Лечебные свойства корочек граната: Гранатовая кожура: полезные свойства, применение, отвар

Содержание

Гранатовая кожура: полезные свойства, применение, отвар

Польза граната для улучшения состава крови, повышения иммунитета известна всем. Но многие, не задумываясь, выбрасывают гранатовую кожуру, не подозревая о ее полезных свойствах.

Хотя о пользе кожуры граната было известно со времен Гиппократа. Толченой коркой засыпали ожоговые и гнойные раны, настоем поили при желудочно-кишечных заболеваниях.

Химический состав

Изучением химического состава гранатовой шкурки занимаются ученые разных стран. Исследования китайских ученых утверждают, что кожура граната по содержанию антиоксидантов обогнала гранатовые зерна в два раза.

Содержащиеся в ней вещества можно разделить на основные группы:

  • дубильные вещества;
  • минералы и микроэлементы;
  • антиоксиданты;
  • кислоты.

Танины и катехины, относящиеся к дубильным веществам, составляют около 30 процентов полезных веществ шкурок. Именно они вызывают вяжущее действие и терпкий вкус.

Все минералы и микроэлементы даже трудно перечислить. Но с уверенностью можно сказать, что в корках граната присутствуют все основные элементы, необходимые человеческому организму.

Необходимо упомянуть железо, калий и кальций, марганец и цинк, медь и селен, магний и кобальт.

Полифенолы, флавоноиды, принадлежащие к антиоксидантам, защищают организм, очищая сосуды от холестерина низкой плотности. Поэтому употребление настоя из гранатовых корок благотворно влияет на работу сердца.

В наибольшем количестве в шкурках представлена урсоловая кислота. В состав корок входят также лейцин, лизин, треонин, витамины E, группа B.

Кожура содержит витамины и минералы, дубильные вещества и антиоксиданты

Польза шкурок

Основным полезным свойством корок граната является вяжущее средство, используемое при диарее, отравлениях и болезнях ЖКТ. При этом полезная микрофлора кишечника не страдает.

Одновременно антиоксиданты, присутствующие в кожуре, выводят вредные вещества из организма. Очищающее действие оказывает лекарство из гранатовой шкурки и на печень.

Антимикробное, противовоспалительное действие используется при заболеваниях полости рта, воспалении горла.

Народная медицина применяет отвар гранатовых корок для избавления от глистов, но официальная медицина не подтверждает эффективность средства.

Многих женщин заинтересует, что кожура оказывает косметологическое действие:

  • увлажняющее действие на кожу;
  • защита кожи от ультрафиолета;
  • предотвращение старения кожи;
  • предотвращение выпадения волос и образования перхоти.

Маска из кожуры граната:

Противопоказания

Основанием отказа от лечения гранатовой кожурой служат такие заболевания:

  • аллергия на составляющие;
  • запоры;
  • гепатит;
  • геморрой.

При лечении настоями или отварами кожуры нельзя принимать антигистаминные препараты, алкоголь. Наличие в корках алкалоидов требует тщательного соблюдения дозировки, чтобы не допустить отравления.

Полезные и лечебные свойства

Свойства кожуры используются для лечения заболеваний желудочно-кишечного тракта:

  • диареи;
  • дисбактериоза;
  • колитов;
  • язвы желудка и двенадцатиперстной кишки.

Настой корок граната оказывает положительный эффект при лечении аритмии сердца, заболевании печени. Он используется для повышения гемоглобина, очистки сосудов от холестерина.

Новейшие исследования американских ученых доказали противораковые свойства антиоксидантов, присутствующих в кожуре. Важную роль они играют для профилактики рака кожи.

Порошок из сухих корок издавна используется для лечения ран, в том числе гнойных, ожогов, трофических язв.

Средства из кожуры применяют для лечения заболеваний ЖКТ, окологии, ожогов и т. д.

Применение при беременности

При беременности нежелателен прием лекарственных препаратов, поэтому отвар из кожуры граната поможет в борьбе с заболеваниями горла и ротовой полости. При расстройстве кишечника отвар избавит от поноса и болевых ощущений.

Для приготовления отвара потребуется 20 грамм сухой кожуры и полтора стакана кипятка. Корку мелко измельчают и заливают стаканом кипятка.

На маленьком огне отвар кипятят полчаса. Процеженный отвар доливают кипятком до одного стакана. Принимают по две чайные ложки несколько раз в день, но не более пяти.

Рецепты с гранатовой кожурой: отвары, настои, порошок

Кожура граната используется в виде настоя, отвара или порошка.

При кишечных расстройствах отвар готовят из одной столовой ложки сухих шкурок, отваренных на маленьком огне в полулитре кипятка в течение десяти минут. Отвар заливают в термос и настаивают два часа. Принимают перед едой три раза в день по 50 мл.

Для детей до семи лет дозировку уменьшают до одной чайной ложки. Грудным детям лекарство дают три раза в день, а старшим детям — 4-5 раз. Подросткам можно давать по столовой ложке три раза в день.

Для полосканий горла 20 грамм корок кипятят пять минут в стакане воды, затем настаивают в термосе около часа. Количество полосканий — пять раз в сутки на протяжении недели.

Чай из заваренных гранатовых корок помогает при кашле, особенно хроническом. Заваривать можно как сухие, так и свежие корки.

Из кожуры граната готовят отвар, настой и порошок из сушеных корок

Чай получается бледного цвета, советуем подсластить его медом, ароматизировать мятой, лимоном. В течение дня выпивают стакан чая небольшими порциями.

Для борьбы с глистами народные целители рекомендуют следующий рецепт: необходимо взять 50 грамм корочек и залить пол-литра холодной воды, настоять шесть часов.

Кипятят на слабом огне до тех пор, пока количество жидкости не уменьшится вдвое.

Отвар процеживают и выпивают на голодный желудок в течение часа небольшими порциями. Спустя полчаса необходимо принять слабительное.

Сухие корки измельчают в кофемолке или в ступке: ими присыпают раны, ожоги.

Порошок из корок принимают внутрь при маточных кровотечениях, обильных месячных по чайной ложке с водой два раза в день.

Заготовленные впрок сухие корочки граната, предварительно очищенные от белой внутренней кожуры, станут полезным дополнением в домашней аптечке.

Отвар из них придет на выручку при внезапном расстройстве, ожогах и ранах, если нет возможности купить лекарственные препараты или они противопоказаны.

Чтобы не допустить отравления алкалоидами, необходимо соблюдать дозировку при приготовлении и применении отвара.

Корочки граната: чем они полезны и как их употреблять

• Кора. Отваром из сушеной гранатовой коры (2 ч. ложки молотого порошка на 1 стакан кипятка) полезно полоскать полость рта – так десны будут крепче, а дыхание свежее.

• Кожура. При сильном кашле заливаем 1 ст. ложку сушеной гранатовой кожуры 1 стаканом кипятка, настаиваем до порозовения воды и медленно выпиваем в теплом виде. А для жирной кожи лица и при угрях делаем маску: поджариваем сухую молотую кожуру на оливковом масле и наносим теплую смесь на кожу.

• Плоды. Самая большая польза – в косточках. Они богаты омолаживающими веществами, стимулируют работу гормональной системы, идут на пользу как женскому, так и мужскому здоровью. Гранат может гармонизировать давление, успокоить головную боль, хорошо укрепляет стенки сосудов и сердечную мышцу, повышает уровень гемоглобина.

• Светлая прослойка. Интересно, но внутренние пленки-перемычки граната можно жевать свежими или заваривать вместо чая. Они очень полезны женщинам при раздражительности в особые дни, при бессоннице, при моральной истощенности и апатии.

• Сок. Поедание граната целиком может быть противопоказано при заболеваниях ЖКТ, запорах, геморрое и пр. Но это не исключает употребление полезного гранатового сока, главное – разбавить его водой. Сок граната насытит кровь полезными веществами, поможет организму побороть и оправиться после вирусных инфекций, обладает желчегонным и мочегонным эффектами. Свежевыжатым соком можно полоскать горло при ангине.

• Мужчины в Турции и Греции считают гранатовый сок самым сильным любовным эликсиром.

• Гранатов без косточек не бывает, просто в некоторых сортах они очень тонкие и почти прозрачные.

Вам понравилась статья? Желаете узнать больше?

Если да, то рекомендуем приобрести подписку на журнал «Всему свету по совету» в один клик на нашем сайте.


Чем полезна гранатовая кожура и как приготовить из неё вкусный чай | Энергия еды

Гранаты всегда были известны как богатый источник витаминов и питательных веществ, которые приносят пользу телу и разуму. Зачастую мы потребляем только сочные гранатовые зерна и выбрасываем кожуру. Но исследователями было обнаружено, что в корке гораздо больше мощных антиоксидантов, чем в мякоти.

Поэтому, прежде чем выбрасывать то, что может быть лучшей частью граната, ознакомьтесь с ключевыми преимуществами его кожуры.

Чем полезна кожура граната?

Она помогает не только укрепить здоровье, но и улучшить состояние волос и кожи, вот некоторые полезные свойства кожуры граната.

Это эффективное средство для лечения сердечно-сосудистых заболеваний

Кожура граната содержит в 2 раза больше антиоксидантов, чем зерна и поэтому способна эффективно понижать уровень «вредного» холестерина ЛПНП в организме.

