в эпигастрии, реже тупыми ноющими болями в верхней половине живота. Боли связаны с растяжением стенок желудка пищевыми массами из-за нарушений пищеварения. Также пациента беспокоят изжога (забрасывание кислого содержимого в пищевод), срыгивание (забрасывание пищи из желудка в ротовую полость), отрыжка (непроизвольный выход воздуха из желудка). Сопровождаются эти симптомы тошнотой, иногда рвотой, после которой боль в эпигастрии уменьшается. В рвотных массах – большое количество съеденной пищи, слизь, желчь. Аппетит значительно снижен.

Нарушения пищеварения распространяются на другие отделы ЖКТ – появляется дискомфорт в животе, стул становится неустойчивым – запоры сменяются поносами. По утрам во рту неприятный привкус, беспокоит постоянный запах изо рта. Язык обложен сероватым налетом, на нем видны отпечатки зубов. Нарушенное пищеварение и снижение аппетита могут приводить к потере веса, а при отсутствии лечения – к выраженной алиментарной дистрофии. Развивается полигиповитаминоз, который приводит к значительному снижению иммунитета, присоединению различных инфекций.

Диагностика

Сегодня все больше внимания уделяется ранней неинвазивной диагностике атрофического гастрита. Для этого врачами-гастроэнтерологами разработана специальная панель диагностики. При проведении обычной гастроскопии выявить очаги дисплазии эпителия, а тем более определить их площадь не представляется возможным. Из-за этого зачастую возникают ошибки, связанные как с гипердиагностикой, так и гиподиагностикой: площадь гиперплазии может быть оценена неправильно, а воспалительные изменения могут быть приняты за метаплазию эпителия. Для того, чтобы правильно оценить площадь измененного эпителия, взять биопсию из всех измененных участков, во время гастроскопии производится окрашивание слизистой (чаще всего метиленовым синим) – краситель хорошо воспринимается участками с кишечной метаплазией.

Специальная гематологическая панель Biohit позволяет быстро и эффективно определить степень метаплазии эпителия, атрофии слизистой и обкладочных желез, избежать ошибок диагностики. В этой панели исследуется уровень сывороточного пепсиногена, определяется соотношение пепсиногена 1 к пепсиногену 2, гистамина 17. Снижение этих показателей говорит о выраженной атрофии клеток железистого эпителия, а низкий уровень гастрина 17 говорит о гибели G-клеток желез желудка.

В то же время, повышение уровня гастрина 17 и пепсиногена 1 часто ассоциируется с хеликобактерной инфекцией. Значительное повышение уровня гастрина 17 чаще всего связано с аутоиммунным гастритом, при котором наблюдается ахлоргидрия или гипохлоргидрия, сохранена функция антрального отдела желудка. Если же в антральном отделе также имеются очаги атрофии (мультифокальная атрофия), то уровни всех этих показателей будут низкими. Данная панель имеет не менее 80% достоверности, используется на начальных этапах обследования и позволяет определиться с типом гастрита, его локализацией и причиной, выявить предраковое состояние и определить правильную тактику лечения.

В сравнении с гематологической панелью и эндоскопическим исследованием с забором биопсии, остальные методы диагностики атрофического гастрита менее информативны. Так, при гастрографии отмечается сглаженность складок слизистой и замедление перистальтики желудка, размеры его уменьшены. Такая же картина обнаруживается при проведении УЗИ желудка. Внутрижелудочная рН-метрия обнаруживает снижение кислотности желудочного сока. Для уточнения диагноза желательно проводить суточное измерение кислотности.

При подозрении на малигнизацию необходимо провести МСКТ органов брюшной полости для исключения опухолевого процесса. Также обязательно проводятся все необходимые исследования для выявления инфицированности H.pylori: ПЦР-диагностику хеликобактер, дыхательный тест, выявление в крови антител к хеликобактер.

Лечение атрофического гастрита

Основной задачей гастроэнтеролога является предупреждение дальнейшей кишечной метаплазии, раковой трансформации. При своевременном начале лечения атрофического гастрита уже через пять лет наступает значительное улучшение состояния эпителия. Обязательно назначается лечебная диета, которая на начальном этапе включает в себя химически, термически и механически щадящую пищу.

После нормализации состояния допускается употребление химически активных продуктов: разведенных соков (лимонный, капустный, клюквенный). Свежие фрукты из диеты исключаются, можно есть только бананы. К пище предъявляются особые требования – она должна быть теплой (нельзя принимать холодные и горячие продукты), приемы пищи должны быть частыми и дробными. Необходимо исключить спиртные напитки и курение.

При обнаружении хеликобактерной инфекции обязательным условием выздоровления является эрадикация инфекционного агента. Современные протоколы лечения предусматривают назначение двух- или трехкомпонентной схемы, включающей антихеликобактерные антибиотики, ингибиторы протонной помпы, препараты висмута. Только полное излечение от хеликобактерий может привести к восстановлению слизистой и снижению риска малигнизации.

Глюкокортикоидные гормоны при атрофическом гастрите назначаются только при развитии В12-фолиеводефицитной анемии. Также назначается симптоматическое лечение: заместительная терапия натуральным желудочным соком, ферментами, недостающими витаминами, препаратами железа. Для стимуляции секреции соляной кислоты необходимо пить минеральные воды с высоким содержанием солей, отвары трав (подорожник, полынь, фенхель), кислые соки, растворы лимонной и янтарной кислот.

Используются гастропротекторы (мизопростол, карбеноксолон), стимуляторы регенерации (облепиховое масло), обволакивающие средства на основе алюминия и висмута, препараты для улучшения перистальтики. Активно применяется физиотерапия: электрофорез с лекарственными препаратами, электро- и магнитотерапия, тепловые процедуры на область эпигастрия. Санаторно-курортное лечение вне периода обострения включает терапию минеральными водами на бальнеологических курортах.

Прогноз и профилактика

Прогноз атрофического гастрита хуже у пациентов возрастной группы старше 50 лет – в этом возрасте метапластические процессы развиваются гораздо быстрее и чаще приводят к малигнизации. Большое значение для полного выздоровления имеет раннее начало лечения, а также степень эрадикации инфекционного агента. Если при повторном обследовании после курса антихеликобактерной терапии в желудочном содержимом определяются микроорганизмы, то курс следует повторить. Профилактикой развития атрофического гастрита является ранняя диагностика и лечение H.pylori, соблюдение режима дня и рационального питания, гигиены рук для предотвращения инфицирования.

K29.4 — Хронический атрофический гастрит

Входит в группу: K29 — Гастрит и дуоденит

Препараты нозологической группы K29.4

Найдено препаратов:2

Описания препаратов с недействующими рег. уд. или не поставляемые на рынок РФ

Описания активных веществ под международным непатентованным наименованием

Другие подгруппы из нозологической группы: Гастрит и дуоденит

Лечение хронического атрофического гастрита

Лечение хронического атрофического гастрита: избавьтесь от дискомфорта и тяжести в желудке с нашей помощью

Гастриты являются самыми распространенными заболеваниями желудка, их количество достигает 80% от всего количества заболеваний. Ощущение тяжести, изжоги, боли в эпигастрии- частый спутник большинства взрослых людей. Хроническим гастритом страдает около 25% взрослого населения страны. Самым опасным его представителем является хронический атрофический гастрит.

Хронический атрофический гастрит- это заболевание желудка, в основе которого лежит атрофия клеток ткани органа, где расположены железы, вырабатывающие желудочный сок. С течением заболевания железистые клетки утрачивают эту важнейшую для пищеварения функцию, что приводит к проблемам с ЖКТ. Причинами данного заболевания могут быть бактериальное инфицирования и аутоиммунный фактор.

Очень часто причиной атрофического гастрита является бактерия Helicobacter pylori. Под ее влиянием снижается защитная функция желудка, из-за этого токсины могут внедряться в ткань желудка и повреждать его клетки. В результате данного процесса желудочные клетки могут перерождаться в кишечные клетки. Бактерия Helicobacter pylori является канцерогеном (т. е. веществом, стимулирующим злокачественные процессы в организме). Научно доказано, что данная бактерия провоцирует развитие рака желудка. По данным статистики около 80% населения планеты являются носителями бактерии.

Частота хронического атрофического гастрита растет с увеличением возраста пациентов. У молодых людей до 30ти лет атрофический гастрит встречается у 5%, у людей же, в возрасте 30-50лет риск возрастает уже до 30%. Среди людей зрелого и пожилого возраста данный показатель достигает 65-70%.

Симптомы хронического атрофического гастрита

К симптомам данного заболевания можно отнести тошноту, отрыжку непереваренной пищей, неприятный запах изо рта, обильное слюнотечение, ноющие боли в эпигастрии, особенно после приема пищи, вздутие живота, метеоризм, расстройства стула и белый налет на языке.

Ни в коем случае не стоит игнорировать данные симптомы, ведь при несвоевременном лечении хронического атрофического гастрита он может с легкостью перерасти в рак желудка. Хорошие врачи нашего медицинского центра проведут тщательную диагностику и назначат качественное лечение современными и безопасными препаратами.

Диагностика хронического атрофического гастрита

Основным методом диагностики данного заболевания является ЭГДС (эзофагогастродуоденоскопия). Также в обязательном порядке больным с подозрением на хронический атрофический гастрит назначаются анализы на обнаружение Helicobacter pylori (биохимические методы, гистологические и цитологические исследования и мазок со слизистой желудка для выявления возбудителя и анализа на чувствительность к антибактериальным препаратам). Дополнительным диагностическим методом может стать УЗИ органов брюшной полости и внутрижелудочная рН – метрия (исследование, нацеленное на измерение секреции и диагностику нарушений в выделении желудочного сока).

Лечение хронического атрофического гастрита

В первую очередь не стоит пренебрегать общими рекомендациями: отказаться от курения, прекратить прием препаратов, раздражающих стенки желудка, соблюдать щадящую диету с исключением алкоголя, жаренной и тяжелой пищи.

Золотым стандартом при лечении хронического атрофического гастрита, вызванного Helicobacter pylori является правильно подобранная терапия антибактериальными препаратами. Также назначаются препараты, подавляющие излишнюю выработку желудочного сока (ингибиторы протонной помпы), производные висмута, анальгетики (альмагель А), а также ферментные препараты. Запомните, никогда не стоит самостоятельно назначать себе препараты для лечения хронического гастрита, поскольку это может привезти к непредсказуемым и опасным последствиям. Запишитесь на прием к нашему доктору и ознакомьтесь с отзывами о его работе на сайте нашего медицинского центра.

Аутоиммунный атрофический гастрит — патогенез, патология и лечение

  • Rugge, M. et al . Атрофия слизистой оболочки желудка: согласованность между наблюдателями с использованием новых критериев классификации и оценки. Алимент. Фармакол. тер. 16 , 1249–1259 (2002).

    Артикул КАС пабмед Google ученый

  • Coombs, C.F. Заметка о сердечных симптомах пернициозной анемии. руб. Мед. J. 2 , 185 (1926).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Addison, T. Заболевание: хроническая надпочечная недостаточность, обычно обусловленная туберкулезом надпочечников. London Medical Gazette 43 , 517–518 (1849).

    Google ученый

  • Флинт А. Клиническая лекция по анемии. American Medical Times 1 , 181–186 (1860).

    Google ученый

  • Biermer, M. A. Über eine eigentümliche Form von Progresser, pernicioser Anaemie [немецкий]. Correspondenz-Blatt für Schweizer Aerzte 2 , 15–17 (1872 г.).

    Google ученый

  • Мапел, Д., Робертс, М., Оверхайзер, А. и Мейсон, А. Эпидемиология, диагностика и стоимость диспепсии и гастрита Helicobacter pylori : анализ случай-контроль на юго-западе США. Helicobacter 18 , 54–65 (2013).

    Артикул пабмед Google ученый

  • Гох К.Л., Чан В.К., Шиота С. и Ямаока Ю. Эпидемиология инфекции Helicobacter pylori и последствия для общественного здравоохранения. Helicobacter 16 (Приложение 1), 1–9 (2011).

    Артикул пабмед ПабМед Центральный Google ученый

  • Тан, Х.J. & Goh, KL. Изменение эпидемиологии Helicobacter pylori в Азии. Дж. Коп. Дис. 9 , 186–189 (2008).

    Артикул пабмед Google ученый

  • Брюс, М. Г. и Маарус, Х. И. Эпидемиология инфекции Helicobacter pylori . Helicobacter 13 (Приложение 1), 1–6 (2008).

    Артикул пабмед Google ученый

  • Малати, Х.М. Эпидемиология инфекции Helicobacter pylori . Лучшая практика. Рез. клин. Гастроэнтерол. 21 , 205–214 (2007).

    Артикул пабмед ПабМед Центральный Google ученый

  • Грэм Д.Ю. Изменение эпидемиологии ГЭРБ: география и Helicobacter pylori . утра. Дж. Гастроэнтерол. 98 , 1462–1470 (2003).

    Артикул пабмед Google ученый

  • Браун, Л.М. Helicobacter pylori : эпидемиология и пути передачи. Эпидемиол. Ред. 22 , 283–297 (2000).

    Артикул КАС пабмед Google ученый

  • Рук, Г. А. и Брюнет, Л. Р. Микробы, иммунорегуляция и кишечник. Гут 54 , 317–320 (2005).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Штрауманн, А.Эозинофильный эзофагит: быстро развивающееся заболевание. Швейцарский мед. Неделя 142 , w13513 (2012).

    ПабМед Google ученый

  • Арнольд, И. К. и др. . Инфекция Helicobacter pylori предотвращает аллергическую астму на моделях мышей за счет индукции регуляторных Т-клеток. Дж. Клин. Вкладывать деньги. 121 , 3088–3093 (2011).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Чен Ю.& Blaser, MJ. Обратные ассоциации Helicobacter pylori с астмой и аллергией. Арх. Стажер Мед. 167 , 821–827 (2007).

    Артикул пабмед ПабМед Центральный Google ученый

  • Ругге М. и др. . Аутоиммунный гастрит: гистологический фенотип и стадия OLGA. Алимент. Фармакол. тер. 35 , 1460–1466 (2012).

    Артикул КАС пабмед Google ученый

  • Левин, С.& Ladd, WS Пернициозная анемия: клиническое исследование ста пятидесяти последовательных случаев с особым упором на ацидность желудка. Больница Джона Хопкинса. Бык. 32 , 254–266 (1921).

    Google ученый

  • Фридлендер, Р. Д. Расовый фактор пернициозной анемии: исследование пятисот случаев. утра. Дж. Мед. науч. 187 , 634–642 (1934).

    Артикул Google ученый

  • Парк, Дж.Y., Cornish, T.C., Lam-Himlin, D., Shi, C. & Montgomery, E. Поражения желудка у пациентов с аутоиммунным метапластическим атрофическим гастритом (AMAG) в условиях третичной помощи. утра. Дж. Сур. Патол. 34 , 1591–1598 (2010).

    ПабМед Google ученый

  • Борди, К. и др. . Разрастания эндокринных клеток при атрофическом гастрите тела. Критическая оценка гистологической классификации. Дж. Патол. 182 , 339–346 (1997).

    Артикул КАС пабмед Google ученый

  • Гершко С. и др. . Вариабельные гематологические проявления аутоиммунного гастрита: возрастное прогрессирование от дефицита железа до истощения запасов кобаламина. Кровь 107 , 1673–1679 (2006).

    Артикул КАС пабмед Google ученый

  • Ланер, Э. и др. . Возникновение и факторы риска аутоиммунных заболеваний щитовидной железы у больных атрофическим органным гастритом. утра. Дж. Мед. 121 , 136–141 (2008).

    Артикул пабмед Google ученый

  • Кармель, Р. Распространенность невыявленной пернициозной анемии у пожилых людей. Арх. Стажер Мед. 156 , 1097–1100 (1996).

    Артикул КАС пабмед Google ученый

  • Эйдт, С., Оберхубер Г., Шнайдер А. и Столте М. Гистопатологический спектр гастрита типа А. Патол. Рез. Практика. 192 , 101–106 (1996).

    Артикул КАС пабмед Google ученый

  • Кармел Р. и Джонсон К. С. Расовые особенности пернициозной анемии. Ранний возраст начала и повышенная частота антител к внутреннему фактору у чернокожих женщин. Н. англ. Дж. Мед. 298 , 647–650 (1978).

    Артикул КАС пабмед Google ученый

  • Кармель, Р., Джонсон, К. С. и Вайнер, Дж. М. Пернициозная анемия у жителей Латинской Америки не является болезнью пожилых людей. Арх. Стажер Мед. 147 , 1995–1996 (1987).

    Артикул КАС пабмед Google ученый

  • Андрес, Э. и др. . Клинические аспекты дефицита кобаламина у пожилых пациентов.Эпидемиология, причины, клинические проявления и лечение с особым акцентом на пероральную терапию кобаламином. евро. Дж. Стажер. Мед. 18 , 456–462 (2007).

    Артикул КАС пабмед Google ученый

  • Андрес, Э. и др. . Дефицит витамина В12 (кобаламина) у пожилых пациентов. CMAJ 171 , 251–259 (2004).

    Артикул пабмед ПабМед Центральный Google ученый

  • Чан, Дж.С. и др. . Продольное исследование китайских пациентов с пернициозной анемией. Аспирантура. Мед. J. 84 , 644–650 (2008).

    Артикул КАС пабмед Google ученый

  • Чук, П.О., Трауб, Н.Е. и Патель, И.К. Пернициозная анемия у замбийца. Восточная Африка Мед. J. 49 , 681–683 (1972).

    КАС пабмед Google ученый

  • Кочак Р.& Paydas, S. Пернициозная анемия в Турции. Междунар. Дж. Гематол. 55 , 117–119 (1992).

    КАС пабмед Google ученый

  • Мактуф, К. и др. . Мегалобластная анемия в Северной Африке. Haematologica 91 , 990–991 (2006).

    ПабМед Google ученый

  • Шлемпер Р. Дж., ван дер Верф С.D., Vandenbroucke, JP, Biemond, I. & Lamers, CB Сероэпидемиология гастрита у работающего населения Японии и Нидерландов: доказательства развития атрофического гастрита, не связанного с Helicobacter pylori . Гут 37 , 199–204 (1995).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Век, М. Н. и Бреннер, Х. Распространенность хронического атрофического гастрита в разных частях мира. Рак Эпидемиол. Биомаркеры Пред. 15 , 1083–1094 (2006).

    Артикул пабмед Google ученый

  • Вун Чан, Дж. К. и др. . Пернициозная анемия по-китайски: исследование 181 пациента в больнице Гонконга. Медицина (Балтимор) 85 , 129–138 (2006).

    Артикул Google ученый

  • Клэйс, Д., Faller, G., Appelmelk, BJ, Negrini, R. & Kirchner, T. Желудочная H + , K + -АТФаза является основным аутоантигеном при хроническом Helicobacter pylori гастрите с атрофией слизистой оболочки тела. Гастроэнтерология 115 , 340–347 (1998).

    Артикул КАС пабмед Google ученый

  • Негрини Р. и др. . Инфекция Helicobacter pylori индуцирует антитела, перекрестно реагирующие со слизистой оболочкой желудка человека. Гастроэнтерология 101 , 437–445 (1991).

    Артикул КАС пабмед Google ученый

  • Негрини Р. и др. . Антигенная мимикрия между Helicobacter pylori и слизистой оболочкой желудка в патогенезе телесного атрофического гастрита. Гастроэнтерология 111 , 655–665 (1996).

    Артикул КАС пабмед Google ученый

  • Фаллер, Г. и др. . Антигастральные аутоантитела при гастрите Helicobacter pylori : распространенность, сайты связывания in situ и ключи к клинической значимости. Арка Вирхова. 427 , 483–486 (1996).

    Артикул КАС пабмед Google ученый

  • Faller, G. и др. . Антигастральные аутоантитела при инфекции Helicobacter pylori : значение гистологических и клинических параметров гастрита. Gut 41 , 619–623 (1997).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Аппельмельк, Б. Дж., Фаллер, Г., Клэйс, Д., Киршнер, Т. и Ванденбрук-Граулс, К. М. Ошибки под следствием: дело о Helicobacter pylori и аутоиммунитете. Иммунол. Сегодня 19 , 296–299 (1998).

    Артикул КАС пабмед Google ученый

  • Бергман М.С. и др. . История до сих пор: Helicobacter pylori и аутоиммунитет желудка. Междунар. Преподобный Иммунол. 24 , 63–91 (2005).

    Артикул КАС пабмед Google ученый

  • Д’Элиос, М. М., Аппельмельк, Б. Дж., Амедей, А., Бергман, М. П. и Дел, П. Г. Аутоиммунитет желудка: роль Helicobacter pylori и молекулярная мимикрия. Тенденции Мол. Мед. 10 , 316–323 (2004).

    Артикул КАС пабмед Google ученый

  • D’Elios, M.M., Bergman, M.P., Amedei, A., Appelmelk, BJ & Del, P.G. Helicobacter pylori и аутоиммунитет желудка. Заражение микробами. 6 , 1395–1401 (2004).

    Артикул КАС пабмед Google ученый

  • Агрей Л. и др. . Обоснование диагностики и скрининга атрофического гастрита с помощью биомаркеров плазмы, специфичных для желудка. Скан. Дж. Гастроэнтерол. 47 , 136–147 (2012).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Столте М. и др. . Активный аутоиммунный гастрит без тотальной атрофии желез. З. Гастроэнтерол. 30 , 729–735 (1992).

    КАС пабмед Google ученый

  • Столте, М., Meier, E. & Meining, A. Лечение аутоиммунного гастрита путем эрадикации Helicobacter pylori у 21-летнего мужчины. З. Гастроэнтерол. 36 , 641–643 (1998).

    КАС пабмед Google ученый

  • Muller, H., Rappel, S., Wundisch, T., Bayerdorffer, E. & Stolte, M. Лечение активного неатрофического аутоиммунного гастрита путем эрадикации H. pylori . Digestion 64 , 30–39 (2001).

    Артикул КАС пабмед Google ученый

  • Бергман, М. П. и Д’Элиос, М. М. Цитотоксические Т-клетки в, H. pylori , связанный с аутоиммунитетом желудка и лимфомой желудка. Дж. Биомед. Биотехнолог. 2010 , 104918 (2010).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Негрини Р., Савио А.и Appelmelk, BJ. Аутоантитела к слизистой оболочке желудка при инфекции Helicobacter pylori . Helicobacter 2 (Приложение 1), S13–S16 (1997).

    Артикул пабмед Google ученый

  • Д’Элиос, М. М. и др. . Молекулярная специфичность и функциональные свойства аутореактивного Т-клеточного ответа при желудочном аутоиммунитете человека. Междунар. Преподобный Иммунол. 24 , 111–122 (2005).

    Артикул КАС пабмед Google ученый

  • Бергман, М., Дель, П. Г., ван Койк, Ю. и Аппельмелк, Б. Helicobacter pylori фазовые вариации, иммунная модуляция и аутоиммунитет желудка. Нац. Преподобный Микробиолог. 4 , 151–159 (2006).

    Артикул КАС пабмед Google ученый

  • Оксанен А. и др. .Атрофический гастрит и инфекция Helicobacter pylori у амбулаторных больных, направленных на гастроскопию. Гут 46 , 460–463 (2000).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Вейола Л.И., Оксанен А.М., Сиппонен П.И. и Раутелин Х.И. Ассоциация атрофического гастрита тела аутоиммунного типа с инфекцией Helicobacter pylori . Мир Дж.Гастроэнтерол. 16 , 83–88 (2010).

    КАС пабмед ПабМед Центральный Google ученый

  • Бедейр, А. С., Лаш, Р. Х., Лаш, Дж. Г. и Рэй, М. Б. Значительное увеличение количества плазматических клеток IgG4+ в образцах биопсии желудка у пациентов с пернициозной анемией. Дж. Клин. Патол. 63 , 999–1001 (2010).

    Артикул КАС пабмед Google ученый

  • Гершвин М.E. & Shoenfeld, Y. Передовые проблемы органоспецифического аутоиммунитета. клин. Преподобный Аллергия Иммунол. 41 , 123–125 (2011).

    Артикул КАС пабмед Google ученый

  • Banka, S., Ryan, K., Thomson, W. & Newman, W.G. Пернициозная анемия — генетическое понимание. Аутоиммун. Ред. 10 , 455–459 (2011).

    Артикул пабмед Google ученый

  • Охана, М. и др. . Ингибирующее действие инфекции Helicobacter pylori на мышиный аутоиммунный гастрит. Гут 52 , 1102–1110 (2003).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Cruchaud, A. & Juditz, E. Анализ антител к париетальным клеткам желудка и антителам к клеткам щитовидной железы у пациентов с пернициозной анемией и заболеваниями щитовидной железы. клин. Эксп.Иммунол. 3 , 771–781 (1968).

    КАС пабмед ПабМед Центральный Google ученый

  • Дониач Д., Ройтт И.М. и Тейлор К.Б. Аутоиммунные явления при пернициозной анемии. Серологическое совпадение с тиреоидитом, тиреотоксикозом и системной красной волчанкой. руб. Мед. J. 1 , 1374–1379 (1963).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Дониач Д., Грант, Д. и Ньюнс, Г. Х. Мультиэндокринное аутоиммунное расстройство у матери и сына. Проц. Р. Соц. Мед. 65 , 488–490 (1972).

    КАС пабмед ПабМед Центральный Google ученый

  • Ирвин В.Дж., Саммерлинг М.Д. и Дэвис С.Х. Иммунологические аспекты пернициозной анемии. Библ. Гематол. 23 , 73–78 (1965).

    КАС пабмед Google ученый

  • Ирвин, В.Дж., Каллен, Д. Р. и Мохинни, Х. Естественная история аутоиммунного ахлоргидрического атрофического гастрита. Последующее исследование в течение 1–15 лет. Ланцет 2 , 482–485 (1974).

    Артикул КАС пабмед Google ученый

  • Singer, W. & Sahay, B.M. Myasthenia Gravis, тиреоидит Хашимото и пернициозная анемия. руб. Мед. J. 1 , 904 (1966).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Марксон, Дж.Л. и Мур, Дж. М. Аутоантитела щитовидной железы при пернициозной анемии. руб. Мед. J. 2 , 1352–1355 (1962).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Feldt-Rasmussen, U. и др. . Аутоантитела, иммунные комплексы и HLA-D при тиреогастральном аутоиммунитете. Tissue Antigens 22 , 342–347 (1983).

    Артикул КАС пабмед Google ученый

  • Оттесен, М., Feldt-Rasmussen, U., Andersen, J., Hippe, E. & Schouboe, A. Функция щитовидной железы и аутоиммунитет при пернициозной анемии до и во время лечения цианокобаламином. Дж. Эндокринол. Вкладывать деньги. 18 , 91–97 (1995).

    Артикул КАС пабмед Google ученый

  • Чанарин И. Пернициозная анемия как аутоиммунное заболевание. руб. Дж. Гематол. 23 (Дополнение), 101–107 (1972).

    Артикул Google ученый

  • Перрос, П., Сингх Р.К., Лудлам С.А. и Фрайер Б.М. Распространенность пернициозной анемии у пациентов с сахарным диабетом 1 типа и аутоиммунным заболеванием щитовидной железы. Диабет. Мед. 17 , 749–751 (2000).

    Артикул КАС пабмед Google ученый

  • Giannouli, S., Anagnostou, D., Soliotis, F. & Voulgarelis, M. Аутоиммунные проявления при общем вариабельном иммунодефиците. клин. Ревматол. 23 , 449–452 (2004).

    Артикул пабмед Google ученый

  • Хасидзуме Т. Синдром Гуда и пернициозная анемия. Интерн. Мед. 41 , 1062–1064 (2002).

    Артикул пабмед Google ученый

  • Коскинен, С. Долгосрочное наблюдение за состоянием здоровья доноров крови с первичным селективным дефицитом IgA. Дж. Клин. Иммунол. 16 , 165–170 (1996).

    Артикул КАС пабмед Google ученый

  • Лакманн Г. М., Ван В., Поремба К. и Нихьюс Т. Подросток с Х-сцепленной агаммаглобулинемией и анемией, вызванной дефицитом витамина В12. Ж. Педиатр. Гастроэнтерол. Нутр. 41 , 360–362 (2005).

    Артикул КАС пабмед Google ученый

  • Каллендер, С. Т. и Денборо, М.A. Семейное исследование пернициозной анемии. руб. Дж. Гематол. 3 , 88–106 (1957).

    Артикул КАС пабмед Google ученый

  • Тох, Б. Х., ван Дриэль, И. Р. и Глисон, П. А. Пернициозная анемия. Н. англ. Дж. Мед. 337 , 1441–1448 (1997).

    Артикул КАС пабмед Google ученый

  • Делва, П.Л., Макдонелл, Дж. Э. и Макинтош, О. С. Мегалобластная анемия, возникающая одновременно у белых монозиготных близнецов женского пола. Кан. Мед. доц. J. 92 , 1129–1131 (1965).

    КАС пабмед ПабМед Центральный Google ученый

  • Масноу, Х. и др. . Пернициозная анемия у тройни. Отчет о клиническом случае и обзор литературы. Гастроэнтерол. Гепатол. 30 , 580–582 (2007).

    Артикул пабмед Google ученый

  • Корреа, П., Пьясуэло, М. Б. и Уилсон, К. Т. Патология желудочно-кишечной метаплазии: клинические последствия. утра. Дж. Гастроэнтерол. 105 , 493–498 (2010).

    Артикул пабмед ПабМед Центральный Google ученый

  • Голденринг, Дж. Р., Нам, К. Т. и Миллс, Дж. К. Происхождение преднеопластической метаплазии в желудке: главные клетки появляются из Тумана. Экспл. Сотовый рез. 317 , 2759–2764 (2011).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Джхала, Северная Каролина и др. . Ацинарно-клеточная метаплазия поджелудочной железы при аутоиммунном гастрите. Арх. Патол. лаборатория Мед. 127 , 854–857 (2003).

    ПабМед Google ученый

  • Беттингтон, М.и Браун, И. Аутоиммунный гастрит: новые ключи к гистологическому диагнозу. Патология 45 , 145–149 (2013).

    Артикул КАС пабмед Google ученый

  • Solcia, E., Rindi, G., Silini, E. & Villani, L. Энтерохромаффиноподобные (ECL) клетки и их рост: связь с гастрином, снижение секреции кислоты и гастрит. Байер Клиник. Гастроэнтерол. 7 , 149–165 (1993).

    Артикул КАС пабмед Google ученый

  • Солсия, Э. и др. . Морфология и патогенез эндокринных гиперплазий, предкарциноидных поражений и карциноидов, возникающих при хроническом атрофическом гастрите. Скан. Дж. Гастроэнтерол. Доп. 180 , 146–159 (1991).

    Артикул КАС пабмед Google ученый

  • Солсия, Э. и др. . Различные модели хронического гастрита, связанные с карциноидом и раком, и их роль в онкогенезе. Йель Дж. Биол. Мед. 65 , 793–804 (1992).

    КАС пабмед ПабМед Центральный Google ученый

  • Торбенсон, М., Абрахам, С. К., Бойтнотт, Дж., Ярдли, Дж. Х. и Ву, Т. Т. Аутоиммунный гастрит: отчетливые гистологические и иммуногистохимические данные до полной потери оксинтических желез. мод. Патол. 15 , 102–109 (2002).

    Артикул пабмед Google ученый

  • Junca J., de Soria, P.L., Granada, M.L., Flores, A. & Marquez, E. Выявление ранних нарушений функции желудка у ближайших родственников пациентов с пернициозной анемией. евро. Дж. Гематол. 77 , 518–522 (2006).

    Артикул пабмед Google ученый

  • Ицуно М. и др. . Множественные карциноиды и микрогнезда эндокринных клеток при гастрите типа А. Их морфология, гистогенез и естественная история. Рак 63 , 881–890 (1989).

    Артикул КАС пабмед Google ученый

  • Muller, J., Kirchner, T. & Muller-Hermelink, H.K. Гиперплазия эндокринных клеток желудка и карциноидные опухоли при атрофическом гастрите типа A. Am. Дж. Сур. Патол. 11 , 909–917 (1987).

    Артикул КАС пабмед Google ученый

  • Ругге М. и др. . OLGA стадирование гастрита: учебное пособие. Коп. Дис печени. 40 , 650–658 (2008).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Ругге, М. и Гента, Р. М. Стадирование и классификация хронического гастрита. Гул. Патол. 36 , 228–233 (2005).

    Артикул пабмед Google ученый

  • Ругге М., и др. . Гастрит OLGA-стадия и риск рака желудка: двенадцатилетнее клинико-патологическое последующее исследование. Алимент. Фармакол. тер. 31 , 1104–1111 (2010).

    КАС пабмед Google ученый

  • Сато К. и др. .Оценка атрофического гастрита по системе OLGA. Helicobacter 13 , 225–229 (2008).

    Артикул пабмед Google ученый

  • Евремович Д., Торбенсон М., Мюррей Дж. А., Бургарт Л. Дж. и Абрахам С. К. Атрофический аутоиммунный пангастрит: особая форма антрального и фундального гастрита, связанная с системным аутоиммунным заболеванием. утра. Дж. Сур. Патол. 30 , 1412–1419 (2006).

    Артикул пабмед Google ученый

  • Солсия, Э. и др. . Естественная история, клинико-патологическая классификация и прогноз опухолей клеток ECL желудка. Йель Дж. Биол. Мед. 71 , 285–290 (1998).

    КАС пабмед ПабМед Центральный Google ученый

  • Кокберн, А. Н., Морган, С. Дж. и Гента, Р. М. Нейроэндокринные пролиферации желудка: прагматический подход для озадаченного патологоанатома. Доп. Анат. Патол. 20 , 148–157 (2013).

    Артикул КАС пабмед Google ученый

  • Солсия, Э. и др. . в Классификация ВОЗ опухолей пищеварительной системы , 2-е изд. (под редакцией Bosman, F.T., Carneiro, F., Hruban, R.H. & Theise, N.D.) 64–68 (IARC, 2010).

    Google ученый

  • Кармак, С.W., Genta, RM, Graham, D.Y. & Lauwers, G.Y. Лечение полипов желудка: основанное на патологии руководство для гастроэнтерологов. Нац. Преподобный Гастроэнтерол. Гепатол. 6 , 331–341 (2009).

    Артикул пабмед ПабМед Центральный Google ученый

  • Shaib, Y.H., Rugge, M., Graham, D.Y. & Genta, RM. Лечение полипов желудка: эндоскопический подход. клин. Гастроэнтерол. Гепатол. http://dx.doi.org/10.1016/j.cgh.2013.03.019.

  • Абрахам, С. К., Сингх, В. К., Ярдли, Дж. Х. и Ву, Т. Т. Гиперпластические полипы желудка: ассоциации с гистологическими картинами гастрита и атрофии желудка. утра. Дж. Сур. Патол. 25 , 500–507 (2001).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Харума К., Сумии К., Йошихара М., Watanabe, C. & Kajiyama, G. Слизистая оболочка желудка у женщин с фундальными железистыми полипами. Дж. Клин. Гастроэнтерол. 13 , 565–569 (1991).