Тем самым она вносит значительный вклад в профилактику сердечно-сосудистых и других заболеваний.

Это мощное детоксицирующее средство

Всем известно, что антиоксидантные вещества в организме обладают противогрибковыми свойствами.

Поэтому кожура граната – инструмент, который способен детоксифицировать организм.

Богатый источник витамина С

Нам часто приходится покупать витамины в аптеке, чтобы поддержать здоровье. В гранатовой кожуре очень много натурального витамина С, который повышает иммунитет, заживляет раны, улучшает цвет лица.

Также он является важным фактором в восстановлении и поддержании хряща, костей и зубов.

Способствует здоровью ротовой полости

Гранатовая кожура часто используется в зубных пастах. Она помогает бороться с неприятным запахом изо рта.

Полезна при кашле и болях в горле

Согласно традиционным медицинским практикам, кожура граната помогает облегчить кашель и способствует быстрому излечению от инфекции горла.

Как заготовить кожуру граната

  • Возьмите 2-3 граната.
  • Удалите семена и отделите кожуру.
  • Разрежьте кожуру на половинки или четверти.
  • Если вы планируете использовать кожуру для терапевтических целей, используйте нож, чтобы удалить желтый слой кожицы под красной кожей.
  • Высушите кожуру в духовке пи самой низкой температуре, пока вся влажность не исчезнет.
  • Следующий шаг – бросьте всю кожуру в кухонный комбайн и размалывайте ее до мелкого порошка. Для заваривания чая можно их не измельчать.
  • Храните его в герметичном контейнере и используйте, когда требуется.

Как сделать домашний чай из гранатовой кожуры

Ингредиенты:

Одна часть сушеных гранатовых корок на двадцать частей воды (от 10 до 12 граммов кожуры на стакан воды).

Инструкция по приготовлению:

  • Поместите высушенные гранатовые корки в пустой стакан.
  • Залейте кипящей водой.
  • Накройте стакан крышкой и дайте ему постоять в течение 25 минут.
  • Наслаждайтесь!

Итак, в следующий раз, когда будете есть гранат, вы уже будете знать, что можно не выбрасывать кожуру. Все, что дает нам природа, имеет полезные свойства. Нам просто нужно уметь воспользоваться этим.

Лечебные свойства кожуры граната

Гранаты в наше время – недешевое удовольствие. Даже сейчас, в сезон, цена этого царского фрукта изрядно «кусается». И это первая причина, почему так важно не только съедать сочные зерна, но и сохранять шкурки.

Читают на dacha6.ru:

Вкус у кожуры довольно терпкий, с выраженным горьковатым привкусом. Но, как не странно, в ней содержится примерно вдвое больше полезных для человека веществ, чем в зернах и свежевыжатом соке. Среди них особо следует выделить: витамины B, C, PP, каротин, калий, кальций, фосфор, железо, йод. Лицам, страдающим от анемии, дефицита железа или йода рекомендуется употреблять гранаты на постоянной основе.

Помимо витаминов в гранатовых корках содержится большое количество активных веществ: алкалоиды, антиоксиданты, дубильные вещества, полифенолы, различные натуральные кислоты. Их сочетания позволяют улучшать состояние при таких заболеваниях, как: воспаление кишечника или мочеполовой системы, диарее, язве желудка, пародонтозе, плохой свертываемости крови.

Наибольшую пользу способен принести настой. Для его приготовления 2 ч. л. перетертых в порошок высушенных гранатовых корок следует залить стаканом крутого кипятка. Состав должен настаиваться под накрытой крышкой на протяжении 1 часа.

В зависимости от вида недуга прием настоя различается:

  • При диарее, кишечных инфекциях и глистных инвазиях принимают по полстакана гранатового настоя утром натощак. Оставшуюся половину выпивают через 3 часа для закрепления результата.
  • При анемии, проблемах с сердцем, язве желудка и двенадцатиперстной кишки настой принимают 5 раз в день небольшими порциями (по 50 мл) на протяжении 3 дней.
  • Для лечения небольших ран, порезов и язв на коже местно следует наложить компресс из отвара. В день процедуру выполняют 2-3 раза по 20-30 минут. Если кровотечение достаточно сильное, то компресс следует держать до полного закрытия раны.

Польза гранатовых корок значительна, но есть у них и противопоказания. Их нельзя принимать аллергикам, лицам, страдающим от заболеваний печени и почек. При лечении детей, беременных женщин и кормящих матерей концентрацию настоя значительно понижают.

Превышение дозировки может привести к отравлению. Все дело в повышенном содержании алкалоидов, которые в больших количествах вызывают токсический эффект.

 © Илья Владимирович | 

полезные свойства, рецепты в народной медицине, калорийность

Гранат на Востоке называют королем фруктов не только за вид плодоножки в форме короны, но и за его полезные и лечебные свойства. Ученые ботаники классифицируют гранат как ягоду. В его плотной кожуре  находится от 400 до 900 сочных кисло-сладких семян красного цвета с косточками диаметром от 9 до 18 сантиметров, употребляемых в пищу человеком.

Калорийность граната и его пищевая ценность

Гранат питает организм человека многими полезными веществами и микроэлементами, обладая низкой калорийностью. В 100 граммах плода содержится около 72 калорий, а в 100 граммах свежевыжатого гранатового сока – всего 64 калории. Если один плод весит приблизительно 200 грамм, то съев его целиком, человек получит всего 144 калории, что полезно людям с лишним весом.

Гранат является низкокалорийной ягодой

Несмотря на малую калорийность, гранат отличается значительной пищевой ценностью. В 100 граммах зерен граната содержится: 14-15 грамм углеводов, по 0,6-0,7 грамм белков и жиров. Плод граната обладает уникальным набором из 15 аминокислот, из которых 7 содержатся только в мясе, поэтому гранат полезно принимать в пищу вегетарианцам.

Благоприятно воздействуют на человека витамины, содержащиеся в гранате:

  • витамин А – природный антиоксидант; улучшает зрение, здоровье кожи и волос, влияет на состояние костей;
  • витамины группы В участвуют во всех обменных процессах организма и снимают синдром хронической усталости;
  • витамин Е благотворно воздействует на зрение и курирует все восстановительные процессы в организме человека;
  • витамин С усиливает иммунитет;
  • витаминная группа РР укрепляет сердечную мышцу и стенки сосудов, блокирует образование холестериновых бляшек.

Гранат  является и кладезем микроэлементов. В его составе содержится:

  • фосфор;
  • калий, магний и натрий;
  • железо и йод;
  • кальций.

В плоде граната присутствует уникальное вещество — пуникалаген, являющийся мощным антиоксидантом и содержится комплекс дубильных веществ.

Противопоказания и вред граната

При большом количестве полезных свойств граната, имеется ряд противопоказаний его применения, которые следует учитывать, чтобы не навредить здоровью.

  • Заболевания желудочно-кишечного тракта. В гранате содержится яблочная, щавелевая и лимонная кислота. Людям, имеющим гастриты с повышенной кислотностью, и язвенную болезнь, гранат и его сок могут раздражать стенки желудка и кишечника.
  • Изжога. Чрезмерное употребление граната увеличивает выделение желчного сока в желудок. В случае повышенной кислотности из-за этого может возникнуть жжение в пищеводе или желудке. Чтобы избежать изжоги, рекомендуется перед употреблением граната выпить стакан чистой воды. Это уменьшит концентрацию желудочного сока.
Гранат противопоказан для людей страдающими заболеваниями ЖКТ
  • Аллергические реакции. Гранат для некоторых людей является сильным аллергеном. Даже, если аллергии не наблюдалось ранее, она может быть вызвана большим употреблением гранатов. Чтобы избежать аллергических реакций следует употреблять не более 2 плодов в день.
  • Запоры. При слабой перистальтике кишечника у человека могут возникать запоры, которые усугубятся при употреблении гранатов и его сока из-за наличия в них большого количества дубильных веществ.
  • Геморрой и трещины в заднем проходе. Излишнее употребление граната и сока из него может вызвать необратимые проблемы и болевые ощущения при освобождении кишечника.
  • Сахарный диабет. Это заболевание исключает прием в пищу сладких сортов граната. В этом случае можно употреблять наполовину разбавленный сок из кислых сортов этого плода без добавления сахара.
  • Пониженное артериальное давление. Гранат способствует снижению артериального давления. Людям с диагнозом — гипотония следует ограничить себя в употреблении его плодов и гранатового сока.
  • Состояние зубной эмали. При слабой зубной эмали, кислоты, содержащиеся в гранате, ускоряют ее разрушение.

Чтобы не допустить разрушение эмали зубов надо, после  того как покушали гранат, прополоскать рот водой или зубным ополаскивателем. Гранатовый сок безопасно пить через коктейльную трубочку.

Полезные свойства граната и его применение в народной медицине

Наукой и вековой практикой народной медицины доказано, что правильное употребление граната благоприятно воздействует на большинство людей.

Мякоть

Мякоть зерен граната способна улучшить самочувствие при недугах и даже препятствовать их появлению.

  • При заболеваниях сердечнососудистой системы гранат способствует укреплению сердечной мышцы, стенок сосудов и нормализует артериальное давление при гипертонии.
  • Людям с нездоровыми почками и желчным пузырем полезно иметь в рационе сладкие плоды граната. Это действенное природное мочегонное и желчегонное средство. Оно не вымывает из организма калий, в отличие от медицинских препаратов.
  • Гранат полезен при истощении организма и анемии. Он повышает уровень гемоглобина в крови.
Мякоть граната помогает выводить радиоактивность из организма
  • По исследованиям ученых, постоянное употребление мякоти граната препятствует возникновению онкологических болезней и выводит радиацию из организма.
  • Эстрогены, что содержатся в гранате, нормализуют гормональный баланс у женщин во время климакса, уменьшают менструальные боли и способствуют избавлению от головной боли.
  • Употребление граната мужчинами способствует улучшению потенции, и, ускоряя циркуляцию крови, благотворно влияет на эрекцию.

Косточки

Некоторые люди игнорируют гранат из-за большого количества косточек в плоде и не подозревают, что они являются эффективным общеукрепляющим и лечебным средством.

  • Перемолов косточки граната можно сделать натуральное лекарство от головной боли и для снижения артериального давления.
  • Измельчив косточки и соединив их с медом, получите болеутоляющее средство при сильных зубных болях. Его следует прикладывать на десну в виде аппликаций.
Гранатовые косточки полезны при снижении уровня гемоглобина в крови, гипертонии, нарушениях сна, депрессивных состояниях, кожных заболеваниях
  • Несколько съеденных за день косточек граната — хорошее средство для улучшения перистальтики кишечника и его очищения.
  • Косточки граната помогают привести в норму гормональный фон, поэтому его сочные зерна следует кушать зернышками.
  • Употребление перемолотых косточек граната повышает уровень гемоглобина в крови.
  • Соком, изготовленным из косточек граната, лечат заболевания почек и печени.

Кожура

Съев гранат, не стоит выбрасывать его кожуру. Засушив и измельчив ее, вы получите лекарство от возникших проблем со здоровьем.

Полезных веществ в корочках граната вдвое больше, чем в соке и зернах
  • В кожуре граната содержатся алкалоиды, позволяющие выводить глистов из организма.
  • Благодаря содержанию танина, порошок из корок граната имеет сильно вяжущие свойства и способен вылечивать энтероколит и диарею.
  • Порошок из кожуры хорошо зарекомендовал себя как присыпка при царапинах и трещинах на коже.
  • Полоскание, изготовленное из кожуры, вылечивает стоматит и кровоточивость десен.
  • Отвары кожуры граната хорошо помогают при простуде и полосканиях при ангине.
  • Ополаскивание волос отваром кожуры граната активизируют их рост, придают им здоровый вид и блеск.

Перегородки

Съев гранат, засушите перегородки, находившиеся между зернышками. Так получится лекарство, которое можно применять для успокоения нервной системы в виде чая, заваренного из перегородок. Оно поможет снять нервное напряжение и успокоиться  при стрессах, тревожном состоянии и различных волнениях. Отвар из перегородок также эффективен при возникновении диареи.

Сок

Широкое применение нашел гранатовый сок в народной медицине.

  • Больным вирусными респираторными заболеваниями и ангиной, сок из граната понижает температуру, облегчает кашель и способствует выработке защитных функций организма.
  • При ожогах гранатовый сок разбавленный водой, снижает боль и раздражение обожженного участка кожи.
  • Людям, соблюдающим диету, разведенный пополам с водой сок граната, улучшит обмен веществ и активизирует пищеварение.
  • В гранатовом соке содержится антиоксидантов больше чем в зеленом чае. Его необходимо употреблять людям, чья робота подвержена повышенному уровню радиации.
  • Маски с гранатовым соком, составленные в равной пропорции со сметаной позволяют удалить с лица угревую сыпь, пигментацию и веснушки.
Сок граната очень полезен гипертоникам и людям, страдающим от отеков, поскольку обладает мочегонным эффектом и способностью понижать артериальное давление

Полезные свойства сохраняются в свежевыжатом соке граната. Его не трудно приготовить самостоятельно. Для этого надо выполнить ряд последовательных действий:

  1. Разделить плод на две равные части.
  2. Наполнить емкость водой и опустить в нее половинку плода с вынутыми из нее косточками.
  3. Когда зернышки упадут на дно, а перегородки всплывут, надо собрать их с поверхности воды.
  4. Слить воду, а зернышки пропустить через соковыжималку.

Пейте сок, разбавив чистой водой в равных долях.

применение и противопоказания, чем полезны, отзывы

Применение гранатовых корок и противопоказания — интересный вопрос с точки зрения народной медицины. Из кожуры гранатовых плодов можно приготовить немало полезных для здоровья средств, но перед этим нужно изучить правила и способы применения.

Можно ли пить гранатовые корки

Корки граната вовсе не обязательно выбрасывать, они также годятся для употребления вовнутрь. Из правильно высушенной кожуры можно приготовить множество напитков, снимающих симптомы хронических и острых заболеваний. При употреблении корок необходимо соблюдать некоторые правила, и разрешено такое лечебное средство не всем. Но для большинства людей применение продукта будет оправданным и очень полезным.

Состав гранатовых корок

Ценность гранатовым корочкам придает химический состав, в котором присутствуют:

  • витамины В1, В2, В5, В6 и В9;
  • витамины А и Е;
  • аскорбиновая кислота и ниацин;
  • калий, магний и фосфор;
  • железо, кальций и натрий;
  • жирные кислоты насыщенного типа;
  • дисахариды и моносахариды;
  • зола и клетчатка;
  • органические кислоты;
  • бета-каротин.

В основном состав корок представлен углеводами, их в продукте присутствует около 14 г. Еще 0,7 г приходится на долю белков, и 0,6 г занимают жиры. Калорийность продукта равна 72 ккал на 100 г, однако фактическая питательность корок намного ниже, употребляют их в минимальных количествах.

Чем полезна кожура граната

Полезные свойства корок граната в народной медицине заключаются в том, что продукт:

  • способствует снижению плохого холестерина, укрепляет сосуды и способствует очищению печени;
  • выводит из тканей лишние жидкости, токсичные вещества и шлаки;
  • укрепляет сердце и защищает его от развития тяжелых недугов;
  • повышает иммунную сопротивляемость и защищает организм от простудных заболеваний и инфекций;
  • нормализует работу пищеварения и помогает при большинстве желудочных и кишечных расстройств;
  • замедляет воспалительные процессы в организме и устраняет бактерии;
  • благотворно воздействует на нервную систему, улучшает тонус и поднимает настроение.

Принимать корки полезно для разжижения крови и профилактики тромбоза. Благодаря наличию антиоксидантов в своем составе кожура служит хорошим противораковым профилактическим средством.

Чем полезны корки граната для женщин

Корки граната обладают особенной пользой для женского организма. Прежде всего, рекомендовано применение корочек при болезненных и обильных месячных. Корки облегчают боль и восстанавливают баланс полезных веществ в организме, снижают объемы выделений. Принесет кожура пользу и в период климакса, на фоне ее применения неприятные симптомы сократятся, а эмоциональный фон станет ровнее.

Высоко ценятся диетические свойства гранатовой кожуры. Применение настоев и отваров на ее основе приносит пользу во время похудения, корки помогают вывести шлаки и очистить кишечник, что способствует снижению веса.

Чем полезны гранатовые корки для мужчин

Применение сырья рекомендовано и мужчинам. Прежде всего, продукт помогает предотвратить развитие инфарктов и инсультов, снижает риск появления атеросклероза и защищает от разрушения печень. Все это крайне полезно для мужчин, особенно подверженных заболеваниям сердца и сосудов после 35 лет.

Также гранатовые корки улучшают состояние репродуктивной системы. С их помощью можно быстрее справиться с воспалениями половой сферы, также применение кожуры граната помогает вернуть потенцию и здоровое либидо.

Чем полезны корки граната для детей

Особенная ценность гранатовой кожуры состоит в том, что отвары и напитки на ее основе разрешены даже для младенцев. Уже после 1 года жизни ребенку можно предлагать домашние лекарственные средства, они помогут укрепить иммунитет и устранят диарею. Детям часто дают гранатовую кожуру от глистов.

Но при этом дозировка для ребенка должна быть очень небольшой, всего по 5 мл отвара не чаще, чем трижды в день. После 5 лет дозировку можно постепенно увеличивать.

Внимание! Корки граната нередко вызывают аллергию и обладают другими противопоказаниями, поэтому предлагать их детям можно только после консультации с врачом.

Как сушить гранатовые корки

Для приготовления отваров и настоев применяются сушеные корки, долго сохраняющие полезные свойства. Но для того, чтобы в сырье остался максимум витаминов и микроэлементов, сушить его необходимо правильно.

  • Для сушки и лекарственного применения лучше всего подходят гранаты, появляющиеся на прилавках магазинов осенью, именно в это время начинается основной сезон, и гранаты могут похвастаться максимальной сочностью и спелостью.
  • Плоды лучше выбирать среднего размера, увесистые, с плотной гладкой кожицей без вмятин и трещин, с равномерным окрасом без пятен.
  • Гранат необходимо как следует вымыть, просушить, а потом снять кожуру с целого плода или с нарезанных долек. Кожуру нужно аккуратно отделить от околоплодника при помощи ножа.