    Артикул КАС пабмед Google ученый

  • Харума К. и др. . Пернициозная анемия и инфекция Helicobacter pylori в Японии: оценка в стране с высокой распространенностью инфекции. утра. Дж. Гастроэнтерол. 90 , 1107–1110 (1995).

    КАС пабмед Google ученый

  • Laxen, F. Карцинома желудка и пернициозная анемия при длительном эндоскопическом наблюдении за пациентами с полипами желудка. Скан. Дж. Гастроэнтерол. 19 , 535–540 (1984).

    Артикул КАС пабмед Google ученый

  • Лаксен Ф., Кекки М., Сиппонен П. и Сиурала М. Слизистая оболочка желудка с полипами: морфологическая и динамическая оценка. Скан. Дж. Гастроэнтерол. 18 , 503–511 (1983).

    Артикул КАС пабмед Google ученый

  • Варис, К., Стенман, У. Х., Лехтола, Дж. и Сиурала, М. Поражение желудка и пернициозная анемия: семейное исследование. Акта Гепатогастроэнтерол. (Штуттг.) 25 , 62–67 (1978).

    КАС Google ученый

  • Красинскас А.М., Абрахам, С.К., Мец, Д.К. и Фурт, Э.Е. Псевдополипы оксинетической слизистой оболочки: проявление атрофического аутоиммунного гастрита. утра. Дж. Сур. Патол. 27 , 236–241 (2003).

    Артикул пабмед Google ученый

  • Vieth, M., Kushima, R., Borchard, F. & Stolte, M. Аденома привратника: клинико-патологический анализ 90 случаев. Арка Вирхова. 442 , 317–321 (2003).

    КАС пабмед Google ученый

  • Chen, Z.M., Scudiere, J.R., Abraham, S.C. & Montgomery, E. Аденома пилорической железы: образование, отличное от аденомы фовеолярного типа желудка. утра. Дж. Сур. Патол. 33 , 186–193 (2009).

    Артикул пабмед Google ученый

  • Абрахам, С. К., Монтгомери, Э. А., Сингх, В. К., Ярдли, Дж.H. & Wu, TT Аденомы желудка: аденомы кишечного и желудочного типа различаются по риску аденокарциномы и наличию фоновой патологии слизистой оболочки. утра. Дж. Сур. Патол. 26 , 1276–1285 (2002).

    Артикул пабмед Google ученый

  • Мацубара А. и др. . Частые мутации GNAS и KRAS при аденомах пилорических желез желудка и двенадцатиперстной кишки. Дж. Патол. 229 , 579–587 (2013).

    Артикул КАС пабмед Google ученый

  • Strickland, R.G. & Mackay, I.R. Переоценка природы и значения хронического атрофического гастрита. утра. Дж. Диг. Дис. 18 , 426–440 (1973).

    Артикул КАС пабмед Google ученый

  • Ваннелла, Л. и др. . Факторы риска прогрессирования неопластических поражений желудка у больных атрофическим гастритом. Алимент. Фармакол. тер. 31 , 1042–1050 (2010).

    КАС пабмед Google ученый

  • Vannella, L., Lahner, E. & Annibale, B. Риск неоплазии желудка у пациентов с хроническим атрофическим гастритом: критическая переоценка. Мир Дж. Гастроэнтерол. 18 , 1279–1285 (2012).

    Артикул пабмед ПабМед Центральный Google ученый

  • Vannella, L., Lahner, E., Osborn, J. & Annibale, B. Систематический обзор: заболеваемость раком желудка при пернициозной анемии. Алимент. Фармакол. тер. 37 , 375–382 (2012).

    Артикул КАС пабмед Google ученый

  • Borch, K. Эпидемиологические, клинико-патологические и экономические аспекты гастроскопического скрининга пациентов с пернициозной анемией. Скан. Дж. Гастроэнтерол. 21 , 21–30 (1986).

    Артикул КАС пабмед Google ученый

  • Брески Г. и др. . Эндоскопические данные в двухгодичной программе наблюдения за пациентами с пернициозной анемией. Гепатогастроэнтерология 50 , 2264–2266 (2003).

    КАС пабмед Google ученый

  • Эльсборг, Л., Andersen, D. & Bastrup-Madsen, P. Скрининг с помощью гастрокамеры при пернициозной анемии. С особым акцентом на возникновение полипов желудка и рака. Скан. Дж. Гастроэнтерол. 8 , 5–8 (1973).

    КАС пабмед Google ученый

  • Коккола А. и др. . Риск рака желудка и карциноидных опухолей у больных пернициозной анемией. Проспективное последующее исследование. Скан.Дж. Гастроэнтерол. 33 , 88–92 (1998).

    Артикул КАС пабмед Google ученый

  • Сьоблом, С. М., Сиппонен, П. и Ярвинен, Х. Гастроскопическое наблюдение за пациентами с пернициозной анемией. Gut 34 , 28–32 (1993).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Аннибале, Б. и др. .Две трети пациентов с атрофическим гастритом тела имеют признаки инфекции Helicobacter pylori . Helicobacter 6 , 225–233 (2001).

    Артикул КАС пабмед Google ученый

  • Ланер, Э. и др. . Первое эндоскопически-гистологическое исследование больных атрофическим гастритом с преобладанием тела: когда его проводить? Гастроинтест. Эндоск. 53 , 443–448 (2001).

    Артикул КАС пабмед Google ученый

  • Руис Б. и др. . Морфометрическая оценка атрофии антрального отдела желудка: сравнение с визуальной оценкой. Гистопатология 39 , 235–242 (2001).

    Артикул КАС пабмед Google ученый

  • Genta, R.M. Обзорная статья: Атрофия желудка и атрофический гастрит — туманные понятия в поисках определения. Алимент. Фармакол. тер. 12 (Приложение 1), 17–23 (1998).

    Артикул пабмед Google ученый

  • Диксон, М. Ф., Гента, Р. М., Ярдли, Дж. Х. и Корреа, П. Классификация и градация гастрита. Обновленная Сиднейская система. Международный семинар по гистопатологии гастрита, Хьюстон, 1994. утра. Дж. Сур. Патол. 20 , 1161–1181 (1996).

    Артикул КАС пабмед Google ученый

  • Ваннелла, Л. и др. . Развитие карциноида желудка I типа у больных хроническим атрофическим гастритом. Алимент. Фармакол. тер. 33 , 1361–1369 (2011).

    Артикул КАС пабмед Google ученый

  • Аннибале, Б. и др. . Пациенты с атрофическим гастритом тела с дисплазией энтерохромаффинных клеток имеют повышенный риск развития карциноида желудка I типа. евро.Дж. Гастроэнтерол. Гепатол. 13 , 1449–1456 (2001).

    Артикул КАС пабмед Google ученый

  • Эль-Зимаити, Х. М., Ота, Х., Грэм, Д. Ю., Акамацу, Т. и Кацуяма, Т. Характер атрофии желудка при раке желудка кишечного типа. Рак 94 , 1428–1436 (2002).

    Артикул пабмед Google ученый

  • Гента, р.M. & Pusztaszeri, M. Слизистая оболочка желудка у больных раком желудка в зоне с низкой заболеваемостью. евро. Дж. Гастроэнтерол. Гепатол. 18 , 1085–1093 (2006).

    Артикул пабмед Google ученый

  • Stabler, S. P. & Allen, R. H. Дефицит витамина B12 как всемирная проблема. год. Преподобный Нутр. 24 , 299–326 (2004).

    Артикул КАС пабмед Google ученый

  • Аннибале, Б., Lahner, E. & Fave, G.D. Диагностика и лечение пернициозной анемии. Курс. Гастроэнтерол. 13 , 518–524 (2011).

    Артикул пабмед Google ученый

  • Стаблер С.П. Клиническая практика. Дефицит витамина В12. Н. англ. Дж. Мед. 368 , 149–160 (2013).

    Артикул КАС пабмед Google ученый

  • Цукьер, Л.С. и Черву, Л. Р. Оценка пернициозной анемии по Шиллингу: текущее состояние. J. Nucl. Мед. 25 , 1032–1039 (1984).

    КАС пабмед Google ученый

  • Криницкий, Б. Р. и Цукьер, Л. С. Точность измерения образцов мочи с двойным изотопом теста Шиллинга: многоцентровое исследование [исправлено]. J. Nucl. Мед. 36 , 1659–1665 (1995).

    КАС пабмед Google ученый

  • Ди Марио, Ф. и др. . «Серологическая биопсия» у ближайших родственников пациентов с раком желудка, пораженных инфекцией Helicobacter pylori . Скан. Дж. Гастроэнтерол. 38 , 1223–1227 (2003).

    Артикул КАС пабмед Google ученый

  • Ди Марио, Ф. и др. . Полезность сывороточных пепсиногенов при хроническом гастрите Helicobacter pylori : связь с воспалением, активностью и плотностью бактерий. Коп. Дис. науч. 51 , 1791–1795 (2006 г.).

    Артикул пабмед Google ученый

  • Германа, Б. и др. . Клиническая полезность сывороточных пепсиногенов I и II, гастрина-17 и антител против Helicobacter pylori при лечении пациентов с диспепсией в условиях первичной медико-санитарной помощи. Коп. Дис печени. 37 , 501–508 (2005).

    Артикул КАС пабмед Google ученый

  • Гуарисо, Г. и др. . GastroPanel: оценка полезности в диагностике изменений слизистой оболочки желудка и двенадцатиперстной кишки у детей. клин. Чим. Acta 402 , 54–60 (2009).

    Артикул КАС пабмед Google ученый

  • Иидзима, К. и др. . Тесты биомаркеров сыворотки полезны для разграничения пациентов с атрофией желудка и нормальным, здоровым желудком. Мир Дж. Гастроэнтерол. 15 , 853–859 (2009).

    Артикул КАС пабмед ПабМед Центральный Google ученый

  • Пейц, У. и др. . Корреляция сывороточных пепсиногенов и гастрина-17 с атрофическим гастритом у пациентов с гастроэзофагеальным рефлюксом: исследование с подобранными парами. Дж. Гастроэнтерол. Гепатол. 26 , 82–89 (2011).

    Артикул пабмед Google ученый

  • Антико, А. и др. . Клиническая ценность серологической биопсии желудка для диагностики хронического аутоиммунного гастрита. клин. Дев. Иммунол. 2012 , 520970 (2012).

    Артикул пабмед ПабМед Центральный Google ученый

  • Faber, K.K. Achylia Gastrica mit Anamie [немецкий]. Medizinische Klinik 5 , 1310–1325 (1909).

    Google ученый

  • Гершко С. и др. . Роль аутоиммунного гастрита, Helicobacter pylori и целиакии в рефрактерной или необъяснимой железодефицитной анемии. Haematologica 90 , 585–595 (2005).

    КАС пабмед Google ученый

  • Genta, R. M. Еще одна дисплазия. евро. Дж. Гастроэнтерол. Гепатол. 13 , 1411–1414 (2001).

    Артикул КАС пабмед Google ученый

  • Алонсо, Н. и др. . A. Сывороточный пепсиноген I: ранний маркер пернициозной анемии у пациентов с диабетом 1 типа. Дж. Клин. Эндокринол. Метаб. 90 , 5254–5258 (2005 г.).

    Артикул КАС пабмед Google ученый

  • De Block, C.E., De Leeuw, IH & Van Gaal, L.F. Аутоиммунный гастрит при диабете 1 типа: клинически ориентированный обзор. Дж. Клин. Эндокринол. Метаб. 93 , 363–371 (2008).

    Артикул КАС пабмед Google ученый

  • De Block, C.E. и др. . Аутоиммунная гастропатия у пациентов с диабетом 1 типа с антителами к париетальным клеткам: гистологические и клинические данные. Diabetes Care 26 , 82–88 (2003).

    Артикул пабмед Google ученый

  • Лам-Це, В. К. и др. . Связь между аутоиммунным тиреоидитом, аутоиммунным гастритом и диабетом 1 типа. Педиатр. Эндокринол. Ред. 1 , 22–37 (2003).

    ПабМед Google ученый

  • Broussais, FJV Histoire des phlegmasies ou воспаления chroniques: fundée sur de nouvellesObservations de clinique et d’anatomie pathologique [французский]. (Габон и Крошар, 1822 г.).

    Google ученый

  • Cruveilhier, J. Королевская академия медицины.Rapport fait à cette Académie dans la séance du 22 Cctobre 1839 sur les pieces pathologiques modelées en Relief et publiées par le Dr Félix Thibert [французский]. (Импр. де Ф. Дидо Фререс, 1839 г.).

    Google ученый

  • Хронический атрофический гастрит, проявляющийся гемолитической анемией вследствие тяжелой недостаточности витамина B12

    Витамин B12 является важным питательным веществом, которое играет важную роль в неврологической функции, кроветворении и синтезе ДНК.Низкий уровень обычно связан либо с плохим потреблением, либо с нарушением всасывания. В настоящее время наиболее распространенной причиной дефицита витамина B12 является мальабсорбция кобаламина, связанная с пищей, которая возникает при нарушении высвобождения витамина B12 из проглоченной пищи из-за выдающегося фактора, препятствующего высвобождению питательного вещества из его транспортного белка. К таким причинам относятся ахлоргидрия, гастрит, гастрэктомия или применение ИПП или антацидов. Более редкой причиной является аутоиммунный хронический атрофический гастрит, приводящий к пернициозной анемии.При этом болезненном процессе происходит разрушение париетальных клеток и, следовательно, снижение внутреннего фактора, необходимого для всасывания витамина B12. Дефицит приводит к различным аномалиям, включая панцитопению, парестезии и нейропсихиатрические симптомы, но не ограничиваясь ими. Редким проявлением дефицита витамина В12 является гемолитическая анемия, возникающая вследствие интрамедуллярной и экстрамедуллярной дисфункции. Этот случай описывает 46-летнего мужчину без истории болезни, у которого были боли в груди, усталость и прогрессирующая слабость, у которых была обнаружена гемолитическая анемия, в конечном итоге связанная с дефицитом витамина B12.Антитела к париетальным клеткам и антитела к внутреннему фактору (IFA) были отрицательными. Тем не менее, пациенту была проведена эндоскопия с биопсией желудка; патология соответствовала хроническому метапластическому атрофическому гастриту. Пациенту стало лучше после внутримышечного введения витамина B12. Этот случай подчеркивает как редкую причину, так и проявление дефицита витамина B12. Пациенты с аутоиммунным хроническим атрофическим гастритом должны иметь антитела к париетальным клеткам или внутреннему фактору. Тем не менее, сообщалось о серонегативных пациентах, таких как этот пациент.Кроме того, гемолитическая анемия, вторичная по отношению к дефициту витамина B12, встречается редко. Клинические проявления обычно отражают тромботическую микроангиопатию (ТМА), включая гемолитическую анемию с шистоцитами в мазке периферической крови и тромбоцитопению, как это было у этого пациента. Это клиническое состояние описывается как псевдотромботическая микроангиопатия, и его крайне важно идентифицировать, чтобы предотвратить применение инвазивных стратегий лечения, таких как плазмаферез.

    1. Введение

    Витамин B12 (кобаламин) является важным питательным веществом, которое действует как кофактор основных химических реакций в организме, включая превращение метилмалоновой кислоты в сукцинил-кофермент А, превращение гомоцистеина в метионин и превращение 5-метилтетрагидрофолата в тетрагидрофолат, которые имеют решающее значение для правильной неврологической функции, кроветворения и синтеза ДНК [1].Следовательно, недостаточность обычно проявляется как совокупность гематологических нарушений (макроцитарная анемия, тромбоцитопения или панцитопения), неврологических симптомов (парестезии, потеря проприоцепции или дисфункция вегетативной нервной системы) и/или нейропсихиатрических нарушений, таких как депрессия, слабоумие, или мания [2]. Сообщается, что распространенность дефицита витамина B12 в Соединенных Штатах достигает 3% среди лиц в возрасте 20–39 лет, 4% среди лиц в возрасте 40–59 лет и 6% среди лиц старше 60 лет. 3].Менее известным осложнением дефицита витамина B12 является гемолитическая анемия, иногда проявляющаяся псевдотромботической микроангиопатией. Это может произойти из-за как интрамедуллярной, так и экстрамедуллярной дисфункции. Дефицит приводит к неэффективному эритропоэзу, что приводит к интрамедуллярному гемолизу и высвобождению лактатдегидрогеназы (ЛДГ), а также к нарушению деформируемости мембран эритроцитов, что вызывает экстрамедуллярную фрагментацию и гемолиз [2, 4].

    В основном получаемый при употреблении в пищу рыбы, мяса, молочных продуктов и обогащенных злаков, витамин В12 всасывается в терминальном отделе подвздошной кишки вместе с внутренним фактором, который вырабатывается париетальными клетками желудка [1].Дефицит обычно возникает в результате либо плохого потребления, либо процесса мальабсорбции. Наиболее распространенной этиологией дефицита витамина B12 является связанная с пищей мальабсорбция кобаламина, которая возникает при нарушении высвобождения витамина B12 из проглоченной пищи из-за выдающегося фактора, который препятствует высвобождению питательного вещества из его транспортного белка. К таким причинам относятся ахлоргидрия, гастрит, гастрэктомия или применение ингибиторов протонной помпы (ИПП) или антацидов [3]. Более редкой причиной дефицита витамина B12 является аутоиммунный хронический атрофический гастрит, приводящий к пернициозной анемии.В основе этого заболевания лежит воспалительный процесс, который приводит к разрушению париетальных клеток и, таким образом, снижению внутреннего фактора, необходимого для всасывания витамина В12. Диагноз обычно ставится с помощью положительных серологических исследований, таких как наличие антител против внутреннего фактора или антител к париетальным клеткам, или с помощью гистологического исследования [5]. Здесь мы представляем случай дефицита витамина B12, проявляющегося гемолитической анемией, вторичной по отношению к хроническому аутоиммунному гастриту, наблюдаемой при гистологическом исследовании, хотя и с отрицательными серологическими маркерами.