После этого шкурки аккуратно раскладывают на салфетке равномерным слоем и прикрывают тонкой марлей. Сушить корки нужно в сухом, теплом и хорошо проветриваемом месте на протяжении 7-10 дней. Ежедневно шкурки следует осматривать на предмет появления влаги, ее быть не должно, поскольку тогда корки начнут гнить.

Совет! Также высушить сырье можно в специальной сушилке для фруктов и овощей, выставив температуру около 40 °С.

Что можно сделать с кожурой граната

Полезные свойства гранатовых корок и рецепты на их основе подходят для терапии многих недугов. Обычно из сырья готовят целебные напитки, также кожуру можно измельчать до состояния порошка. В таком случае сухое сырье подойдет для приготовления домашних мазей.

Отвар из гранатовых корок

Самое распространенное и простое средство на основе корок — это лекарственный отвар. Для его приготовления нужно взять 3 большие ложки мелко порубленных корок, залить их 500 мл воды, прокипятить четверть часа и остудить. Средство настаивают около получаса, потом процеживают и пьют по рецептам — применение отвара хорошо помогает при желудочных и воспалительных недугах.

Настой из гранатовых корок

Еще одно эффективное средство — это настой на целебном сырье. Для его приготовления маленькую ложечку измельченных корок нужно залить стаканом кипятка и настоять пару часов. Процеженное средство пьют согласно рецептам, обычно в количестве половины стакана. Настой хорошо помогает при расстройстве желудка и других недугах.

Ингаляция гранатовыми корками

Способы лечения полезными свойствами кожуры граната не ограничиваются применением напитков. Сырье применяют не только вовнутрь, но и для ингаляций. Около 3 больших ложек измельченного сырья нужно отварить в небольшой кастрюле на протяжении 20 минут, а потом наклониться над емкостью, накрыть голову полотенцем и несколько минут подышать горячим паром.

Процедура принесет пользу, если подходить к ней с осторожностью. Пар не должен обжигать носоглотку, а вдохи нужно делать медленные и неглубокие.

Ароматный чай

На основе гранатовых корок можно приготовить полезный и очень вкусный ароматный чай. Делают его так:

  • крупнолистовой чай смешивают с имбирем и мятой;
  • добавляют к сбору 1 маленькую ложечку гранатовых корок;
  • заливают смесь кипятком и отваривают всего минуту, а потом процеживают.

В готовый напиток по желанию можно добавить мед, а можно выпить его без подсластителей. Применение чая хорошо укрепляет пищеварительную систему, помогает поднять иммунитет и оказывает профилактическое действие, защищая организм от простудных заболеваний.

Порошок

Корки тропического фрукта можно использовать в виде порошка — сухое сырье нужно тщательно растолочь ступкой, измельчить в кофемолке или мясорубке. Применение полезного порошка очень обширно, его можно использовать вместо целых корок для приготовления настоев и отваров.

Также порошок хорошо подходит для создания целебных домашних мазей. Его просто разводят водой до состояния кашицы и наносят на больные места или поврежденные участки кожи.

От чего помогают корки граната

Лечение гранатовыми корками используют при множестве заболеваний. Витамины и минералы в составе корок помогают устранить симптомы острых и хронических недугов, если следовать проверенным рецептам, результат проявится очень быстро.

Гранатовые корки от язвы желудка

Применение настоя на корках оправдано при язвенной болезни желудка — средство оказывает хорошее заживляющее и противовоспалительное действие. Готовят напиток так:

  • 10 г корок заливают стаканом горячей, но не кипящей воды;
  • настаивают на протяжении получаса;
  • фильтруют настой через сложенную марлю.

Остывший напиток употребляют до 5 раз в день по 40 мл натощак. Пить средство нужно не менее недели, суточная дозировка должна составлять около стакана.

Гранатовые корки от гастрита

При хроническом гастрите полезно на постоянной основе употреблять гранатовый чай. Для его приготовления в обычную чайную заварку добавляют пару листочков мяты, щепотку сушеного имбиря и несколько корок граната, а потом заливают кипятком и настаивают полчаса.

Пьют такое средство, как обычный чай, по 1-2 чашки в день. Гранатовая кожура оказывает благотворное воздействие на желудок и помогает избавиться от неприятных симптомов.

Корки граната от кишечной инфекции

При кишечных инфекциях применение корок также приносит пользу. Необходимо:

  • половину стакана сухого сырья залить стаканом горячей воды;
  • настоять на протяжении получаса;
  • остудить настой и всыпать в него 10 г тминовых семечек;
  • залить смесь 100 мл кефира;
  • взбить все компоненты в блендере.

В готовое средство добавляют еще щепотку соли и пьют напиток трижды в день по 50 мл. Продолжать лечение нужно неделю.

Корки граната от глистов

Корочки граната — одно из самых эффективных натуральных глистогонных. Можно воспользоваться рецептом корок граната от паразитов:

  • 50 г порошка из корок залить 400 мл горячей воды;
  • настоять около 6 часов;
  • прокипятить на малом огне, пока половина воды не испарится;
  • остудить и профильтровать.

Пьют средство натощак в объеме половины стакана. Через пару часов после применения употребляют слабительное или делают очистительную клизму, благодаря чему паразиты выходят из кишечника.

Гранатовые корки от кашля

Корочки хорошо разжижают мокроту и помогают откашляться, поэтому их полезно употреблять при простуде и бронхите. Готовят средство так:

  • большую ложку измельченных корок заливают стаканом кипятка;
  • настаивают полчаса;
  • фильтруют.

Принимать напиток нужно в теплом виде по 1 стакану раз в день. Для усиления полезного эффекта от применения можно добавить в настой ложечку натурального меда.

Гранатовые корки от колита

При кишечном колите применение гранатовых корок помогает успокоить боль и снять воспалительные процессы. Хороший эффект приносит такое средство:

  • в прогретую стеклянную посуду засыпают около 20 штук сухих корочек;
  • сырье заливают 200 мл кипящей воды;
  • емкость накрывают крышкой и дают напитку настояться полчаса.

Пить средство нужно четырежды в день всего по 25 мл натощак, продолжать лечение нужно неделю через день. По окончании курса нужно сделать перерыв еще на неделю, а затем, если эффект достигнут не полностью, повторить лечение.

Гранатовые корки при кандидозе

Продукт обладает хорошим противогрибковым действием, его применение полезно при кандидозе. Необходимо приготовить из корок классический отвар, а затем остудить его и провести подмывание.

Уже после первой процедуры зуд при молочнице заметно утихнет. А если использовать средство на постоянной основе, то постепенно уйдут нездоровые выделения.

Корки граната при отравлении

При пищевом отравлении гранатовые корочки не только остановят тошноту и понос, но и помогут вывести из организма токсичные вещества. Будет очень полезным применение целебного настоя, несколько сухих шкурок нужно залить 200 мл кипятка и оставить настаиваться до тех пор, пока вода не приобретет насыщенный бордовый оттенок.

Не фильтруя, настой выпивают за 1 раз в объеме стакана. Через несколько часов средство можно приготовить заново, на тех же самых корках.

Гранатовые корки от ангины

Противовоспалительные свойства продукта делают его ценным средством при ангине. Около 20 г высушенных корочек нужно залить стаканом воды и прокипятить 5 минут, а потом настоять в термосе на протяжении часа и процедить.

Полученным отваром полощут горло до 5 раз в день, а всего применение средства нужно продолжать неделю.

Гранатовые корки от дисбактериоза

При дисбактериозе кишечника применение корок принесет пользу, если приготовить такое средство:

  • 2 маленькие ложечки сухих корочек залить стаканом кипятка;
  • полчаса подержать средство на водяной бане;
  • процедить настой.

Готовое средство употребляют дважды в день по 50 мл натощак в неразбавленном виде. Применение настоя нужно продолжать в течение недели, пока микрофлора кишечника не восстановится.

Гранатовые корки от геморроя

Поскольку шкурки граната укрепляют сосуды и разжижают кровь, их применение полезно при склонности к геморрою. Маленькую ложку измельченного сырья нужно развести всего 1 большой ложкой воды и принимать такую смесь утром натощак и незадолго до сна.

Всего лечение продолжают 5 дней, при необходимости курс можно повторить после перерыва.

Гранатовые корки в гинекологии

Высушенные корочки граната находят свое применение в гинекологии. С их помощью лечат кандидоз и цистит, пользу отвары и настои на основе корочек приносят при менопаузе и болезненных месячных, самочувствие женщины заметно улучшается.

Корки граната помогают даже в лечении бесплодия. Если употреблять настои и отвары из корочек граната на постоянной основе, напитки помогут отрегулировать гормональный фон и тем самым повысят вероятность зачатия.

Употреблять корочки можно внутрь в составе отваров, также практикуют применение своеобразных ингаляций для репродуктивных органов. Ежедневно на протяжении месяца по 10-15 минут нужно сидеть над горячим отваром, от которого поднимается целебный пар.

Гранатовые корки от ожогов

Заживляющие свойства корочек находят свое применение при ожогах, кожура граната способствует быстрому восстановлению кожных покровов. Используют средство очень просто — протирают обожженные участки свежим настоем на корках, а потом присыпают больное место порошком из корочек и накладывают повязку.

Гранатовые корочки не только ускоряют заживление, но и снимают боль. Если вовремя начать применение средства, то шрамы от ожогов останутся почти незаметные.

Гранатовые корки при диарее

Корочки граната помогают остановить диарею. Чтобы справиться с поносом, необходимо трижды в день принимать по щепотке порошка, запивая его небольшим количеством воды.

Корки граната в косметологии

Польза и вред гранатовых корок для здоровья находят свое применение в косметологической сфере. Кожура тропического фрукта обладает мощным антивозрастным эффектом — она помогает разгладить морщины и подтянуть контуры лица, улучшить цвет и упругость кожи. Использовать отвары на основе продукта можно в качестве домашнего тоника, средство качественно очистит и напитает кожу витаминами, предотвратит появление прыщей и сделает менее заметными веснушки.

Пользуется популярностью рецепт следующей антивозрастной маски:

  • небольшое количество гранатовых корок перетирают в порошок;
  • затем разводят теплым нежирным молоком до состояния мягкой кашицы;
  • смесь наносят на чистую кожу на 15 минут.

Делать маску нужно хотя бы дважды в неделю — тогда уже через несколько применений появится заметный эффект.

Важно! Благотворное влияние корочки оказывают не только на кожу, но и на волосы, локоны становятся мягче и послушнее, приобретают красивый блеск. Если регулярно ополаскивать волосы отварами и настоями, можно избавиться от перхоти.

Как принимать корки граната

Применение гранатовой кожуры в лечебных целях требует тщательного соблюдения дозировок. Для взрослых максимальный разовый объем настоев и напитков должен составлять не более 1 стакана, а в день средства можно употреблять не чаще 3 раз. Всего лечение гранатовыми корками продолжают обычно не дольше недели, затем следует сделать такой же по продолжительности перерыв.

При лечении детей и подростков дозировки полезных средств необходимо сокращать вдвое. Чувствительному детскому организму корочки могут принести не только пользу, но и вред.

Меры предосторожности

В ходе применения гранатовой кожуры необходимо придерживаться рекомендованных дозировок и проверенных рецептов. Избыточное употребление сухого сырья может вызвать:

  • головокружение и слабость;
  • повышение давления и судороги;
  • временное ухудшение зрения, тошноту и диарею.

При появлении тревожных симптомов необходимо сразу же прекратить применение гранатовой кожуры.

Внимание! Напитки на основе корочек строго запрещено сочетать с употреблением антигистаминных средств или приемом алкоголя — это принесет вред.

Противопоказания к применению гранатовой кожуры

Полезные свойства и противопоказания корок граната не всегда одинаковы, при некоторых состояниях от продукта лучше отказаться. Применение корочек нужно ограничить при:

  • нефрите и гепатите;
  • хронических запорах;
  • трещинах в прямой кишке.

Очень аккуратным применение средства должно быть при геморрое. Абсолютным противопоказанием для применения корок является аллергия на гранат, его кожуру и любые компоненты в составе фрукта.

Сроки и условия хранения

Сушеные корочки могут сохранять свою пользу до 3 лет, но для этого нужно соблюдать правила хранения. Наибольшую опасность для корочек представляет повышенная влажность, поскольку они просто начинают гнить. Сырье необходимо держать в плотно закрытом бумажном пакете в прохладном и сухом месте.

Заключение

Применение гранатовых корок и противопоказания зависят от индивидуального состояния здоровья и от соблюдения проверенных рецептов. Если не допускать передозировки корочками, то их полезные свойства благотворно отразятся на состоянии организма.

Отзывы о полезных свойствах корок граната

Буренкова Тамара Павловна, 42 года, г. Москва

Мне не нравится вкус свежих гранатов, а вот корочки я использую в лечебных целях очень часто. Кожура помогает мне справляться с обострениями гастрита, очень хорошее действие продукт оказывает при простудах. С тех пор, как я начала пить чай с кожурой граната, ОРВИ и грипп стали обходить меня стороной.

Ильина Мария Викторовна, 33 года, г. Самара

Очень люблю корки граната за их лечебные и косметические свойства. Кожура хорошо помогает при ангине и простуде, несколько раз порошком из корочек я лечила ожоги — кожа восстанавливалась очень быстро. Время от времени ополаскиваю отваром на корочках волосы, и они растут густыми и блестящими, а о перхоти я и вовсе давно забыла.

Как можно использовать гранатовые корки

Применение кожуры граната – не такая и большая сложность, если знать общие правила, но в шкурке этого ценного плода содержится много алкалоидов, поэтому при переизбытке продукта можно запросто получить отравление. Впрочем, как известно с древности, даже яды лечат в адекватных дозах, а самые полезные вещества в больших объемах представляют собой смертельную опасность. Разберемся, как использовать гранат правильно и с пользой для себя, не подвергаясь риску.

Зачем нужен гранат?

Не только его шкурка, но и сами зернышки, отжимаемый из них сок имеют множество положительных качеств, позитивно влияющих на здоровье человека. Включение граната в разных формах в повседневный рацион – залог долголетия и здоровой жизни. Плод окажет поддержку при избавлении от широкого спектра недугов – но нужно знать, как использовать кожуру граната, зернышки правильно, с максимальной выгодой для себя.

Что внутри?

Прежде чем разбираться с полезными свойствами корок граната, стоит вникнуть в причину того, почему они так хороши. Обусловлено это химическим составом уникального плода, богатством компонентов, содержащихся как в шкурке, так и во внутренней части. С давних пор человечество знает, что, кроме внутренних вкусных зернышек, пользу приносят и шкурка, и перепонки, и даже листья дерева. Отжимают из граната масло, широко используемое при самых разных проблемах со здоровьем и просто для своего удовольствия.

Полезные свойства корок граната объясняются их ценностью и составом. Всего на сто граммов приходится 14 гр углеводов, 0,7 гр белка и 0,6 гр жиров. В составе присутствуют фруктоза, глюкоза, незаменимые для человеческого организма пищевые волокна и органические кислоты, а также жирные. В кожуре плода много витаминов, микроэлементов. Особенно ценны запасы витаминов А, Е, К и никотиновой кислоты. Богата кожура и витаминными соединениями из группы В, включая фолиевую кислоту в количестве 40 мкг. При правильном использовании в пищу граната из его шкурки можно получить фосфор, калий, йод, цинк и множество других исключительно важных микроэлементов. Врачи отмечают наличие холина, бета-каротина, незаменимых аминокислот.

А в чем польза?

Зная, чем полезна кожура граната, можно всерьез подойти к оформлению меню с участием этого продукта. В настоящее время разработаны методы использования в кулинарии всех частей ягод, и кожура в большей степени пригодны для полезных для здоровья рецептов, нежели для вкусового удовольствия. Обусловлено это следующими качествами:

  • способность бороться с воспалениями, инфекциями;
  • активизация иммунитета, выработка организмом способности противостоять патогенным микроскопическим форма жизни;
  • стимуляция работы почек, за счет чего ткани быстрее очищаются от токсинов;
  • нормализация стула при диарее;
  • инициирование процессов продуцирования желчи.

Список не исчерпан

Чем полезна кожура граната еще? Этот продукт борется с атеросклерозом и помогает ослабить болевой синдром разной природы, немного разжижает кровь и даже позволяет предупредить формирование опухолей, наростов. Правильное использование корок в пище помогает бороться с патогенными колониями микроорганизмов – их рост угнетается, постепенно популяция вымирает.

Гранат имеет выраженный ранозаживляющий эффект, стимулирует регенеративные процессы на клеточном уровне, поэтому после полного заживления не остается следов даже в виде незначительных шрамов. Поможет кожура граната от глистов, иных инвазий и инфицирования, некоторых вирусов. Отвар на основе продукта тонизирует организм в целом, укрепляет защитные силы и активизирует человека. Особенно яркий эффект заметен по иммунной системе. Кроме отвара кожуры, можно употреблять в пищу сок, свежие ягоды.

Кому актуально?

Рекомендовано регулярно пить отвар из кожуры граната в период смены сезонов, когда человек в наибольшей степени страдает от авитаминоза. Если пришлось пережить тяжелое заболевание, продукты из плода помогут восстановить организм. Правильное использование ягод позволяет восполнить запасы важных для нормального функционирования организма микроэлементов.

Рекомендовано употреблять в пищу свежий гранат и настои, отвары из его корок в период восстановления после хирургического вмешательства. Поможет чай из кожуры граната при общем ослаблении. Во многом это связано с высокой концентрацией в продукте витамина С, который оказывает положительное влияние на иммунитет человека. Выражается это в повышении стойкости к простудным заболеваниям. А вот витамины группы В улучшают состояние зрительной, нервной системы, памяти.

На что обратить внимание?

Лечебные свойства кожуры граната во многом объясняются достаточно большим количествам железа, витамина В2 – за их счет активизируется производство в клетках организма гемоглобина, предотвращается анемия. Никотиновая кислота, в свою очередь, нормализует психическое, эмоциональное состояние человека. Рекомендуют использовать отвары, чаи с гранатом в ситуациях сильного стресса, нервных потрясений или депрессионных расстройств. Полезный чай – эффективное средство против нарушений сна, тревожности, нервозности, повышенной раздражительности и даже агрессивности.