    2. История болезни

    46-летний гаитянин без истории болезни поступил в отделение неотложной помощи с болью в груди, прогрессирующей слабостью и утомляемостью, которые продолжались в течение последнего месяца. До появления этих симптомов больной находился в обычном состоянии здоровья. Он не регулярно обращался к врачу. Он описал боль в груди как периодическое чувство жжения за грудиной, возникающее в основном в состоянии покоя. Из-за этого у него снизился аппетит, что привело к непреднамеренной потере веса на 30 фунтов за предыдущие несколько недель.Он отрицал лихорадку, озноб, кашель, ночную потливость, дисфагию, одинофагию, тошноту или рвоту. Он также сообщил о запорах с опорожнением кишечника каждые 3-4 дня, что сопровождалось периодической ректальной болью и ярко-красной кровью при подтирании. В остальном он отрицал наличие ректального кровотечения, гематохезии, мелены, кровавой рвоты, гематурии, сыпи или кровоподтеков. Следует отметить, что у пациента не было значимого семейного анамнеза. Он не принимал никаких лекарств и отрицал использование безрецептурных средств, включая НПВП, ацетаминофен, аспирин, травы или добавки.Он отрицал употребление алкоголя или табака. Он придерживался диеты, включающей мясо и овощи без ограничений. Он сообщил, что работал на улице ландшафтным дизайнером, хотя отрицал какие-либо известные укусы клещей или комаров. Он отрицал какие-либо недавние контакты с больными или историю поездок, а его последняя поездка на Гаити произошла примерно за 1,5 года до презентации.

    Жизненно важные показатели при поступлении: температура тела 98,1°F, пульс 84/мин, частота дыхания 18/мин, АД 130/67 мм рт.ст., сатурация кислорода 100% на комнатном воздухе.Физикальное обследование было отмечено иктеричностью склер. Язв во рту и глоссита не было. Живот мягкий, без болезненности и гепатоспленомегалии. Периферических отеков и высыпаний не было. Неврологическое обследование было ничем не примечательным; мышечная сила была 5/5 в верхних и нижних конечностях, дефицита чувствительности не было. Также у него не было отклонений в походке.

    При первичном общем анализе крови (ОАК) выявлена ​​панцитопения со сниженным количеством лейкоцитов 2,4 мкл (4,5–11,0·10  3/мкл), уровень гемоглобина 4.6/мкл). Мазок периферической крови был грубо аномальным, демонстрируя каплевидные клетки, небольшое количество шистоцитов, анизопойкилоцитоз, смещенные влево лейкоциты, гигантские тромбоциты, атипичные лимфоциты и отсутствие бластов. Дополнительный анализ крови выявил нормальные электролиты сыворотки и функцию почек, повышение АСТ, общего билирубина, прямого билирубина и ЛДГ и снижение уровня гаптоглобина (таблица 1). Прямой тест Кумбса IgG был положительным. Уровни витамина B12, фолиевой кислоты и гомоцистеина также определялись в это время в рамках обследования на гемолитическую анемию, которая продемонстрировала тяжелый дефицит витамина B12 (<50 пг/мл), нормальный уровень фолиевой кислоты 22 (>4,0).0 нг/мл) и повышенный уровень гомоцистеина 42,6 (5,0–15,0 мкмоль/л). Анализ мочи показал мутную мочу, отрицательный результат на глюкозу, билирубин и кетоны, умеренную кровь, 30–50 эритроцитов и 0–2 лейкоцитов. КТ грудной клетки/брюшной полости/таза с контрастированием была значимой для легкой спленомегалии с длиной селезенки 13,9 см без рентгенологических признаков инфаркта или поражений селезенки. Не было гепатомегалии или значительной ретроперитонеальной или медиастинальной лимфаденопатии. Анализ кала на скрытую кровь положительный.Больному перелили 2 единицы эритроцитарной массы и госпитализировали для дальнейшего обследования.

    +
    Лаборатория + АНК

    +
    Значение Ссылка Диапазон

    +
    WBC 2,4 4.5-11.0 10 3 / мкл
    +
    1.2 1,8–8,0 10  3/мкл
    HGB 4,9 13,2–17,5 г/дл
    HCT
    40.0-53.0
    MCV 98.7 98.7
    57 140-450 10 3 / ул
    глюкозы 93 93 99 мг / dl
    Na 138 136 136-145 MMOL / L
    K 4.4 3.5-5.2 MMOL / L
    105 105 96-110 ммоль / L
    Dioxide 21 21 24-31 MMOL / L
    BUN 14 5-25 мг / дл
    CR 1.15 0.61-1.24 MG / DL
    105 10-42 U / L
    ALT 55 10-60 U / L
    ALP 29 38-126 U / L
    Total Bilirobin 4.2 0.2-1,3 мг / дл
    Direct Bilirobin 0.5 0.0-0,2 мг / дл
    Troponin 0.01 <0,08 NG / ML
    6392
    haptoglobin <6 30-225 мг / дл
    Reticulocyte Count 1.38 0,40-2,50%
    Direct Cooombs IgG 41689
    304.3 304.336 NG / ML
    81 45-180 UG / DL
    TIBC 227 260-480 UG / DL
    <50 180-914 PG / ML
    Folate 22 > 4.0 NG / ML
    Homocysteine ​​ 42.6 5.0-15.0 UMOL / L
    отрицательный отрицательный
    антипараетнатная ячейка 20.7 0.0-20,0 единицы = отрицательный
    Антитела (первый тест) 20.1-24.9 = Equivocal
    антипараетнатная клетка 19.2 19.2 0.0-20,0 единицы = негативные
    20.1–24,9 = Двусмысленно

    Дополнительное тестирование было проведено для оценки гемолитической анемии, включая панель гепатита, ВИЧ, CMV, EBV IgM, ANA и клещевые патогены. Мазок от паразитов , антитела Lyme , антитела Ehrlichia , антитела Rickettsia rickettsii и уровни ADAMTS13. Хотя результаты этих тестов не были доступны в день госпитализации, все в конечном итоге оказались отрицательными или в пределах нормы.Цитометрия периферического кровотока не выявила иммунофенотипических признаков лимфопролиферативного заболевания, миелоидного новообразования высокой степени злокачественности/острой лейкемии или новообразования из плазматических клеток.

    Тромботическая тромбоцитопеническая пурпура первоначально рассматривалась, но менее вероятно, поскольку у пациента не было лихорадки, нормального мышления и нормальной функции почек. ADAMTS13 в итоге оказался в пределах нормы. Ведущей гипотезой его панцитопении и гемолитической анемии был неэффективный эритропоэз и интрамедуллярный гемолиз из-за тяжелой недостаточности витамина B12.Были отправлены антитела к париетальным клеткам и антитела к внутреннему фактору (IFA); оба в конечном итоге оказались отрицательными. Впоследствии пациенту была выполнена эндоскопия верхних отделов (ЭГДС) и колоноскопия. ЭГДС выявила единственную некровоточащую эрозию в пищеводно-желудочном переходе и диффузную атрофическую слизистую оболочку тела и антрального отдела желудка, которая была подвергнута биопсии. Патология продемонстрировала слизистую оболочку антрального отдела желудка с хроническим гастритом и отсутствием кишечной метаплазии или выявлено Helicobacter pylori ; слизистая оболочка желудка соответствовала хроническому гастриту, кишечной метаплазии и отсутствию железистых тканей, что соответствовало метапластическому атрофическому гастриту (рис. 1).Колоноскопия показала внутренний геморрой, но в остальном ничем не примечательна.


    На следующий день после поступления посттрансфузионный гемоглобин пациента улучшился до 8,2 г/дл (13,2–17,5 г/дл). В конечном итоге его лечили 4-дневным внутривенным введением дексаметазона по 40 мг в день по поводу возможной аутоиммунной гемолитической анемии, учитывая первоначальный прямой положительный тест Кумбса, и начали ежедневные внутримышечные инъекции цианокобаламина 1000 мкг в течение 10 дней. Дальнейших переливаний крови ему не потребовалось.Во время госпитализации его состояние продолжало улучшаться, сообщалось о повышении энергии и улучшении аппетита. В день выписки гемоглобин пациента составлял 9,8 г/дл (13,2–17,5 г/дл). Учитывая, что количество клеток у пациента улучшилось на фоне приема витамина B12, биопсия костного мозга была отложена. Он был выписан с пероральным приемом витамина В12 и инструкциями по дальнейшему наблюдению в гематологической клинике для получения еженедельных внутримышечных инъекций витамина В12 в течение следующего месяца.

    3. Обсуждение

    Дефицит витамина B12, проявляющийся тяжелыми гематологическими проявлениями, является относительно редким явлением, и в современной медицинской литературе имеется лишь ограниченное количество сообщений. Наш случай не только служит примером этой редкой клинической формы, но также представляет собой совокупность уникальных результатов этого конкретного болезненного процесса. Во-первых, первоначальная картина нашего пациента включала гемолитическую анемию, тромбоцитопению и дисморфические эритроциты. Эти результаты согласуются с тромботической микроангиопатией (ТМА).Однако, поскольку уровни витамина B12 были получены немедленно и было показано, что они значительно снизились, был поставлен диагноз псевдо-ТМА, ТМА, специфически вторичной по отношению к дефициту витамина B12. В отличие от первичных синдромов ТМА, таких как тромботическая тромбоцитопеническая пурпура или гемолитико-уремический синдром, псевдоТМА не требует инвазивных вмешательств, таких как плазмаферез. Предполагается, что этиология дисморфических эритроцитов при тяжелом дефиците витамина B12 связана как с интрамедуллярной, так и с экстрамедуллярной дисфункцией.С экстрамедуллярной точки зрения исследования показали, что гипергомоцистеинемия, возникающая при дефиците витамина B12, может увеличить риск гемолиза в дополнение к повреждению эндотелия, что в дальнейшем приводит к внутрисосудистому гемолизу и фрагментации эритроцитов [6]. Следует отметить, что гипергомоцистеинемия также может быть вызвана гипотиреозом, ожирением, диабетом, гиперлипидемией, лекарствами и, реже, наличием варианта гена метилентетрагидрофолатредуктазы [7]. Однако тестирование этого варианта гена обычно рекомендуется только в том случае, если причина гипергомоцистеинемии не объясняется другой, более распространенной причиной, поэтому наш пациент не прошел эту форму тестирования.

    Кроме того, по мере накопления дополнительных данных предполагаемой причиной дефицита витамина B12 у нашего пациента был аутоиммунный атрофический хронический гастрит, учитывая гистологические данные, отмеченные при биопсии его желудка, в частности, кишечную метаплазию и отсутствие железистой ткани оксинта в слизистой оболочке желудка. , отсутствие признаков инфекции Helicobacter pylori и отсутствие метаплазии в антральном отделе желудка. Согласно обновленной Сиднейской системе классификации и классификации гастрита, аутоиммунный гастрит тесно связан с атрофическим гастритом с преобладанием тела желудка, при этом в антральном отделе отмечается небольшая атрофия или метаплазия [8].Это может означать, что у пациента пернициозная анемия, приводящая к серьезному дефициту витамина B12 и, следовательно, к гемолитической анемии. Хотя и редко, сообщения об этом болезненном процессе существуют в литературе. Однако в большинстве этих случаев диагноз пернициозной анемии подтверждается гистологическим исследованием в дополнение к лабораторным исследованиям или свидетельствам предшествующей гастрэктомии или резекции подвздошной кишки [9–11]. Исторически эти лабораторные исследования включали наблюдение за дефицитом внутреннего фактора с использованием теста Шиллинга [12].Однако этот метод часто заменяют другими диагностическими тестами, такими как определение антител к внутреннему фактору или антител к париетальным клеткам. Хотя у нашего пациента не были обнаружены антитела к внутреннему фактору или париетальным клеткам, у него были гистологические признаки аутоиммунного гастрита, подтверждающие диагноз.

    На момент написания этой публикации было обнаружено всего несколько случаев, в которых описывался пациент с гемолитической анемией из-за тяжелого дефицита витамина B12, вероятно вторичного по отношению к серонегативному хроническому атрофическому гастриту.Подобно нашему пациенту, этот случай описывает молодого мужчину с макроцитарной анемией, повышенным уровнем ЛДГ и неопределяемым уровнем витамина B12, у которого при биопсии был обнаружен хронический атрофический гастрит. У этого пациента также были отрицательные серологические маркеры, включая антитела к париетальным клеткам и антитела к внутреннему фактору [13].

    Недавно Conti et al. провели ретроспективное поперечное исследование в Италии, изучая уровни антител к париетальным клеткам (PCA) и клинические признаки у 516 пациентов с гистологически диагностированным аутоиммунным атрофическим гастритом.Из этих пациентов 21,1% оказались серонегативными. Серонегативные пациенты были значительно старше серопозитивных пациентов, причем большая часть этих пациентов была старше 70 лет. Было высказано предположение, что положительная корреляция между пожилым возрастом и серонегативностью может быть объяснена сероконверсией из-за прогрессирования заболевания, аналогичного что наблюдалось при других аутоиммунных состояниях, таких как аутоиммунный тиреоидит. Однако это исследование показало, что серопозитивность не коррелирует с тяжестью атрофии, а серонегативность не связана с большей тяжестью атрофии желудка или клиническими симптомами [14].Интересно, что в нашем случае представлен молодой пациент с отрицательными серологическими исследованиями.

    Наконец, еще одной уникальной особенностью нашего случая было наличие изначально положительного прямого антиглобулинового теста (DAT) на фоне гемолитической анемии, вызванной дефицитом витамина B12. Пернициозная анемия, связанная с положительным результатом DAT, редко описывалась в литературе. Сообщалось, что у пациентов с пернициозной анемией может временно быть положительный тест Кумбса; однако повторное тестирование часто становится отрицательным после того, как пациент начинает принимать добавки витамина B12 [15].Интересно, что у нашего пациента повторный DAT был отрицательным после того, как пациент начал принимать как добавки с витамином B12, так и курс стероидов.

    4. Заключение

    Этот случай указывает как на редкую причину, так и на проявление дефицита витамина B12. Дефицит возникает из-за плохого перорального приема или мальабсорбции питательного вещества. Аутоиммунный хронический атрофический гастрит является редкой этиологией дефицита витамина B12, который приводит к разрушению париетальных клеток, что приводит к снижению внутреннего фактора, необходимого для всасывания витамина B12.При этом патологическом процессе у пациентов обычно выявляются либо антитела к париетальным клеткам, либо антитела к внутреннему фактору. Однако недавние исследования показали, что пациенты с этим заболеванием являются серонегативными, что делает биопсию необходимой для диагностики. Кроме того, дефицит витамина B12 обычно проявляется неврологическими и гематологическими симптомами. В редких случаях это вызывает гемолитическую анемию и тромбоцитопению, лучше всего описываемую как псевдотромботическая микроангиопатия, как показано в данном случае. Предполагается, что механизм гемолиза обусловлен как интрамедуллярной, так и экстрамедуллярной дисфункцией.Крайне важно установить этот диагноз на ранней стадии, чтобы предотвратить ненужное лечение, такое как плазмаферез.

    Согласие

    Пациент, описанный в истории болезни, дал информированное согласие на публикацию истории болезни.

    Конфликт интересов

    Авторы заявляют об отсутствии конфликта интересов в связи с публикацией данной статьи.

    Распространенность хронического атрофического гастрита в разных частях мира | Эпидемиология рака, биомаркеры и профилактика

  • Факторы риска атрофического хронического гастрита у населения Европы: результаты исследования Eurohepygast.Гут 2002;50:779-85.

  • Асака М., Сугияма Т., Нобута А., Като М., Такеда Х. и Грэм Д.Ю. Атрофический гастрит и кишечная метаплазия в Японии: результаты большого многоцентрового исследования. Хеликобактер 2001;6:294-9.

  • Beales IL, Crabtree JE, Scunes D, Covacci A и Calam J. Антитела к белку CagA связаны с атрофией желудка при инфекции Helicobacter pylori . Eur J Gastroenterol Hepatol 1996;8:645-9.

  • Chang-Claude J, Raedsch R, Waldherr R, et al.Распространенность инфекции Helicobacter pylori и гастрита среди молодых людей в Китае. Eur J Cancer Prev 1995; 4:73-9.

  • Chen XY, van Der Hulst RW, Shi Y, Xiao SD, Tytgat GN и Ten Kate FJ. Сравнение предраковых состояний: атрофия и кишечная метаплазия при гастрите Helicobacter pylori у китайских и голландских пациентов. Дж. Клин Патол 2001; 54: 367-70.

  • Дурсун М., Йылмаз С., Юкселен В., Килинц Н., Каноруц Ф. и Тузку А.Оценка оптимального места и количества биопсии слизистой оболочки желудка для выявления Helicobacter pylori , атрофии желудка и кишечной метаплазии. Гепатогастроэнтерология 2004;51:1732-5.

  • Fontham ET, Ruiz B, Perez A, Hunter F и Correa P. Детерминанты инфекции Helicobacter pylori и хронического гастрита. Am J Gastroenterol 1995;90:1094-101.

  • Fung WP, Lee SK и Tye CY. Распространенность хронического гастрита у больных язвенной болезнью желудка.Aust NZ J Med 1975; 5:133-7.

  • Харума К., Камада Т., Кавагути Х. и др. Влияние возраста и инфекции Helicobacter pylori на секрецию желудочного сока. J Gastroenterol Hepatol 2000;15:277-83.

  • Hu PJ, Li YY, Lin HL и др. Желудочная атрофия и региональные вариации при заболеваниях верхних отделов желудочно-кишечного тракта. Am J Gastroenterol 1995;90:1102-6.