Лечебные свойства кожуры граната в некоторой степени объясняются повышенной концентрацией антиоксидантов в продукте, включая витамины А, Е. Если организм получает эти соединения в достаточном количестве, замедляются процессы старения, что сказывается не только на внешнем виде, но и общем состоянии организма. При регулярном употреблении напитков на гранатовых шкурках приходят в норму волосы, ногти, кожа, улучшается зрение, растет общий тонус.

Можно или нет?

Как и любой другой продукт, влияющий на здоровье человека, имеет кожура граната и противопоказания. Лечебные свойства не будут полезными, если злоупотреблять ими в слишком большом объеме. Есть вероятность аллергической реакции – многое зависит от особенностей конкретного организма. В кожуре присутствуют токсичные вещества, которые в повышенной концентрации могут вызвать слабое или даже сильное отравление. Чтобы не столкнуться с таким неприятным эффектом, придется тщательно следовать рекомендациям относительно концентрации корок на литр воды, а также соблюдать установленную частоту приема напитков.

Чтобы не столкнуться с самыми неприятными проявлениями, нужно учитывать не только противопоказания кожуры граната. Лечебные свойства проявляются при использовании продукта с учетом особенностей организма больного: возраста, веса, индивидуальных отличительных качеств. Если, предположим, речь идет о маленьком ребенке, то при нарушениях стула ему следует пять раз ежедневно использовать в пищу чайную ложку отвара, а вот в школьном возрасте – столовую. Дозировку, соответствующую разрешенной во взрослом возрасте, допускают с 12 лет. При несоблюдении таких правил можно столкнуться с ухудшением ситуации: отравлением организма и побочными реакциями.

Специальный случай

Лечебные свойства кожуры граната можно проверять с очень большой осторожностью в период выкашивания плода, выкармливания ребенка. Лучше предварительно посоветоваться с доктором, только после его рекомендаций начинать курс лечения. Если нет возможности проконсультироваться, имеет смысл отказаться от такой программы, чтобы не навредить себе и ребенку.

Не стоит проверять на себе лечебные свойства граната, если есть склонность к запорам, геморрой или беспокоят трещины кишки. Почечные заболевания накладывают запрет на употребление в пищу граната в любой форме. Настои, отвары корок не следует использовать, если есть повышенная вероятность кровотечений, высок шанс аллергической реакции. Народные целители обращают внимание, что в большинстве случаев использование препаратов на базе гранатовых шкурок не провоцирует побочных реакций, но нужно быть аккуратным. Особенно категоричный запрет связан с приемом антигистаминных препаратов: они категорически не сочетаются с отварами, настоями кожуры граната.

Важные особенности

Чтобы шкурка граната была действительно полезной, нужно хранить ее правильно, иначе все полезные вещества просто улетучатся, распадутся, и от напитка на такой основе не будет никакой пользы. При соблюдении правил срок годности заготовленных шкурок – несколько лет. Правила достаточно простые:

  • подходят только плотные плоды с толстой, цельной кожурой без повреждений;
  • перед заготовкой нужно внимательно осмотреть гранат: цвет шкурки должен быть натуральным, ровным;
  • пересушенная или слишком светлая кожура не подходит для отваров, настоев;
  • перед заготовкой шкурку снимают, аккуратно разрезая, убирая внутреннюю прослойку;
  • делят кожуру на небольшие кусочки и неделю просушивают, храня на салфетке под слоем марли;
  • в период сушки регулярно перемешивают корочки для равномерности процесса.

Готовый продукт хранят в бумажном пакете, стеклянной банке. Перед использованием измельчают в порошок ступкой, кофемолкой.

Как пользоваться: проблемы кишечника

Особенно эффективна кожура граната от поноса. Для приготовления рецепта предварительно высушенные корочки измельчают. Количество ингредиентов: на каждые пол-литра воды – столовая ложка порошка. Природный продукт и воду смешивают, 10 минут варят на слабом огне, еще несколько часов настаивают в закрытом термосе. В пищу необходимо использовать трижды ежедневно до еды. Для взрослых рекомендовано употреблять 50-100 мл за раз. Средство не только избавляет от поноса, но и очищает организм от токсинов, нормализует ЖКТ.

Для лечения детей можно воспользоваться другим рецептом. На чашку кипятка берут четверть шкурок небольшого граната, выжидают 40 минут (чашка должна быть плотно накрыта). Если поносом страдает малыш годовалого возраста или младше, в пищу необходимо трижды в сутки давать по чайной ложке полученного настоя. В более старшем возрасте при такой же дозировке увеличивают частоту по пяти раз. Для подростков можно выбрать другую дозировку – трижды ежедневно столовая ложка.

Гранат против кишечных инвазий

Один из самых популярных рецептов на гранатовых шкурках – настой, помогающий победить заражение глистами. Для приготовления необходимо иметь 50 гр порошка, сделанного из предварительного высушенных шкурок, но при отсутствии таковых можно использовать свежие. Порошок заливают 400 мл чистой воды, закрывают крышкой и выжидают четверть суток, после чего кипят весь объем, пока половина жидкости не испарится. Полученному отвару дают остыть, фильтруют и выпивают за час в несколько подходов. Еще через полчаса используют слабительное средство.

Никаких воспалений!

Процесс приготовления лекарства от воспалений – проще некуда: нарезают кожуру одного плода, заливают кипятком и час дают постоять на паровой бане, после чего жидкость сцеживают и пьют по четверть стакана перед едой дважды в сутки. Длительность такого курса – до полного выздоровления. Особенно хорошим будет результат, если воспалительный процесс поразил мочевой пузырь, почки, репродуктивные, дыхательные органы или кишечник.

Если воспаления наблюдаются в полости рта, горле, если болят десны, гранат можно применять по другой схеме: на чашку кипятка берут 20 гр шкурок плода, варят не более пяти минут, еще час выдерживают в термосе и фильтруют. Полученная жидкость подходит для регулярного ополаскивания полости рта. Длительность курса – не меньше недели, частота использования – до пяти раз ежедневно.

Гранатовый чай

Рецепт очень простой: в привычный и любимый человеком напиток добавляют небольшое количество корочек плода. Можно использовать как предварительно высушенные, так и свежие. Для усиления вкусовых и ароматических качеств, повышения пользы в напиток вводят мяту, лимон, иные травы, оказывающие положительное влияние на человеческое здоровье. Для подслащения лучше использовать мед. Готовый напиток приятно пахнет, немного терпкий и очень вкусный. Правда, важно придерживаться нормы: если корок граната будет слишком много, есть вероятность внезапного ухудшения самочувствия.

Это любопытно

Впервые в нашей стране официально рецепты с использование гранатовой кожуры были опубликованы в 1999 г. Разработанный препарат был предназначен для приведения в норму аппендикса, устранения инвазий сальмонеллы, рекомендовался при дизентерии и поносе. Этот рецепт с применением гранатовых корок был даже запатентован несколькими годами раньше – в 1996-м. Для выявления его эффективности были организованы клинические тесты в профильном медицинском учреждении.

А вы знали, что гранатовые корки, это эффективное очищающее средство от паразитов, токсинов, для лечения поноса, патологий сердечно -сосудистой системы и укрепления иммунитета? Читайте подробнее в этой статье

Гранатовые корки – полезные свойства и рецепты применения

Благородный гранат яркого багрового цвета во все времена считался королем фруктов. Несмотря на то, что в наших краях он не растет, фрукт ценится не меньше, чем в родных странах.

Что уж там говорить, плоды сами все скажут своим безупречным терпковатым вкусом.

На самом деле не только сочные плоды, но и кожура может оказаться полезной.

С помощью простых корок, которые мы привыкли выбрасывать, можно излечиться от многих патологий.

Полезные свойства гранатовых корок

Кожура граната издавна применяется в целебных целях, благодаря своим потрясающим возможностям:

  • остановка процессов окисления и выведение плохого холестерина, что служит отличной профилактикой сердечнососудистых патологий;
  • кожура мгновенно выводит токсины и способствует очищению печени;
  • за счет своих противовоспалительных способностей, кожура широко применяется для укрепления иммунитета и лечения простудных патологий;
  • чай из гранатовых корок прекрасно помогает избавляться от паразитов ( остриц, глистов и т.д)
  • средство на ура справляется с регенерацией кожи и способствует заживлению, поддерживает кости и зубы в хорошем состоянии, что объясняется большой концентрацией аскорбиновой кислоты;
  • составы с порошком граната способствуют остановке кровотечения;
  • многочисленными исследованиями была подтверждена эффективность корок граната в борьбе с онкологическими кожными заболеваниями;
  • порошок, который прожаривается на масле оливы, широко применяется в косметологии против различных высыпаний и прыщей. Помимо этого, состав применяется от ожогов, ссадин и поражений кожного покрова;
  • гранатовые корки — отличное средство от поноса.Отвар поможет решить проблему у детей и взрослых.
  • корки можно смело добавлять в чай. Такой напиток успокоит ваши нервы и поднимет настроение.

Помимо этого стоит отметить многочисленные косметические свойства универсального граната:

  • эллагеновая кислота эффективно увлажняет, делает кожу нежной, помогает от увядания;
  • далеко не всем известно, что гранат способен решить проблему облысения и перхоти, а с помощью настоя из гранатовых корок можно проводить ополаскивания волос, что может придать им красивый оттенок;
  • солнцезащитные вещества, входящие в состав кожицы, борются с ультрафиолетовым облучением;
  • смесь из кожуры и масла стимулирует продукцию проколлагена, что помогает надолго сохранить молодость кожи.

Как сушить гранатовые корки правильно?

Разумно полезные корочки заготавливать на будущее, ведь очень сложно найти в продаже такой специфический продукт.

Вымойте и протрите тщательно полотенцем фрукт, после чего очистите его от кожицы аккуратно, максимально избавляясь от мякоти.

После чего корочки мелко нарежьте и сушите в течении семи дней. Разложите все осторожно на салфетку и накройте слоем марли.

Несколько раз в день из перемешивайте, так как они очень быстро начинают портиться под воздействием влаги.

Сухие корки помещают в пакетах из бумаги и хранят в прохладном месте.

Как приготовить и пить напитки из корочек граната?

  • Настой из гранатовых корок

Как правило на основе гранатовых корок готовят настой. Для этого измельченные корки граната ( 1 ч.л ) заливаются стаканом кипятка и настаиваются 2 часа. Принимают средство по половине стакана.

Такое средство хорошо помогает при диарее (поносе) и обладает всеми вышеперечисленнмыи полезными свойствами .

При соблюдении рецептуры и правильном приготовлении настоя, вы забудете про расстройство кишечника сразу.

Огромным преимуществом продукта является то, что он подавляет пагубную микрофлору во всем ЖКТ и никак не влияет на полезные бактерии.

Рекомендуется все же повторить прием данного средства по истечении двух часов. Если ситуация слишком запущена, больному требуется более длительное лечение до трех дней.

Если вы лечите расстройство кишечника или другие патологии ЖКТ, вам необходимо пить настой четыре раза в день через одинаковый временной интервал. Впервые напиток выпивается натощак, а последняя порция должна быть выпита на ночь. Пейте отвар через день.

Корки граната – ограничения к применению

Как правило, гранатовые корки хорошо переносятся пациентами.

Но фанатически принимать средства народной медицины нельзя. Стоит понимать, что в корках содержится определенное количество токсинов.

Детям разрешается давать по маленькой ложечке настоя пять раз в день.

Школьники могут принимать уже по столовой ложке лекарства, а подростки могут употреблять средство для лечения взрослыми дозами.

С осторожностью следует лечиться корками людям, имеющим склонность к кровотечениям. Очень внимательными должны быть аллергики.

Подобное лечение не подходит людям, страдающим запорами, трещинами в анальном отверстии и геморроем.

Не стоит спешить выбрасывать кожуру из граната. Возможно, она вам пригодится, ведь у нее столько полезных свойств.

Гранат – вкусный популярный экзот. Его любят взрослые и дети, но съедобны только зернышки. Что делать с кожурой, мало кто знает. Почти всегда ее выбрасывают. И напрасно: гранатовые корки насыщены ценными компонентами, по ряду полезных свойств превосходят мякоть. Однако у корок граната полезные свойства и противопоказания дополняют друг друга. И об этом тоже нужно знать.

Состав гранатовой кожуры

У кожуры граната лечебные свойства обусловлены ее составом.

Из чего состоит кожура

Корки граната содержат большинство полезных компонентов, присутствующих в мякоти и зернах экзота:

  1. Натуральные антиоксиданты. Представлены витаминами А, С, Е. Они активируют жировой обмен, полезны для крови, сердца, кожи, десен. Выводят свободные радикалы, притормаживая старение организма. Ускоряют заживление порезов и ран. У корок их вдвое больше, чем у зерен.
  2. Урсоловая кислота. Главный жиросжигатель в организме. Тормозит онкологию, атеросклероз. Помогает работе сердца, контролирует сахар и холестерин в крови, укрепляет волосы, уничтожает перхоть. Это непременный элемент спортивного питания, поскольку держит тело в тонусе и помогает нарастить мышцы.
  3. Дубильные вещества. Им кожура (и другие компоненты граната) обязана вяжущим вкусом. Танины с катехинами составляют треть состава. Ценятся как противовоспалительные и останавливающие кровь, нормализуют работу желудочно-кишечного тракта, выводят токсины, тормозят размножение опасной микрофлоры. Это главный компонент, останавливающий диарею. Однако при избыточном потреблении эффект противоположный, то есть запор.
  4. Антоцианы. Это красящие соединения, благодаря которым гранат обретает фирменный цвет.

Оболочка граната содержит алкалоиды. Их намного меньше, чем у измельченной коры дерева – всего 5%, но вред может оказаться фатальным. Вот почему важно соблюдать дозировку средств из кожуры граната. От использования коры вообще отказались: слишком ядовита.

Минералы, витамины

Гранатовая кожура обладает целебными возможностями благодаря набору минералов:

В кожуре граната избыток витаминов А, Е, С, К. Представлен витаминный комплекс В: В3 (никотиновая кислота), В4 (холин), В9 (фолиевая кислота). Насыщенность железом предотвращает анемичность, улучшает качество крови.

Биологическая и питательная ценность

Пищевая ценность кожуры граната (г/на 100 г свежего продукта):

В составе кожуры граната обнаружены глюкоза, фруктоза, клетчатка (пищевые волокна), органические и жирные кислоты, бета-каротин.

Гранатовые корки полезные свойства

Чем полезна корка граната, досконально изучили на родине экзота, в Грузии.

Это антисептик, бактерицид, заживляющий, противоглистный препарат. Витаминно-минеральный комплекс корок граната укрепляет иммунитет, сердце, сосуды, препятствует проникновению вирусов в организм. Борется с атеросклерозом, ослабляет боль разной природы, выводит токсины из печени, разжижает кровь, тормозит онкологию.

Корки граната для ЖКТ

Главная миссия кожуры граната – оздоровление желудочно-кишечного тракта.

Препарат, созданный грузинскими учеными на основе экстракта из них, доказал эффективность при лечении взрослых и детей. Речь об энтерите, колитах (включая хроническую форму), поражениях внутренней оболочки кишечника, дизентерии.

Если медицинские препараты противопоказаны, подойдут народные средства. Отвары гранатовых корок – доказавшее эффективность средство при сбоях в работе кишечника, в первую очередь диарее, а также при дисбактериозе.

Корки граната для десен

Кожура граната хорошо лечит следующие недуги:

  • кровоточивость десен;
  • гингивит;
  • стоматит
  • ринит;
  • фарингит.

Применяется отвар для полоскания из кожуры экзота. Независимо от характера болезни, ротовая полость оздоравливается целиком.

Корки граната при ожогах

Изобилие аскорбиновой кислоты наделило гранат ранозаживляющим действием.
Регенерация запускается на уровне клеток, поэтому на зажившей коже нет даже маленьких шрамов.
Раны, порезы, ссадины или ожоги лечат порошком либо спиртовой настойкой кожуры фрукта.

Другие применения корок граната

Для корок экзота нашлось еще несколько сфер. Отвары, чаи помогают в таких ситуациях:

  • ослабленный иммунитет, склонность к простудным заболеваниям;
  • межсезонье, чтобы нейтрализовать авитаминоз или анемичность;
  • реабилитация после хирургической операции, тяжелого заболевания;
  • кровохаркание, обильные месячные;
  • ослабление зрения или памяти;
  • нервозность, вспыльчивость.

Отвары, чаи, другие продукты на основе гранатовых корок сохраняют минерально-витаминный баланс организма в проблемных ситуациях.

Народные лекари утверждают, что кожурой граната вылечиваются ЛОР-заболевания, печень, язва. Официальная наука ставит это под сомнение, поскольку в рецептах компоненты экзота дополняются другими ингредиентами. Однако роль гранатовых составляющих как эффективного вспомогательного средства доказана.

Как заготавливать гранатовые корки

Сушеная гранатовая кожура либо продукты из нее продаются в аптеках или интернет-магазинах. Но если хочется иметь их всегда под рукой и быть уверенным в качестве, для лечения лучше заготовить кожуру самостоятельно. Особенно в сезон фрукта.

Заготовка корок экзота включает несколько этапов:

  1. Выбор. Подойдут только сочные плоды, твердоватые с цельной кожурой яркого цвета. Она не должна быть очень сухой, пятнистой или бледной.
  2. Подготовка плодов. Гранаты моют и вытирают досуха. Кожуру осторожно срезают ножом, убирая белую мягкую прослойку: она дает горечь. Если это приветствуется, данный компонент можно оставить.
  3. Корочки экзота измельчают ножом или вручную.
  4. Сырье раскладывают на салфетке, бумаге (не газете, без рисунков) или доске, прикрывают марлей. Располагают на воздухе, но чтобы не попадали солнечные лучи. То есть в тени. Регулярно перемешивают, чтобы все просушилось равномерно. Обычно для полного высушивания хватает недели.
  5. Если корки нужно высушить срочно, используют духовку или электросушилку. Выставляют 45-50°.
  6. При любом способе сушки кондиции гранатовых корок проверяют одинаково. Если легко, с похрустыванием разламываются, – готовы.
  7. Можно измельчить все сырье сразу или часть, нужную в данный момент. Лучший результат даст кофемолка, но подойдет и ступка.
  8. Для хранения гранатовой кожуры выделяют плотно закрываемые емкости (стекло, бумага), которые держат в сухом затененном прохладном месте (13-23°С).