  • Яскевич К., Лууренс Х.Д. Хронический атрофический гастрит у населения с риском развития карциномы желудка.Anticancer Res 1991;11:835-9.

  • Като И., Томинага С., Ито Ю. и др. Риск атрофического гастрита и рака желудка: перекрестный анализ. Jpn J Cancer Res 1992;83:1041-6.

  • Каур Г., Радж С.М. Изучение соответствия между эндоскопическим гастритом и гистологическим гастритом на территории с низкой фоновой распространенностью инфекции Helicobacter pylori . Singapore Med J 2002; 43:090-2.

  • Кавагути Х., Харума К., Комото К., Ёсихара М., Сумии К., Кадзияма Г.Инфекция Helicobacter pylori является основным фактором риска развития атрофического гастрита. Am J Gastroenterol 1996;91:959-62.

  • Kiyohira K, Yoshihara M, Ito M, Haruma K, Tanaka S, Chayama K. Концентрация пепсиногена в сыворотке как маркер инфекции Helicobacter pylori и гистологической степени гастрита; оценка слизистой оболочки желудка по уровню пепсиногена в сыворотке крови. J Gastroenterol 2003;38:332-8.

  • Кольштадт И.С., Антунес де Майоло Э.А., Рамирес-Икаса С.Антитела париетальных клеток у перуанцев с патологическими изменениями желудка. Рабочая группа по физиологии желудочно-кишечного тракта. Scand J Gastroenterol 1993;28:973-7.

  • Lee CH, Bang SH, Lee SK, Song KY, Lee IC. Профилирование экспрессии генов выявляет последовательные изменения в аденоме желудочных канальцев и карциноме in situ . World J Gastroenterol 2005; 11:1937-45.

  • Мацукура Н., Онда М., Токунага А. и др. Значение сывороточных маркеров пепсиногена I и II для хронического атрофического гастрита, язвенной болезни и рака желудка.J Clin Gastroenterol 1993;17 Suppl 1:S146-50.

  • Михара М., Харума К., Камада Т. и др. Роль эндоскопических данных для диагностики инфекции Helicobacter pylori : оценка в стране с высокой распространенностью атрофического гастрита. Хеликобактер 1999;4:40-8.

  • Montani A, Sasazuki S, Inoue M, Higuchi K, Arakawa T и Tsugane S. Потребление пищи/питательных веществ и риск атрофического гастрита среди Helicobacter pylori -инфицированного населения северо-восточной Японии.Наука о раке 2003; 94: 372-7.

  • Motteram R. Биопсия при хроническом гастрите и атрофии желудка. J Pathol Bacteriol 1951;63:389-94.

  • Munoz N, Vivas J, Buiatti E, Kato I, Oliver W. Исследование химиопрофилактики предраковых поражений желудка в Венесуэле: краткое изложение дизайна исследования и исходных данных. Научная публикация IARC, 1996; 125–33.

  • Окума К., Окада М., Мураяма Х. и др. Ассоциация инфекции Helicobacter pylori с атрофическим гастритом и кишечной метаплазией.J Gastroenterol Hepatol 2000;15:1105-12.

  • Оксанен А., Сиппонен П., Миеттинен А., Сарна С., Раутелин Х. Оценка анализов крови для прогнозирования нормальной слизистой оболочки желудка. Scand J Gastroenterol 2000;35:791-5.

  • Potet F, Florent C, Benhamou E, et al. Хронический гастрит: распространенность среди населения Франции. CIRIG. Gastroenterol Clin Biol 1993;17:103-8.

  • Приминьяни М., Агапе Д., Ронки Г. и др. Гистология желудка и функциональные тесты у итальянских пациентов с герпетиформным дерматитом.Scand J Gastroenterol 1990;25:357-62.

  • Риччи С., Вакил Н., Ругге М. и др. Серологические маркеры атрофии желудка у бессимптомных пациентов, инфицированных Helicobacter pylori . Am J Gastroenterol 2004;99:1910-5.

  • Рикуарте О., Гутьеррес О., Кардона Х., Ким Дж. Г., Грэм Д. Ю., Эль-Зимаити Х. М. Атрофический гастрит у детей раннего возраста и подростков. Дж. Клин Патол 2005; 58: 1189-93.

  • Ругге М., Бусатто Г., Кассаро М. и др. Пациенты моложе 40 лет с карциномой желудка: генотип Helicobacter pylori и ассоциированный фенотип гастрита.Рак 1999;85:2506-11.

  • Ругге М., Кассаро М., Леандро Г. и др. Helicobacter pylori в стимуляции канцерогенеза желудка. Dig Dis Sci 1996; 41: 950-5.

  • Ruiz B, Correa P, Fontham ET, Ramakrishnan T. Антральная атрофия, колонизация Helicobacter pylori и рН желудка. Ам Дж. Клин Патол 1996; 105:96-101.

  • Satoh K, Kimura K, Sipponen P. Инфекция Helicobacter pylori и хронологическое распространение атрофического гастрита.Eur J Gastroenterol Hepatol 1995;7 Suppl 1:S11-5.

  • Симояма Т., Фукуда С., Танака М., Миками Т., Сайто Ю., Мунаката А. Высокая распространенность CagA-положительных штаммов Helicobacter pylori у бессимптомных японских пациентов и больных раком желудка. Scand J Gastroenterol 1997;32:465-8.

  • Sipponen P, Helske T, Jarvinen P, Hyvarinen H, Seppala K, Siurala, M. Падение распространенности хронического гастрита за 15 лет: анализ амбулаторных исследований в Финляндии за 1977, 1985 и 1992 годы.Гут 1994;35:1167-71.

  • Sipponen P, Samloff IM, Saukkonen M, Varis K. Пепсиногены I и II сыворотки и гистология слизистой оболочки желудка после резекции желудка. Гут 1985; 26:1179-82.

  • Ситас Ф., Смоллвуд Р., Джуэлл Д. и др. Сывороточные антитела IgG к Helicobacter pylori и пепсиногены А и С как серологические маркеры хронического атрофического гастрита. Рак эпидемиол биомаркеры Prev 1993;2:119-23.

  • Sobala GM, Pignatelli B, Schorah CJ, et al.Уровни нитритов, нитратов, N-нитрозосоединений, аскорбиновой кислоты и общих желчных кислот в желудочном соке больных с предраковыми состояниями желудка и без них. Канцерогенез 1991;12:193-8.

  • Stahel E, Gyr K, Jallah E, Heitz P. Гастродуоденит и пептическая язва в сельской либерийской общине. Эндоскопическое проспективное исследование. Trop Geogr Med 1981; 33:155-60.

  • Суриани Р., Вентурини И., Таральо С. и др. Кишечная метаплазия типа III, инфекция Helicobacter pylori и индекс риска карциномы желудка в итальянской серии из 1750 пациентов.Гепатогастроэнтерология 2005;52:285-8.

  • Тамм А., Виллако К., Харконен М., Каронен С.Л. Пепсиноген I сыворотки и состояние слизистой оболочки желудка в выборке населения Эстонии. Scand J Gastroenterol 1984;19:1091-4.

  • Тацута М., Ииси Х., Накаидзуми А. и др. Фундальный атрофический гастрит как фактор риска рака желудка. Int J Рак 1993;53:70-4.

  • Топал Д., Горал В., Йылмаз Ф., Кара И.Х. Связь Helicobacter pylori с кишечной метаплазией, атрофией желудка и BCL-2.Терк Дж. Гастроэнтерол 2004; 15:149-55.

  • Varis O, Valle J, Siurala M. Участвует ли Helicobacter pylori в патогенезе гастрита, характерного для пернициозной анемии? Сравнение родственников с пернициозной анемией и родственников с язвенной болезнью двенадцатиперстной кишки. Scand J Gastroenterol 1993;28:705-8.

  • Zaitoun AM. Гистологическое исследование хронического гастрита из Объединенных Арабских Эмиратов с использованием Сиднейской системы классификации. Дж. Клин Патол, 1994; 47:810-5.

  • Текущий клинический обзор атрофического гастрита: Экспертный обзор гастроэнтерологии и гепатологии: Том 14, № 2

  • АГ — относительно распространенное заболевание, часто встречающееся у пожилых людей, но часто присутствующее и у молодых людей, которое может возникать в течение длительного времени. хроническое последствие инфекции H. pylori или как или в контексте желудочного аутоиммунитета.

  • Золотым стандартом диагностики АГ является гистопатологическая оценка биоптатов слизистой оболочки антрального отдела и тела желудка (необходимо получить и отправить в отдельные флаконы), для достижения правильной стадии АГ и/или кишечной метаплазии (КМ)

  • Гистопатологическую оценку биоптатов желудка следует проводить в соответствии с обновленной Сиднейской системой, а стадирование следует выражать в соответствии с классификационными системами OLGA/OLGIM .

  • Электронная хромоэндоскопия (узкоспектральная визуализация или визуализация в синем свете) позволяет распознать метапластический АГ, что позволяет выполнять «прицельные биопсии» в зонах с высоким подозрением на ИМ, повышая точность диагностики.

  • Утвержденная классификация эндоскопической классификации желудочно-кишечной метаплазии (EGGIM) демонстрирует высокую точность стадирования ИМ по сравнению с гистологическим исследованием в качестве золотого стандарта.

  • АГ с вовлечением слизистой оболочки тела может быть связана с дефицитом железа и/или витамина B 12 , иногда с более неспецифическими гематологическими изменениями в виде макро- или микроцитоза или анизоцитоза; своевременная диагностика и лечение этих изменений имеет решающее значение, особенно у пожилых людей.

  • Стратегия выявления случаев заболевания (серологическое тестирование или гастроскопия с биопсией) может быть полезной у лиц с необъяснимой железодефицитной анемией, макроцитозом или макроцитарной анемией, персистирующей диспепсией, аутоиммунными тиреопатиями и сахарным диабетом 1 типа, положительным семейным анамнезом желудочно-кишечного тракта. онкологические/предраковые поражения, а также при непрерывном лечении ИПП.

  • Серологические тесты, такие как пепсиногены и гастрин, полезны для скрининга пациентов с высоким подозрением на АГ для выявления тех, кому необходимо выполнить гастроскопию; анти- H.pylori помогает идентифицировать пациентов с предшествующей или текущей инфекцией H. pylori ; Антитела к париетальным клеткам кажутся перспективным инструментом при аутоиммунной и связанной с H. pylori АГ, но валидация ожидается.

  • АГ связана с повышенным риском рака желудка, поэтому эндоскопическое наблюдение показано в зависимости от внутрижелудочного распределения атрофии желудка и факторов риска.

  • Пациенты с АГ с поражением слизистой оболочки тела должны проходить эндоскопическое наблюдение каждые 3 года или каждые 1–2 года при наличии в семейном анамнезе рака желудка первой степени; пациенты с АГ только в антральном отделе без ИМ не нуждаются в наблюдении, больные с метапластической АГ только в антральном отделе подлежат диспансерному наблюдению каждые 3 года только при наличии факторов риска (семейный анамнез рака желудка первой степени, неполный ИМ, аутоиммунный гастрит или персистирующий H.pylori инфекции).

  • У пациентов с АГ с вовлечением тела желудка применение антисекреторных препаратов, таких как ингибиторы протонной помпы, может быть не показано из-за наличия нарушения секреции желудочного сока из-за атрофического поражения оксинтических желез тела.

  • Целесообразно ли скрининг и наблюдение за атрофическим гастритом? — Реферат — Болезни органов пищеварения 2007, Том. 25, № 3

    Нардон Г. a · Rocco A. a · Сравните D. a · De Colibus P. a · Autiero G. a · Pica L. a · De Nucci G. a · Gasbarrini G. б

    Принадлежности автора

    a Кафедра клинической и экспериментальной медицины, Отделение гастроэнтерологии, Университет Федерико II, Неаполь, и b Институт внутренней медицины, Католический университет, Рим, Италия

    Соответствующий автор

    Gerardo Nardone, MD

    Отделение медицины и экспериментальной клиники, Отделение гастроэнтерологии

    Università degli Studi di Napoli ‘Federico II’, Via Pansini n° 5

    IT–800131 Napoli (Италия) 9. 9. 0010/факс +39 081 7464 293, электронная почта [email protected]

    Диг Дис 2007; 25: 214–217

    Аннотация

    Рак желудка остается основной причиной смертности от рака во многих частях мира.В настоящее время профилактика представляется наиболее эффективным средством снижения заболеваемости и смертности. Атрофия желудка считается первым важным этапом в гистогенезе аденокарциномы желудка. Однако целесообразность скрининга и наблюдения за атрофическим гастритом обсуждается. Распространенность и характер хронического атрофического гастрита сильно варьируется от страны к стране, будучи более высоким и в основном диффузным пангастритом или локализованным в странах с высокой заболеваемостью раком желудка.Единственным доступным методом выявления атрофии желудка является гистопатологическое исследование эндоскопических образцов, но единого мнения относительно диагноза нет. Сывороточная желудочная секреция может быть маркером атрофии желудка, хотя она имеет высокую специфичность, но низкую чувствительность. Атрофия желудка в основном связана с хронической инфекцией Helicobacter pylori (H. pylori) . Таким образом, единственной эффективной стратегией профилактики рака желудка является эрадикация инфекции H. pylori для остановки прогрессирования атрофии в отдельных группах населения.В заключение, нет достаточных данных, чтобы предложить скрининг и наблюдение за атрофическим гастритом среди населения в целом; однако эту стратегию следует применять в странах с высокой заболеваемостью раком желудка.

    © 2007 S. Karger AG, Базель


    Каталожные номера

    1. Корреа П.: Канцерогенез желудка человека: многоэтапный и многофакторный процесс.Лекция первой премии Американского онкологического общества по эпидемиологии и профилактике рака. Рак Res1992; 52: 6735–6740.
    2. Sipponen P: Рак желудка – долгосрочное последствие инфекции Helicobacter pylori ? Scand J Gastroenterol 1994; 29 (дополнение 201): 24–27.
    3. Динис-Рибейро М., Лопес С., да Коста-Перейра А., Гильерме М., Барбоза Дж., Ломба-Виана Х., Силва Р., Морейра-Диас Л.: Модель наблюдения за пациентами с атрофическим хроническим гастритом и кишечной метаплазией.Дж. Клин Патол 2004; 57: 177–182.
    4. Паркин Д.М., Брей Ф.И., Девеса С.С.: Раковое бремя в 2000 году. Глобальная картина. Eur J Cancer 2001; 37 (дополнение 8): 54–66.
    5. Американское онкологическое общество: оценка новых случаев рака и смертей с разбивкой по полу во всех учреждениях, США, 2000 г. (таблица).http://www.cancer.org/statistics/cff2000/data/newCaseSex.html. По состоянию на 13 марта 2001 г.
    6. Cheli R, Giacosa A, Pirasso A: Хронический гастрит: динамический процесс в сторону рака; в Ming SC (ed): Precursor рака желудка. Нью-Йорк, Praeger Scientific, 1984, стр. 117–29.
    7. Леодольтер А., Эберт М.П., ​​Пейц У., Волле К., Каль С., Вит М., Малфертейнер П. Распространенность H.pylori — ассоциированный «гастрит высокого риска» развития рака желудка у пациентов с нормальными эндоскопическими данными. World J Gastroenterol 2006;12:5509–5512.
    8. Correa P, Haenszel W, Cuello C, Zavala D, Fontham E, Zarama G, Tannenbaum S, Collazos T, Ruiz B: Желудочный предраковый процесс в группе высокого риска: когортное наблюдение. Рак Res 1990; 50: 4737–4740.
    9. Johnsen R, Bernersen B, Straume B, Forde OH, Bostad L, Burhol PG: Преобладание эндоскопических и гистологических данных у субъектов с диспепсией и без нее. BMJ 1991; 302: 749–752.
    10. You WC, Blot WJ, Li JY, Chang YS, Jin ML, Kneller R, Zhang L, Han ZX, Zeng XR, Liu WD и др.: Предраковые поражения желудка у населения с высоким риском рака желудка.Рак Res 1993; 53: 1317–1321.
    11. Katelaris PH, Seow F, Lin BP, Napoli J, Ngu MC, Jones DB: Влияние возраста, инфекции Helicobacter pylori и гастрита с атрофией на гастрин сыворотки и секрецию желудочной кислоты у здоровых мужчин. Гут 1993; 34: 1032–1037.
    12. Асака М., Като М., Кудо М., Катагири М., Нишикава К., Кошияма Х., Такеда Х., Йошида Дж., Грэм Д.Ю. Атрофические изменения слизистой оболочки желудка вызваны инфекцией Helicobacter pylori , а не старением: исследования у бессимптомных взрослых японцев.Helicobacter 1996; 1:52–56.
    13. You WC, Zhang L, Gail MH, Li JY, Chang YS, Blot WJ, Zhao CL, Liu WD, Li HQ, Ma JL, Hu YR, Bravo JC, Correa P, Xu GW, Fraumeni JF Jr: Предраковые поражения у двух округа Китая с контрастным риском рака желудка. Int J Epidemiol 1998;27:945–948.
    14. Borch K, Jonsson KA, Petersson F, Redeen S, Mardh S, Franzen LE: Распространенность гастродуоденита и инфекции Helicobacter pylori в выборке населения в целом: связь с симптоматикой и образом жизни.Dig Dis Sci 2000; 45: 1322–1329.
    15. Малекзаде Р., Сотоуде М., Дерахшан М.Х., Микаэли Дж., Язданбод А., Мерат С., Юнесси А., Тавангар М., Абеди Б.А., Сотудехманеш Р., Пуршамс А., Асгари А.А., Дулатшахи С., Ализаде Б.З., Арши С., Маджидпур А., Мир Мумен S, Fleischer DE: Распространенность предраковых поражений желудка в Ардебиле, провинции с высокой заболеваемостью аденокарциномой желудка на северо-западе Ирана.Дж. Клин Патол 2004; 57: 37–42.
    16. Broutet N, Plebani M, Sakarovitch C, Sipponen P, Megraud F, Eurohepygast Исследовательская группа: пепсиноген A, пепсиноген C и гастрин как маркеры атрофического хронического гастрита у европейских диспепсий. Бр Дж. Рак 2003; 88: 1239–1247.
    17. Иноуэ М., Кобаяши С., Мацуура А., Хамадзимал Н., Тадзима К., Томинага С.: Согласование эндоскопических данных и уровней пепсиногена в сыворотке как показатель атрофического гастрита.Эпидемиологические биомаркеры рака. Пред. 1998; 7:261–263.
    18. Kuipers EJ: Через дверь: серология атрофического гастрита. Eur J Gastroenterol Hepatol 2003;15:877–879.
    19. Ricci C, Vakil N, Rugge M, Gatta L, Perna F, Osborn JF, Russo VM, Tampieri A, Bernabucci V, Miglioli M, Vaira D: Серологические маркеры атрофии желудка у бессимптомных пациентов, инфицированных Helicobacter pylori .Am J Gastroenterol 2004; 99: 1910–1915.
    20. Ley C, Mohar A, Guarner J, Herrera-Goepfert R, Figueroa LS, Halperin D, Parsonnet J: маркеры скрининга хронического атрофического гастрита в штате Чьяпас, Мексика. Эпидемиологические биомаркеры рака. Пред. 2001; 10:107–112.
    21. Диксон М.Ф., Гента Р.М., Ярдли Дж.Х., Корреа П.: Классификация и градация гастрита.Обновленная Сиднейская система. Международный семинар по гистопатологии гастрита, Хьюстон, 1994 г. Am J Surg Pathol, 1996; 20:1161–1181.
    22. Genta RM: Атрофия желудка и атрофический гастрит — туманные понятия в поисках определения. Aliment Pharmacol Ther 1998; 12:17–23.
    23. Диксон М.Ф.: Перспективы вмешательства в канцерогенез желудка: обратимость желудочной атрофии и кишечной метаплазии.Гут 2001; 49: 2–4.
    24. Rugge M, Correa P, Dixon MF, Fiocca R, Hattori T, Lechago J, Leandro G, Price AB, Sipponen P, Solcia E, Watanabe H, Genta RM: Атрофия слизистой оболочки желудка: согласованность между наблюдателями с использованием новых критериев для классификации и оценки. Aliment Pharmacol Ther 2002;16:1249–1259.
    25. Асака М., Сугияма Т., Нобута А., Като М., Такеда Х., Грэм Д.Ю.: Атрофический гастрит и кишечная метаплазия в Японии: результаты большого многоцентрового исследования.Helicobacter 2001; 6: 294–299.
    26. Ходжо М., Мива Х., Окуса Т., Окура Р., Куросава А., Сато Н.: Изменение гистологического гастрита после лечения инфекции Helicobacter pylori . Aliment Pharmacol Ther 2002; 16:1923–1932.
    27. Nardone G, Rocco A, Malfertheiner P: Обзорная статья: Helicobacter pylori и молекулярные события при предраковых поражениях желудка.Aliment Pharmacol Ther 2004; 20:261–270.
    28. Satoh K: Приводит ли эрадикация Helicobacter pylori к излечению атрофического гастрита или кишечной метаплазии? Данные из Японии. Gastroenterol Clin North Am 2000;29:829–835.
    29. Уэмура Н., Окамото С., Ямамото С., Мацумура Н., Ямагути С., Ямакидо М., Танияма К., Сасаки Н., Шлемпер Р.Дж.: инфекция Helicobacter pylori и развитие рака желудка.N Engl J Med 2001; 345: 784–789.
    30. Вонг Б.К., Лам С.К., Вонг В.М., Чен Д.С., Чжэн Т.Т., Фэн Р.Э., Лай К.С., Ху В.Х., Юэн С.Т., Люн С.И., Фонг Д.Ю., Хо Дж., Чинг К.К., Чен Д.С.; Китайская группа по изучению рака желудка: Ликвидация Helicobacter pylori для предотвращения рака желудка в регионе высокого риска Китая: рандомизированное контролируемое исследование. ДЖАМА 2004; 291:187–194.

    Детали статьи/публикации

    Предварительный просмотр первой страницы

    Опубликовано в сети: 10 сентября 2007 г.
    Дата выпуска выпуска:

    сентября 2007 г.

    Количество печатных страниц: 4
    Количество фигурок: 0
    Количество столов: 1

    ISSN: 0257-2753 (печать)
    eISSN: 1421-9875 (онлайн)

    Для получения дополнительной информации: https://www.karger.com/DDI


    Авторское право / Дозировка препарата / Отказ от ответственности

    Авторское право: Все права защищены. Никакая часть данной публикации не может быть переведена на другие языки, воспроизведена или использована в любой форме и любыми средствами, электронными или механическими, включая фотокопирование, запись, микрокопирование или любую систему хранения и поиска информации, без письменного разрешения издателя. .
    Дозировка препарата: авторы и издатель приложили все усилия, чтобы гарантировать, что выбор препарата и дозировка, указанные в этом тексте, соответствуют текущим рекомендациям и практике на момент публикации.Тем не менее, в связи с продолжающимися исследованиями, изменениями в правительственных постановлениях и постоянным потоком информации, касающейся лекарственной терапии и реакций на лекарства, читателю настоятельно рекомендуется проверять вкладыш в упаковке для каждого лекарства на предмет любых изменений в показаниях и дозировке, а также для дополнительных предупреждений. и меры предосторожности. Это особенно важно, когда рекомендуемый агент является новым и/или редко используемым лекарственным средством.
    Отказ от ответственности: заявления, мнения и данные, содержащиеся в этой публикации, принадлежат исключительно отдельным авторам и участникам, а не издателям и редакторам.Появление рекламы и/или ссылок на продукты в публикации не является гарантией, одобрением или одобрением рекламируемых продуктов или услуг или их эффективности, качества или безопасности. Издатель и редактор(ы) отказываются от ответственности за любой ущерб людям или имуществу в результате любых идей, методов, инструкций или продуктов, упомянутых в содержании или рекламе.

    Атрофический гастрит — wikidoc

    Главный редактор: C.Майкл Гибсон, MS, MD [1] Заместитель главного редактора:

    Пищеварительная система

    Обзор

    Атрофический гастрит представляет собой процесс хронического воспаления слизистой оболочки желудка, приводящий к гибели железистых клеток желудка и возможному замещению их кишечной и фиброзной тканью. В результате нарушается секреция желудком основных веществ, таких как соляная кислота, пепсин и внутренний фактор, что приводит к проблемам с пищеварением, дефициту витамина B12 и мегалобластной анемии.Это может быть вызвано персистирующей инфекцией Helicobacter pylori или может иметь аутоиммунное происхождение.

    Аутоиммунный метапластический атрофический гастрит (АМАГ) — наследственная форма атрофического гастрита, характеризующаяся иммунным ответом, направленным против париетальных клеток и внутреннего фактора. Характерными признаками являются наличие сывороточных антител к париетальным клеткам и внутреннему фактору. Аутоиммунный ответ впоследствии приводит к разрушению массы париетальных клеток, что затем приводит к глубокой гипохлоргидрии (и повышению уровня гастрина).Неадекватное производство внутреннего фактора также приводит к нарушению всасывания витамина B12 и пернициозной анемии. AMAG обычно ограничивается телом и дном желудка.

    Гипохлоргидрия вызывает гиперплазию G-клеток (продуцирующих гастрин), что приводит к гипергастринемии. Гастрин оказывает трофическое действие на энтерохромаффиноподобные клетки (клетки ECL ответственны за секрецию гистамина) и предположительно является одним из механизмов, объясняющих злокачественную трансформацию клеток ECL в карциноидные опухоли при AMAG.

    Пациенты с AMAG и пернициозной анемией также подвержены повышенному риску развития аденокарциномы желудка. Оптимальная стратегия эндоскопического наблюдения неизвестна, но у этих пациентов следует удалить все узлы и полипы.

    Экологический метапластический атрофический гастрит (EMAG) возникает из-за факторов окружающей среды, таких как диета и инфекция H. pylori . EMAG обычно ограничивается телом желудка. Пациенты с EMAG также подвержены повышенному риску рака желудка.

    Недавние исследования показали, что AMAG является результатом атаки иммунной системы на париетальные клетки, атака инициируется H. pylori посредством механизма, называемого молекулярной мимикрией.

    Историческая перспектива

    Классификация

    Патофизиология

    Причины

    Побочный эффект препарата

    Пантопразол

    Дифференциация атрофического гастрита от других заболеваний

    Эпидемиология и демография

    Факторы риска

    Скрининг

    Естественная история, осложнения и прогноз

    Естествознание

    Осложнения

    Прогноз

    Диагностика

    Критерии диагностики

    История и симптомы

    Медицинский осмотр

    Лабораторные выводы

    Результаты визуализации

    Другие диагностические исследования

    Дифференциальная диагностика

    Дифференциальная диагностика

    Атрофический гастрит необходимо дифференцировать с: [1] [2] [3] [4] [5] [6] [7] 7 804 9]

    Лечение

    Медицинская терапия

    Хирургия

    Профилактика

    Ссылки

    1. Сугимати К., Инокути К., Кувано Х., Оойва Т. (1984).«Острый гастрит клинически классифицируется в соответствии с данными как верхних отделов желудочно-кишечного тракта, так и эндоскопии». Scand J Гастроэнтерол . 19 (1): 31–7. PMID 6710074.
    2. Сиппонен П., Маарус Х.И. (2015). «Хронический гастрит». Scand J Гастроэнтерол . 50 (6): 657–67. дои: 10.3109/00365521.2015.1019918. PMC 4673514. PMID 256.
    3. Сартор РБ (2006). «Механизмы заболевания: патогенез болезни Крона и язвенного колита». Nat Clin Pract Gastroenterol Hepatol . 3 (7): 390–407. doi: 10.1038/ncpgasthep0528. PMID 16819502.
    4. Сиппонен П. (1989). «Атрофический гастрит как предраковое состояние». Энн Мед . 21 (4): 287–90. PMID 2789799.
    5. Бадильо Р., Фрэнсис Д. (2014). «Диагностика и лечение гастроэзофагеальной рефлюксной болезни». World J Gastrointest Pharmacol Ther . 5 (3): 105–12. дои: 10.4292/wjgpt.v5.i3.105. PMC 4133436. PMID 25133039.
    6. Рамакришнан К., Салинас Р.К. (2007). «Язвенная болезнь». Семейный врач . 76 (7): 1005–12. PMID 17956071.
    7. Банаш М., Шмитц Ф. (2007). «Диагностика и лечение гастриномы в эпоху ингибиторов протонной помпы». Вена Клин Вохеншр . 119 (19–20): 573–8. doi: 10.1007/s00508-007-0884-2. PMID 17985090.
    8. Дикен Б.Дж., Бигам Д.Л., Касс С., Макки Дж.Р., Джой А.А., Гамильтон С.М. (2005).«Аденокарцинома желудка: обзор и соображения для будущих направлений». Энн Сург . 241 (1): 27–39. PMC 1356843. PMID 15621988.
    9. Гимире П., Ву Г.Ю., Чжу Л. (2011). «Первичная лимфома желудочно-кишечного тракта». Мир J Гастроэнтерол . 17 (6): 697–707. дои: 10.3748/wjg.v17.i6.697. PMC 3042647. PMID 213

      .

    Шаблон:WS Шаблон: WH

    Формула Jianpiyiqi облегчает течение хронического атрофического гастрита у крыс путем модулирования сигнального пути Wnt/β-катенина

    Введение

    Хронический атрофический гастрит (ХАГ) является частым заболевания желудочно-кишечного тракта, характеризующиеся атрофией желез желудка, уменьшение количества желудочных желез и хроническое воспаление (1).Типичные клинические симптомы пациентов с ХАГ включают снижение аппетита, тошноту и кислотность рефлюкс (2). Хеликобактер pylori (H. pylori), курение, употребление алкоголя и иммунные аномалии могут привести к развитию ХАГ (3). Кроме того, ХАГ является предраковым состояние рака желудка (РЖ). Поэтому эффективно и своевременно лечение ХАГ может помочь предотвратить возникновение РЖ (4,5). Ингибиторы протонной помпы, антибиотики, фолиевая кислота, витамины и средства для защиты слизистой оболочки желудка часто используются в качестве традиционные методы лечения пациентов с ХАГ (6).Однако не хватает конкретных препараты, которые могут обратить вспять атрофию у пациентов с ХАГ в клинических условиях. упражняться.

    Формула

    Jianpiyiqi, также называемая Weiwei No. 1, представляет собой тип формулы традиционной китайской медицины (ТКМ) и используется для лечить ХАГ в клинических условиях (7). Формула Jianpiyiqi не является коммерческим продуктом. в настоящее время не хватает эффективных коммерческих формул для лечения ХАГ в клинике. Формула Jianpiyiqi состоит из 12 китайских лекарственные травяные компоненты/ингредиенты: Даншэнь, Байчжу, Фулин, Ганьцао, Ченпи, Банься, Мусян, Шарен, Эчжу, Байуашешецао, Юнмуши и Юджин (таблица I).это в основном применяется у больных ХАГ со слабой селезенкой и желудком, застой ци и застой крови согласно теории ТКМ (8). Тем не менее, фармакологический механизмы действия формулы Jianpiyiqi для улучшения ЦАГ оставался неуловимым. В настоящем исследовании крысиная модель CAG, индуцированная N-метил-N’-нитро-N-нитрозогуанидин и ранитидин были сконструированы для оценки молекулярной фармакологии формулы Jianpiyiqi.

    Таблица I

    Компоненты формулы Jianpiyiqi.

    Таблица I

    Компоненты формулы Jianpiyiqi.

    Китайское название Латинское или английское Наименование Части растения Количество (г) Весовая доля (%)
    Дангшен Кодонопсис pilosula (франц.) Nannf. Корень 15 10,27
    Байчжу Атрактилис macrocephala (Koidz.) Рук.-мазз. Корневище 10 6,85
    Fuling Poria cocos (Schw.) Wolf Sclerotia 10 6.85
    Gancao Glycyrrhiza uralensis Fisch Rhizoma 3 2,05
    Chenpi Цитрусовые reticulata Blanco Peel 6 4.11
    Banxia Pinellia терната (Thunb.) Макино Клубень 6 4.11
    Мусян Окландия Лаппа Декне. Корень 10 6.85
    Шарен Амомум villosum Лур. Фрукты 6 4.11
    Ежу Куркума aeruginosa Roxb. Корневище 10 6,85
    Baihuasheshecao Олденландия diffusa (Виллд.) Роксб. Целая трава 30 20,55
    Юджин Куркума wenyujin Y. H. Chen & C. Ling Корневой клубень 10 6,85
    Yunmushi A Na Na 30 30 20.55
    Total NA Na 146 100.00 1002685

    Слизистая желудка больных ХАГ постоянно повреждается различными патогенными факторами и не может быть отремонтированы в течение достаточного периода времени (1).Сообщается, что ущерб восстановление и пролиферация эпителиальных клеток желудка тесно связаны с сигнальным путем Wnt/β-катенин (9-12). Инфекция H. pylori связана с экспрессией β-катенин в ХАГ с кишечной метаплазией (13). ГК был связан с повышенным экспрессия сигнального пути Wnt/β-катенина, который может способствуют аномальной пролиферации клеток желудочной железы, а затем вызывать опухоли (14). На сегодняшний день ограниченное количество исследований изучало связь между CAG и сигнальный путь Wnt/β-катенин (15).Поэтому цель настоящего целью исследования было выяснение фармакологических механизмов действия Формула Jianpiyiqi в лечении ХАГ через Wnt/β-катенин сигнальный путь.

    Материалы и методы
    Реагенты

    N-метил-N’-нитро-N-нитрозогуанидин (MNNG) был приобретен у Tokyo Chemical Industry Co., Ltd. Ранитидин гидрохлорид был приобретен у Shanghai Hengshan Pharmaceutical. Co., Ltd. Ликвиритин, гесперидин, лобетиолин, курдион, костунолид и атрактиленолид II были приобретены в Chengdu Must. Биотехнология Ко., Ltd. Набор для окрашивания H&E и простагландин Набор E2 (PGE2) ELISA (каталожный номер H099-1) был приобретен в Нанкинском институте биоинженерии Цзяньчэн. Метанол и ацетонитрил были приобретены у EMD Millipore. Этанол уксусный кислота, ксилол и формальдегид были приобретены у Sinopharm Chemical Reagent Co., Ltd. Гастрин (GAS), пепсин (PP) и Наборы ELISA на соматостатин (SS) были приобретены у Elabscience, Inc. Wnt1 был приобретен у Abcam Co., Ltd. β-катенин, гликоген антитела к синтазы-киназы-3β (GSK-3β) и циклину D1 и коза были приобретены вторичные антитела против кроличьего и мышиного IgG. от Cell Signaling Technology, Inc.Праймеры ПЦР для Wnt1, Были произведены Wnt5a, β-катенин, GSK-3β, циклин D1, MMP7 и GAPDH. от Nanjing Genscript Biological Technology Co., Ltd. Реактив TRIzol®, синтез кДНК первой цепи Maxima Набор для ПЦР с обратной транскрипцией и Maxima SYBR Green/ROX набор для количественной ПЦР был получен от Thermo Fisher Scientific, Инк

    Приготовление формулы Jianpiyiqi водный экстракт

    Все лекарственные травы, используемые для приготовления Формула Jianpiyiqi была приобретена в провинции Цзянсу. Больница китайской и западной медицины (Нанкин, Китай).Все имели их личность подтверждена профессором Шихуэй Цянем (китайская медицина Лаборатория растительных ресурсов, Институт исследований провинции Цзянсу традиционной китайской медицины) и хранить в сухом и вентилируемом лабораторный кабинет. Одна партия весила 146 г и состояла из 12 Китайские лекарственные травы/ингредиенты: Дангшен, Байчжу, Фулин, Ганьцао, Ченпи, Банься, Мусян, Шарен, Эчжу, Байуашшецао, Юнмуши и Юджин (таблица I). 146 г травяной смеси помещают в круглодонную колбу и замачивают на 0,5 ч в 1.46 литров воды. Вода, содержащая травы кипятили 0,5 ч непрерывно. Водный экстракт был естественным образом охлаждали до комнатной температуры, затем фильтровали и собирал впервые. Затем влили 0,73 л воды. добавляют в круглодонную колбу с последующим непрерывным кипячением за 0,5 ч. Водная вытяжка охлаждалась естественным образом до комнатной температуры. температуру отфильтровывали и собирали во второй раз. дважды собранные водные экстракты концентрировали до 48,7 мл (эквивалентно до концентрации препарата 3 г/мл) с помощью вакуумно-ротационного испарителя и хранят при температуре -80°С в холодильнике со сверхнизкой температурой.

    Животные

    В общей сложности 20 самцов крыс Sprague Dawley [масса тела, 200±20 г; возраст, 6-8 недель; сертификат качества животного №. SCXK (Вс) 2019-0001] были приобретены в Центре лабораторных животных Университет Наньтун. Все крысы содержались в условиях 12-часового режима свет/темнота. цикла и размещен в Центре лабораторных животных в Цзянсу. Провинциальный институт традиционной китайской медицины (Нанкин, Китай). Животные имели свободный доступ к пище и воде. в помещении с температурой 20˚C и влажностью 50%.Экспериментальные операции на животных соответствовали Руководству Благополучие и этика лабораторных животных (выпущено Генеральным Управление по надзору за качеством, инспекцией и карантином КНР) и Руководство по уходу и использованию лабораторных Животные (выпущено Национальным институтом здравоохранения США). Эксперимент на животных настоящего исследования был одобрен Этическим комитетом. Комитет провинции Цзянсу по объединению китайского и западного Медицинская больница (Нанкин, Китай; разрешение №. AEWC-20160810-12).

    Создание CAG крыс модели

    20 самцов крыс Sprague Dawley были случайным образом разделены на пустую группу, модельную группу, препарат положительного контроля группа (2,7 мг/кг фолиевой кислоты и 13,5 мг/кг тепренона) и Jianpiyiqi формульная группа (13,2 г/кг сырого препарата). Всего было 5 крыс. каждая группа. Крысы в ​​модельных группах CAG были предоставлены бесплатно. с питьевой водой, содержащей 150 мкг/мл МНГ, и с пищей содержащий 0,03% ранитидина. Построение крысиной модели CAG длился 24 недели.Затем крысам вводили препараты через желудочный зонд в группе препаратов положительного контроля и формуле Jianpiyiqi группа. Крысам в контрольной и модельной группах вводили через зонд стерильная вода. Эксперимент был прекращен через 8 нед. лечение. Регистрировали массу тела и суточное потребление пищи. Все крыс анестезировали внутрибрюшинной инъекцией 30 мг/кг (масса тела) пентобарбитал натрия. Затем было взято 20 мл крови. брали из брюшной аорты живых анестезированных крыс.После полного сбора крови крысы умирали естественным путем. из-за обескровливания.

    Высокоэффективная жидкостная хроматография (ВЭЖХ) анализ

    Ликвиритин, гесперидин, лобетиолин, курдион, костунолида и атрактиленолида II готовили к раствору 1 мг/мл в метаноле. Шесть соединений смешивали в равных количествах. пропорции для анализа ВЭЖХ. Извлечение воды по формуле Jianpiyiqi раствор (3 г/мл неочищенного лекарственного средства) разбавляли до 1 г/мл раствором с метанол для анализа ВЭЖХ.Все образцы были разделены с помощью Хроматографическая колонка C18 (5 мкм; 250×4,6 мм) в Система ВЭЖХ Waters 2695 и обнаружение в детекторе Waters 2489 (корпорация Уотерс). Подвижные фразы представляли собой воду, содержащую 0,1% муравьиной кислоты. кислоты (растворитель А) и ацетонитрила (растворитель Б). Подвижная фаза Процедура элюирования была следующей: Растворитель А меняли от 95 до 85% от 0 до 30 мин, растворитель А варьировали от 85 до 70% от 30 мин. до 45 мин растворитель А варьировали от 70 до 30% от 45 до 55 мин и растворитель А оставался на уровне 30% от 55 до 60 мин.Колонка температура 30°С, объем загрузки образца 25 мкл, поток скорость составляла 1 мл/мин, а длина волны обнаружения составляла 230 нм.

    Окрашивание H&E

    Ткани желудка крыс фиксировали в 4% формалине при 25°C в течение 24 часов и подвергалась стандартной дегидратации этанолом. и заливка парафином. Заложенные ткани разрезали на 5-мкм срезов с помощью колесного слайсера Leica Biosystems RM2245 (Leica Микросистемс ГмбХ). Ломтики выпекали в духовке при температуре 60°С в течение 2 часов. ч, а затем были депарафинированы и регидратированы.В последующем дольки окрашивали гематоксилином (Nanjing Jiancheng Bioengineering института) при 25°C в течение 3 мин и эозина (Nanjing Jiancheng Институт биоинженерии) при 25°С в течение 30 сек. Окрашенные ломтики обезвоживали этанолом, просветляли ксилолом, помещали на стекло предметные стекла с нейтральным бальзамом и покрытые покровными стеклами. Крыса ткани желудка визуализировали с помощью инвертированного света Olympus CKX-41. микроскоп (Olympus Corporation) при увеличении х100. Атрофия воспаление желудочных желез оценивали по шкале визуальная аналоговая шкала новой Сиднейской системы (16,17).Балльную оценку патологии проводили независимо два экзаменаторов, и, наконец, было взято среднее значение.

    ИФА

    Содержимое ГАЗ (кат. № E-EL-R0472c; Elabscience, Inc.), полипропилен (номер по каталогу E-EL-R0719c; Elabscience, Inc.), SS (каталожный номер E-EL-R0914c; Elabscience, Inc.) и PGE2 (каталожный номер H099-1; Нанкинский институт биоинженерии Цзяньчэн) в крысиная сыворотка определялась в соответствии с протоколами производителя для наборов ИФА. Крысиную сыворотку добавляли в 96-луночный планшет с покрытием. микропланшет.Антитела и HRP-конъюгированный стрептомицин были добавил в тарелку. Затем 96-луночный микропланшет запечатывали. с парафильмом и инкубировали при 37°С в течение 1 часа. Решение в скважины были затем полностью отброшены. Микропланшет промывали пятью раз с промывочным буфером и инкубировали с диаминобензидином (DAB) хромогенный реагент при 37°С в течение 10 мин и прекращение реакции затем сразу добавляли раствор. Значение оптической плотности (ОП) всех лунок измеряли при длине волны 450 нм с помощью прибора Tecan Автоматический считыватель микропланшетов M200 pro (Tecan Group, Ltd.). Согласно к уравнению линейной регрессии стандартной кривой и значениям OD образцов в каждой группе, соответствующий образец рассчитывали концентрацию.

    Иммуногистохимия (ИГХ)

    Ткани желудка, залитые парафином, были разрезаны на Срезы толщиной 3 мкм. После того, как ломтики были запечены, слайды были погружены в воду. в цитратном демаскирующем растворе для поиска антигена и кипятили при 100°С в течение 5 мин. Срезы инкубировали с 3% водородом. перекиси в течение 10 мин и блокировали 0.5 мл блокирующего раствора на 1 ч при комнатной температуре. Предметные стекла покрывали 0,2 мл Wnt1. (разведение 1:300; № по каталогу ab15251; Abcam), β-катенин (1:300 разбавление; номер кота 7074; Cell Signaling Technology, Inc.), GSK-3β (разведение 1:300; кат. № 7074; Cell Signaling Technology, Inc.) и циклин D1 (разведение 1:300; кат. № 7074; Cell Signaling Technology, Inc.) первичных антител и инкубировали в течение ночи при 4°C. Ломтики затем инкубировали с 0,2 мл вторичного антитела, конъюгированного с HRP. (разведение 1:500; кат.7074; Cell Signaling Technology, Inc.) в во влажной камере при 25°С в течение 1 часа. Слайды инкубировали 0,5 мл раствора ДАБ в течение 5 мин и срезы докрасили гематоксилином при 25°С в течение 30 сек. Слайды были смонтирована с нейтральным бальзамом и покрыта с помощью покровные стекла. Ткани желудка крыс визуализировали с помощью Olympus. Инвертированный световой микроскоп CKX-41 (Olympus Corporation) с увеличением x100 увеличение. Окрашивание срезов ИГХ определяли с помощью Имидж-Про Плюс 6.0 (Media Cybernetics, Inc.).

    Количественная обратная транскрипция (RT-q) ПЦР

    Тотальную РНК экстрагировали из тканей желудка крысы. с использованием реагента ТРИЗОЛ. Выделенную РНК подвергали обратной транскрипции. в комплементарную ДНК с использованием кДНК Maxima First Strand Набор для ПЦР с обратной транскрипцией синтеза согласно протокол производителя. Условия реакции: 25°С в течение 10 мин, 50°С в течение 15 мин и 85°С в течение 5 мин. Относительная мРНК уровни экспрессии Wnt1, Wnt5a, β-катенина, GSK-3β, циклина D1 и ММР7 были обнаружены с помощью Applied Biosystems StepOnePlus. оборудование для количественной флуоресцентной ПЦР (Applied Biosystems; Thermo Фишер Сайентифик, Инк.) с Maxima SYBR Green/ROX набор для количественной ПЦР согласно протоколу производителя. Условия термоциклирования были следующими: один цикл при 95°C в течение 15 мин, затем 40 циклов: 95°C в течение 15 секунд, 60°C в течение 30 секунд и 72°C в течение 30 секунд. Относительную экспрессию мРНК анализировали и рассчитывали с использованием 2-∆∆Cq-метод (18), с геном домашнего хозяйства GAPDH, используемым в качестве контрольного гена. последовательности всех праймеров для КПЦР перечислены в Таблице II.

    Таблица II

    Последовательности праймеров, использованных для количественная ПЦР.

    Таблица II

    Последовательности праймеров, использованные для количественная ПЦР.

    Название гена Прямая последовательность (5′-3′) Обратная последовательность (5′-3′) Длина изделия (п.н.)
    Wnt1 AACAGTAGTGGCCGATGGTG GGGTTCTGTCGGATCAGTCG 143
    Wnt5a CCAGTACCAGTTCCGGCATC GCCTATTTGCATCACCCTGC 82
    β-катенин CAGATCCCATCCACGCAGTT TCTGTGACGGTTCAGCCAAG 70
    Гликогенсинтаза киназа-3β TCCTTATCCCTCCTCACGCT GATGCAGAAGCGGCGTTATT 118
    Циклин D1 CAAGTGTGACCCGGACTGC GACCAGCTCTTCCTCCACTT 137
    MMP7 GATGGGCCAGGAAACACTCT TCAAAGTGAGCATCTCCGCC 71
    GAPDH GTGAAGGTCGGTGTGAACGG CCACTTTGTCACAAGAGAAGGC 76
    Анализ статистики

    Значения выражены как среднее ± стандарт отклонение.Различия между группами анализировали с помощью одностороннего ANOVA с последующим апостериорным тестом Тьюки. P<0,05 считалось для обозначения статистически значимой разницы. Данные были проанализированы с использованием программного обеспечения SPSS 22.0 (IBM Corp.), и графики были построено с помощью программного обеспечения GraphPad Prism 5.0 (GraphPad Software, Инк.).

    Результаты
    ВЭЖХ хроматограмма Jianpiyiqi формула

    Формула Jianpiyiqi рецепта TCM является экстракт 12 китайских лекарственных трав/ингредиентов (таблица I).Химический состав формула сложная. В настоящем исследовании формула Jianpiyiqi была готовили и исследовали его хроматограмму ВЭЖХ (фиг. 1А). Анализ ВЭЖХ показал, что относительно высокие концентрации ликиритина и гесперидина. присутствует в экстракте (рис. 1А). Результаты ВЭЖХ показали, что гесперидин является основным активным компонентом Формула Цзяньпийци. Шесть соединений ликвиритин, гесперидин, использовались лобетиолин, курдион, костунолид и атрактиленолид II. в качестве контроля для идентификации фармацевтически значимых компонентов формула (рис.1Б).

    Влияние формулы Jianpiyiqi на организм вес, потребление пищи, морфология и патология желудка крыс с КАГ

    После создания модели ЦАГ у крыс, индуцированных MNNG и ранитидин, терапевтический эффект Jianpiyiqi формула на CAG была оценена. Экспериментальные результаты показали по сравнению с контрольной группой, живой массой и потреблением корма крыс уменьшились, а слизистая желудка атрофировалась и воспаление появилось в модельной группе. формула Цзяньпийци значительно улучшилась масса тела и потребление пищи крысы (рис.2А и В). Желудки всех крыс разрезали вдоль сторону большой кривой и морфологию желудка визуализировали с помощью камера. По сравнению с контрольной группой ткань желудка в модельной группе выглядели немного бледнее и имели меньше желудочных складки. Кроме того, формула Jianpiyiqi и положительный контроль препараты улучшали морфологию желудка (рис. 2С). Затем ткань желудка крысы окрашивали H&E для патологического наблюдения. Атрофия и воспаление ткани желудка оценивали по новой Сиднейской системе. (16).Выраженная атрофия желудка и воспаления наблюдались в модельной группе CAG. После Цзяньпийци лечение формулами, атрофия и воспаление желудочных желез был улучшен. Кроме того, препараты положительного контроля значительно улучшенная атрофия желудка (рис. 2D-F).

    Влияние формулы Jianpiyiqi на GAS, PP, SS и PGE2 у крыс с CAG

    Затем были определены факторы, связанные со слизистой оболочкой желудка. обнаружены для оценки лечебного эффекта формулы Jianpiyiqi на ЦАГ. Содержание GAS, PP, SS и PGE2 в сыворотке крови крыс. были измерены с помощью ИФА.По сравнению с теми, кто был в пустой группе, содержание GAS, PP, SS и PGE2 было снижено в группа моделей крыс CAG. Указано, что положительный контроль препараты значительно повышали содержание СС. Кроме того, Формула Jianpiyiqi значительно улучшила секрецию желудочного сока. факторы, связанные со слизистой оболочкой (GAS, PP, SS и PGE2) в сыворотка крыс ХАГ (рис. 3).

    Рисунок 3

    Влияние формулы Jianpiyiqi на GAS, ФП, СС и ПГЕ2 в сыворотке крови крыс с ХАГ.В конце В эксперименте на животных была собрана крысиная сыворотка и использована для определить содержание (A) ГАЗ, (B) PP, (C) SS и (D) PGE2 по протоколу ИФА. *P<0,05 и **P<0,01 по сравнению с модельной группой. ХАГ, хронический атрофический гастрит; ГАЗ, гастрин; РР, пепсин; SS, соматостатин; ПГЕ2, простагландин Е2.

    Влияние формулы Цзяньпийци на уровни экспрессии белка Wnt1, β-катенина, GSK-3β и циклина D1 у крыс с CAG

    Сигнальный путь Wnt/β-катенин ранее был сообщается, что тесно связан с эффективностью Jianpiyiqi формула у крыс с ХАГ (13). Уровни экспрессии белка in situ Wnt1, β-катенина, GSK-3β и циклин D1 в тканях желудка были обнаружены с помощью ИГХ. Результаты, достижения показали, что по сравнению с контрольной группой белок уровни экспрессии Wnt1, β-катенина и циклина D1 были повышены и экспрессия белка GSK-3β была снижена в модели группа. Кроме того, по сравнению с модельной группой, экспрессия белка GSK-3β была значительно увеличена, а уровни экспрессии белка Wnt1 и β-катенина были значительно снизился в группе положительного контроля.Также было замечено что формула Jianpiyiqi значительно уменьшила содержание белка уровни экспрессии Wnt1, β-катенина и циклина D1 и повышенный экспрессия GSK-3β у крыс с ХАГ (рис. 4).

    Влияние формулы Jianpiyiqi на ген уровни экспрессии Wnt1, Wnt5a, β-катенина, GSK-3β, циклина D1 и MMP7 у крыс с CAG

    Относительные уровни экспрессии мРНК Wnt1, Wnt5a, β-катенин, GSK-3β, циклин D1 и MMP7 в тканях желудка крыс. обнаружены с помощью RT-qPCR. Результаты показали, что ген уровни экспрессии Wnt1, Wnt5a, β-катенина, циклина D1 и MMP7 были значительно повышены, а уровни экспрессии генов GSK-3β были значительно снижены в модельной группе CAG, поскольку по сравнению с таковыми в пустой группе.В положительном контроле группы препаратов не было явных изменений в экспрессии мРНК GSK-3β. наблюдалось, в то время как уровни экспрессии мРНК Wnt5a, β-катенина, ММР7 и циклин D1 были снижены по сравнению с таковыми в модели. группа. Кроме того, формула Jianpiyiqi значительно уменьшила экспрессия генов Wnt1, Wnt5a, β-катенина, циклина D1 и MMP7 и значительно увеличил экспрессию гена GSK-3β по сравнению с что в модельной группе (рис. 5). Таким образом, на основании результатов экспериментов IHC и RT-qPCR, было высказано предположение, что формула Jianpiyiqi значительно ингибирует сигнальный путь Wnt/β-катенин у крыс с ХАГ.

    Обсуждение

    ХАГ часто сопровождается кишечными метаплазия и интраэпителиальная неоплазия, которые считаются предраковые поражения РЖ (PLGC) (19). Поэтому необходимо срочно выявить новые и эффективные методы лечения ХАГ. В последние годы, достигнуты значительные успехи в лечении больных с КАГ с использованием ТКМ (20,21). Предыдущие исследования in vivo показали, что составы ТКМ способны улучшать состояние слизистой оболочки желудка. атрофии, включая модифицированный отвар сыцзюньцзы (22), отвар вэйци (23), отвар банься сэсинь (24) и хуанци цзяньчжун тан (25).Формула Jianpiyiqi — это традиционная китайская медицина. рецепт, который может быть использован для эффективного лечения ХАГ в поликлиника (7,8). Однако механизмы действия Формула Jianpiyiqi в лечении ХАГ осталась нерешенной. разъяснено. Смесь фармакологически активных компонентов в водный экстракт формулы комплексный. В меру наших знаний, ни одно предыдущее исследование не сообщало об анализе Jianpiyiqi формула с помощью ВЭЖХ. Таким образом, настоящее исследование впервые построило ВЭЖХ хроматограмма формулы Jianpiyiqi для контроля качества лекарств и последующее исследование его фармакологических механизмов.Были идентифицированы ликвиритин и гесперидин, а также основные компоненты формула. Хотя предыдущие исследования предполагали, что ликвиритин и гесперидин обладают противовоспалительным и противоопухолевым действием. свойства (26,27), два соединения не представляют все компоненты формулы. Эффекты ликвиритина и гесперидин на CAG необходимо проверить дальнейшими экспериментами в будущее.

    Сообщалось, что сигнальный путь Wnt играет важную роль в пролиферации слизистой оболочки желудка эпителий (12).Кроме того, пролиферация эпителиальных клеток слизистой оболочки желудка у больных с CAG ингибируется или задерживается (1). Многочисленные исследования показали, что передача сигналов Wnt/β-катенин путь связан с GC (11,14). ХАГ является предраковым заболеванием желудка, которое отличается от РЖ. Тем не менее, ограниченные исследования изучали взаимосвязь между CAG и сигнальный путь Wnt/β-катенин (13,15). Поэтому целесообразно исследовать механизмы Действие формулы Jianpiyiqi при лечении ХАГ включает Сигнальный путь Wnt/β-катенин.

    В настоящем исследовании MNNG-индуцированная модель CAG у крыс было установлено (28) и использовалось оценить влияние формулы Jianpiyiqi на CAG. Это было указали, что формула значительно улучшила атрофию желудка и уменьшить воспаление желудка. Кроме того, ГАЗ, ПП, СС и PGE2 тесно связаны с развитием CAG (1,4,29-31). GAS был способен способствовать пролиферации клеток слизистой оболочки желудка. увеличивают секрецию желудочного сока и пепсиногена. Кроме того, ПП способствует перевариванию пищи, а СС оказывает сильное ингибирующее действие на секреция желудочного сока.Сообщалось, что PGE2 способен регулировать расслабление и сокращение кровеносных сосудов и оказывают защитное действие на клетки слизистой оболочки желудка (29-31). Настоящее исследование показало, что формула Jianpiyiqi значительно увеличилось содержание ГАЗ, ПП, СС и PGE2 у крыс с ХАГ.

    Канонический сигнальный путь Wnt/β-катенин служит играет важную роль в регуляции пролиферации клеток желудка (32,33). Лиганды Wnt специфически связываются с Завиваются рецепторы, а затем активируются взлохмаченные семейные белки.Активация растрепанных белков приводит к инактивация GSK-3β. В результате накопления и миграция β-катенина из цитоплазмы в ядро, β-катенин способен повышать экспрессию родственных генов (12). Кроме того, передача сигнала Wnt может быть тесно связана с патогенезом ХАГ. Настоящее исследование показало, что сигнальный путь Wnt/β-катенин активируется в модели крыс CAG. Также было установлено, что Формула Jianpiyiqi ингибировала активацию Wnt/β-катенина. сигнальный путь в КАГ.Из-за последовательности моделирования крыс, ошибка экспрессии генов крыс в группе была небольшой. Есть в настоящее время нет золотого стандарта лечения ХАГ в клинике. В зависимости от специфических симптомов у пациентов с ХАГ назначаются соответствующие лечебные препараты. Фолиевая кислота как витамин способен улучшить повреждение слизистой оболочки желудка, а тепренон является желудочным средство для защиты слизистой оболочки (34,35). В настоящем исследовании препараты положительного контроля, выбранные для крысиной моделью CAG были фолиевая кислота и тепренон, так как они обладают определенным эффект для улучшения атрофии желудка в соответствии с предыдущим экспериментальные результаты (23,25).Кроме того, положительный контроль препараты ингибировали уровни экспрессии генов, связанных с сигналом Wnt. В совокупности было показано, что терапевтический эффект Формула Jianpiyiqi на CAG была более эффективной по сравнению с формулой на CAG. препараты положительного контроля.

    В заключение, настоящее исследование показало, что Формула Jianpiyiqi значительно улучшила атрофию желудочных желез и воспаление слизистой оболочки желудка у крыс с ХАГ. Более того, Было показано, что формула Jianpiyiqi ингибирует Wnt/β-катенин. сигнальный путь; экспериментальные данные и предлагаемый путь обобщены на рис.6. Согласно к настоящим результатам, сигнальный путь Wnt может служить важную роль в процессе перехода от CAG к PLGC. Однако, эти результаты должны быть дополнительно подтверждены дополнительными экспериментами в будущем. В целом было высказано предположение, что из-за его многообещающего эффективность, формула Jianpiyiqi может быть более широко использована в клиническое лечение ХАГ.

    Благодарности

    Не применимо.

    Финансирование

    Финансирование: Это исследование было поддержано Национальным Научный фонд Китая (грант No.81804071 и 81573966).

    Наличие данных и материалов

    Наборы данных, использованные и/или проанализированные в течение текущего исследование доступно у соответствующего автора на разумных запрос.

    Вклад авторов

    Эксперименты на животных проводились ZY и TX. ВЭЖХ-анализ был проведен ZA. Иммуногистохимия и RT-qPCR исполняли WC и YX. ZY и FZ внесли основной вклад к дизайну исследования и написанию рукописи.Все авторы подтверждают подлинность всех исходных данных и всех авторы прочитали и одобрили окончательный вариант рукописи.

    Одобрение этики и согласие на участвовать

    Эксперимент на животных в рамках настоящего исследования был одобрен Комитетом по этике провинции Цзянсу. Больница китайской и западной медицины (Нанкин, Китай; разрешение №. AEWC-20160810-12).

    Согласие пациента на публикацию

    Не применимо.

    Конкурирующие интересы

    Авторы заявляют, что у них нет конкурирующих интересы.

    Ссылки

    1

    Li Y, Xia R, Zhang B и Li C: Chronic атрофический гастрит: обзор. J Environ Pathol Toxicol Oncol. 37:241–259. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    2

    Родригес-Кастро К.И., Франчески М., Ното А., Миралья С., Нувенн А., Леандро Г., Мески Т., Де’Анджелис Г.Л. и Ди Марио Ф.: Клинические проявления хронического атрофического гастрита.Акта Биомед. 89:88–92. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    3

    Сон Джей, Ким Н, Ли Джей, Хван ЮДжей, Ким ХВ, Чанг Дж.В., Ким Дж.В. и Ли Д.Х.: Связь между рН желудочного сока, атрофический гастрит, кишечная метаплазия и Helicobacter pylori инфекционное заболевание. Кишечник Печень. 12:158–164. 2018. Просмотр PubMed/NCBI Статья : Академия Google

    4

    Ланер Э., Загари Р.М., Зулло А., Ди Сабатино A, Meggio A, Cesaro P, Lenti MV, Annibale B и Corazza GR: Chronic атрофический гастрит: естественное течение, диагностика и лечение управление.Документ с изложением позиции Итальянского общества больниц Гастроэнтерологи и пищеварительные эндоскописты [AIGO], итальянский Общество пищеварительной эндоскопии [SIED], Итальянское общество гастроэнтерологии [SIGE] и Итальянского общества внутренних Медицина [СИМИ]. Копать печень Dis. 51:1621–1632. 2019. PubMed/NCBI Просмотр статьи: Google Scholar

    5

    Спенс А.Д., Кардвелл Ч.Р., Макменамин Калифорнийский университет, Хикс Б.М., Джонстон Б.Т., Мюррей Л.Дж. и Коулман Х.Г.: Аденокарцинома риск желудочной атрофии и кишечной метаплазии: систематический рассмотрение.БМК Гастроэнтерол. 17(157)2017. PubMed/NCBI Просмотр статьи: Google Scholar

    6

    Аннибале Б., Эспозито Г. и Ланер Э.: А текущий клинический обзор атрофического гастрита. Экспертная версия Гастроэнтерол Гепатол. 14:93–102. 2020. PubMed/NCBI Просмотр статьи: Google Scholar

    7

    Су К.Л., Чжу Ф.С., Ши Т., Сюй Т.Т., Чжан С. и Wang C: Клиническое наблюдение за лечением 62 случаев хронического атрофический гастрит с синдромом недостаточности желудка селезенки Вэйвэй Нет.1 гранула. Фармакология и клиника китайской материи Медика. 29:154–156. 2013 г. (на китайском языке).

    8

    Чжу Ф.С.: Теоретическое исследование лечения хронического атрофического гастрита с помощью формулы Jianpi Yiqi. китайский язык Журнал базовой медицины в традиционной китайской медицине. 23:471–472+487. 2017 г. (на китайском языке).

    9

    Маккракен К.В., Айхара Э., Мартин Б., Кроуфорд CM, Broda T, Treguier J, Zhang X, Shannon JM, Montrose MH и Wells JM: Wnt/бета-катенин способствует спецификации дна желудка у мышей и люди.Природа. 541: 182–187. 2017. PubMed/NCBI Просмотр статьи: Google Scholar

    10

    Лешаке М., Тан С.Х., Вонг А., Свати Ю., Hajamohideen A, Tan LT, Goh J, Wong E, Denil SLIJ, Murakami K и Barker N: главные клетки, экспрессирующие Lgr5, управляют регенерацией эпителия. и рак в оксинтическом желудке. Nat Cell Biol. 19: 774–786. 2017. Просмотр PubMed/NCBI Статья : Академия Google

    11

    Tan SH и Barker N: передача сигналов Wnt в взрослые эпителиальные стволовые клетки и рак.Prog Mol Biol Transl Sci. 153:21–79. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    12

    Flanagan DJ, Austin CR, Vincan E и Phesse TJ: передача сигналов Wnt в желудочно-кишечном эпителиальном стебле клетки. Гены (Базель). 9(178)2018. PubMed/NCBI Просмотр статьи: Google Scholar

    13

    Yu XW, Xu Q, Xu Y, Gong YH и Yuan Y: Экспрессия пути E-кадгерин/β-катенин/tcf-4 в желудочном заболевания, связанные с инфекцией Helicobacter pylori: клиника и патологические последствия.Азиатский Pac J Рак Prev. 15: 215–220. 2014. PubMed/NCBI Просмотр статьи: Google Scholar

    14

    Chiurillo MA: Роль Wnt/β-катенина путь при раке желудка: подробный обзор литературы. Мир J Опыт Мед. 5:84–102. 2015. PubMed/NCBI Просмотр статьи: Google Scholar

    15

    Чу А, Ю С, Го Ц, Ли Ц, Сунь М, Юань И и Gong Y: H. pylori slyD, новый фактор вирулентности, связан с экспрессией белка пути Wnt во время заболевания желудка прогресс.Микроб Патог. 148(104428)2020. PubMed/NCBI Посмотреть статью : Google Scholar

    16

    Диксон М.Ф., Гента Р.М., Ярдли Дж. Х. и Корреа P: Классификация и градация гастрита. Обновленный Сидней система. Международный семинар по гистопатологии гастрита, Хьюстон, 1994. Ам Дж. Сург Патол. 20:1161–1181. 1996. PubMed/NCBI Просмотр статьи: Google Scholar

    17

    Крафа П., Руссо М., Миралья К., Барки А., Мочча Ф., Нувенн А., Леандро Г., Мески Т., Де’Анджелис Г.Л. и Ди Марио Ф.: От Сиднея до ОЛЬГИ: обзор атрофического гастрита.Акта Биомед. 89:93–99. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    18

    Ливак К.Дж. и Шмитген Т.Д.: Анализ данные об относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метод 2(-Delta Delta C(T)). Методы. 25:402–408. 2001. PubMed/NCBI Просмотр статьи: Google Scholar

    19

    Бергер Х., Маркес М.С., Зитлоу Р., Мейер Т.Ф., Machado JC и Figueiredo C: Патогенез рака желудка.Хеликобактер. 21 (Приложение 1): S34–S38. 2016. PubMed/NCBI Просмотр статьи: Google Scholar

    20

    Fang WJ, Zhang XY, Yang B, Sui SJ, Chen M, Pan WH, Liao WQ, Zhong M и Wang QC: Китайский травяной отвар в качестве лечебного средства. дополнительная терапия атрофического гастрита: систематический обзор и метаанализ. Afr J Tradit Дополнение Altern Med. 14: 297–319. 2017. PubMed/NCBI Просмотр статьи: Google Scholar

    21

    Дай Ю.К., Чжан Ю.З., Ли Д.Ю., Е Дж.Т., Цзэн Л.Ф., Ван Ц. и Ху Л.: Эффективность терапии Jianpi Yiqi при хронических заболеваниях. атрофический гастрит: систематический обзор и метаанализ.PLoS Один. 12(e0181906)2017.PubMed/NCBI Посмотреть статью : Google Scholar

    22

    Тянь Г, Ву С, Ли Дж, Лян Б, Чжан Ф, Фан X, Li Z, Wang Y, Li Z, Liu D и др.: Сетевая фармакология на основе исследование эффекта и механизма модифицированного Sijunzi Отвар против подвидов хронического атрофического гастрита. Фармакол рез. 144:158–166. 2019. PubMed/NCBI Просмотр статьи: Google Scholar

    23

    Инь Дж, Йи Дж, Ян С, Сюй Б, Линь Дж, Ху Х, Ву X, Shi H и Fei X: отвар Weiqi ослабляет хронические атрофические гастрит с предраковым поражением путем регуляции нарушение микроциркуляции и сигнального пути HIF-1α.Эвид На основе комплемента Alternat Med. 2019(2651037)2019.PubMed/NCBI Посмотреть статью : Google Scholar

    24

    Ji Q, Yang Y, Song X, Han X и Wang W: Отвар Banxia Xiexin в лечении хронического атрофического гастрит: протокол систематического обзора и метаанализа. Медицина (Балтимор). 99(e22110)2020.PubMed/NCBI Посмотреть статью : Google Scholar

    25

    Лю И, Джин Зи, Цинь Икс и Чжэн Цюй: Мочевая система исследование метаболизма для Huangqi Jianzhong Tang против хронического крысы с атрофическим гастритом по данным 1 H ЯМР и УЭЖХ-Q/TOF РС.Дж Фарм Фармакол. 72:748–760. 2020. PubMed/NCBI Просмотр статьи: Google Scholar

    26

    Вэй Ф, Цзян Х, Гао ХИ и Гао Ш: Ликвиритин индуцирует апоптоз и аутофагию цисплатина. (DDP)-резистентные клетки рака желудка in vitro и ксенотрансплантат голые мыши in vivo . Int J Oncol. 51:1383–1394. 2017. PubMed/NCBI Просмотр статьи: Google Scholar

    27

    Ахмади А., Шадбурестан А., Набави С.Ф., Сетцер В. Н. и Набави С. М.: Роль гесперидина в клеточном сигнале путь трансдукции для профилактики или лечения рака.Курр Мед Хим. 22:3462–3471. 2015. PubMed/NCBI Просмотр статьи: Google Scholar

    28

    Мива Х., Эндо К., Вада Р., Хираи С., Хиросе М., Мисава Х., Нагахара А., Охта К., Ватанабэ С. и Сато Н.: Сотовая связь пролиферация и дифференцировка в атрофической слизистой оболочке желудка крыс индуцированный N’-метил-N’-нитро-N-нитрозогуанидином. Джей Клин Гастроэнтерол. 25 (Приложение 1): S116–S121. 1997. PubMed/NCBI Просмотр статьи: Google Scholar

    29

    Смит Дж. П., Наделла С. и Осборн Н.: Гастрин и рак желудка.Селл Мол Гастроэнтерол Гепатол. 4: 75–83. 2017. PubMed/NCBI Просмотр статьи: Google Scholar

    30

    Шуберт М.Л.: Функциональная анатомия и физиология желудочной секреции. Курр Опин Гастроэнтерол. 31: 479–485. 2015. PubMed/NCBI Просмотр статьи: Google Scholar

    31

    Такеучи К. и Амагасе К.: Роли рецепторы циклооксигеназы, простагландина E2 и EP в слизистой оболочке защита и заживление язв в желудочно-кишечном тракте.Карр Фарм Дез. 24:2002–2011. 2018. PubMed/NCBI Просмотр статьи: Google Scholar

    32

    Nusse R и Clevers H: Wnt/β-катенин сигнализация, болезнь и новые терапевтические методы. Клетка. 169:985–999. 2017. PubMed/NCBI Просмотр статьи: Google Scholar

    33

    Steinhart Z и Angers S: сигнализация Wnt в развития и тканевого гомеостаза.

    Leave a Reply

    Добавить комментарий

    Ваш адрес email не будет опубликован.

    2022 © Все права защищены.