При соблюдении перечисленных условий сушеные корки граната сохраняют кондиции до трех лет.

Корки граната в народной медицине

Есть простые, но эффективные лечебные средства из гранатовой кожуры. Главное знать пропорции и соблюдать технологию изготовления отвара, чая или другого водного настоя сухих корок.

Чай с корками граната

Чай с корками от граната заваривается как обычный. Подходят сухие или свежие, главное, чтобы кусочки корочек были не слишком крупными.

Чай получается душистый, но терпковатый. Поэтому можно разбавить гранатовые корки лимонной кожурой, мятой, мелиссой, другими травами по собственному вкусу. Поле для экспериментирования широкое. Сладкоежкам понравится вариант меда к гранатовому чаю.

У тех, кто постоянно пьет гранатовый чай, красивые волосы, ногти, кожа. Человек замечает, что стал крепче, бодрее, лучше чувствует себя.

Такой чай полезно заварить и пить при стрессе, душевном потрясении. Он помогает одолеть депрессию, бессонницу, тревожность, раздражительность, вспышки агрессии. Особенно помогает его прием на ночь.

Отвар при поносах и расстройствах ЖКТ

Гранат от поноса помогает в любом возрасте. Проверенный рецепт – отвар из сухих измельченных корок граната от диареи.
Для детей до 12 лет. Столовую ложку гранатовых корок заливают 190-210 мл кипятка, накрывают крышкой. Через 35-45 минут средство готово.
При расстройствах ЖКТ у детей дозировка следующая:

  • грудничкам достаточно трех приемов по чайной ложке;
  • детям постарше, до дошкольников включительно, дают чайную ложку 4-5 раз в сутки;
  • в возрасте 7-11 лет нужна столовая ложка трижды в день.

В тяжелых случаях отвар из гранатовых корок от поноса детям потребуется принимать два-три дня. Первую порцию нужно выпивать утром натощак, финальную на ночь.

Для детей старше 12 лет и взрослых. Понадобятся корки граната, вода, термос. Берут столовую ложку корок на 0,5 л воды. Смесь кипятят 10-11 минут на малом огне. Отвар настаивается в термосе около двух часов. Норма приема у взрослых и подростков при диарее – трижды в день до еды по 60-120 мл.


Алкоголь в эти дни запрещен.
Средство прекращает понос, попутно избавляя организм от токсинов. Подавляется только вредная микрофлора кишечника, что нормализует работу ЖКТ.

Для больных десен горла и воспалений во рту

Заболевания ротовой полости лечат гранатовым отваром. Понадобится 20-25 г корок граната на 210-270 мл воды. Смесь кипятят пять-шесть минут, настаивают в термосе минимум час, процеживают. Полоскания ежедневны, по пять-шесть раз. Для излечения обычно хватает пяти-восьми дней.

Другие виды воспалений

Если воспалительным процессом охвачены ЖКТ, мочеполовая, репродуктивная система, почки, в лечении применяют лекарство по такому рецепту.

Кожуру плода средних габаритов измельчают, заливают кипятком, отправляют на паровую баню (на 55-60 минут). Жидкость осторожно сливают. Пьют до еды по 50-60 мл дважды в сутки до результата.

Корки граната от паразитов

Паразитов, остриц, глистов выводят настоем из кожуры граната.

Понадобится 50 г порошка из сухих или свежих корок. Его заливают 380-420 мл воды (примерно два стакана) комнатной температуры, прикрывают крышкой. Через 6-7 часов кипятят, пока количество жидкости не уменьшится наполовину. Остывшую жидкость фильтруют.

Начинают прием настоя гранатовых корок с утра, натощак. Его нужно выпить за час, разделив на 5-6 приемов. Через 30-40 минут принимают слабительное средство.

При ожогах

Эффективное средство лечения ожогов – измельченная до порошка гранатовая кожура и разбавленный гранатовый сок (5 частей воды на 1 часть сока). Жидкостью промывают ожог или ссадину, щедро присыпают порошком, накладывают марлевую повязку. Марля и порошок создадут корку-щит, под которой ожог заживет безопаснее и быстрее.
Подойдет и спиртовая настойка из гранатовых шкурок.

Косметология

Гранатовые корочки используют, чтобы быть красивыми и ухоженными. Популярные варианты из косметологии:

  1. Крем для лица. Обычное средство кремообразной текстуры по уходу за кожей или косметическое масло обогащается порошком из корок граната (45-55 г). Аппликации с гранатовым порошком разглаживают морщинки.
  2. Отвар-ополаскиватель для волос. 150 г корок граната заливают 450 мл воды, на слабом огне доводят до кипения (но не кипятят). Настаивают сутки. Применяют после мытья головы на влажные волосы. Средство укрепляет волосы, ускоряет их рост, но делает темнее.
  3. Настойка против перхоти. В раствор (как для отвара-ополаскивателя) добавляют 75 мл водки или разбавленного до водочной концентрации спирта. Настойку из корок граната и водки наносят на кожу головы или волосы максимум на 14-16 минут.

Гранатово-спиртовой состав противопоказан при чувствительной коже головы, пересушенных, ломких, посеченных волосах.

Для создания домашнего гранатового ассортимента в магазинные кремы или маски для лица можно добавлять витаминно-минеральные комплексы, масла, другие компоненты, используемые повседневно. Как пример, гранатовый порошок, прожаренный на оливковом масле. Средство хорошо помогает от высыпаний и прыщеватости.

Корки граната противопоказания и вред

Как любой продукт, тем более экзот, гранат, его кожура, другие компоненты имеют противопоказания.

Кому запрещен экзот

Шкурки граната запрещено использовать в следующих случаях:

  • индивидуальная непереносимость, аллергия на гранат;
  • предрасположенность к запорам, травмы прямой кишки, геморрой;
  • заболевания почек;
  • гепатит;
  • повышенный риск кровотечений.

Кожура граната несовместима с антигистаминными средствами, их параллельный прием опасен.

Что учитывать при использовании сырья

В кожуре граната сосредоточены токсичные элементы, провоцирующие отравление. Чтобы избежать этого, при применении гранатовых корок или продуктов из них соблюдают рецептуру и частоту приема. Маленьким детям при поносе дают чайную ложечку гранатового отвара (максимум пять раз за день), школьникам до 12 лет – столовую.

Во время беременности и при грудном вскармливании кожура граната как лечебное или профилактическое средство применяется только после консультаций с врачом.

Если это невозможно, отказ однозначен. Иначе проблемы возникнут не только у мамы, но и у ребенка.

Признаки отравления кожурой

Опасный компонент корок граната – органические щелочи (алкалоиды). Их чрезмерное количество вызывает тошноту, рвоту, общее недомогание, головную боль, головокружение, судороги, потемнение в глазах.

При появлении любого из этих симптомов прием гранатовых препаратов прекращают. В тяжелых случаях немедленно обращаются к врачу.

Заключение

Корки граната задействуют для красоты и более приземленных, практичных целей по сохранению здоровья. Их не стоит выбрасывать, ведь процесс заготовки несложен.

При соблюдении дозировки и меры пагубные побочные эффекты исключены, а позитивные изменения не заставят себя ждать.

Оцените статью: Поделитесь с друзьями!

Положительное влияние экстракта кожуры граната и пробиотиков на преадипоцитную дифференцировку

Front Microbiol. 2019; 10: 660.

Валерия Сорренти

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Cinzia Lucia Randazzo

2 Dipaziena Di мы Università di Catania, Катания, Италия

Cinzia Caggia

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

Gabriele Ballistreri

) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Флора Валерия Ромео

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Симона Фаброни

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок и цитрусовых and Tree Fruit, Ачиреале, Италия

Николина Тимпанаро

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливковых, цитрусовых и древесных фруктов, Ачиреале, Италия

Марко Рафаэле

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Luca Vanella

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия , Италия Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

3 Совет по сельскохозяйственным исследованиям и исследованиям в области сельского хозяйства Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Под редакцией: Розальба Ланчотти, Болонский университет, Италия 90 003

Рецензент: Анна Реале, Институт науки и технологий (ISA), Италия; Коши Филип, Малайский университет, Малайзия

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы микробиологии»

Поступила в редакцию 22 октября 2018 г .; Принята в печать 15 марта 2019 г.

Авторские права © 2019 Сорренти, Рандаццо, Каджия, Баллистрери, Ромео, Фаброни, Тимпанаро, Раффаэле и Ванелла.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Благоприятные эффекты граната обусловлены содержанием эллагитаннинов и антоцианов, которые защищают от множества заболеваний, включая воспалительные. Многие исследователи сообщают, что экстракты отходов граната (кожуры и семян), полученные из отходов промышленной переработки, обладают акцептором свободных радикалов и обладают мощной антиоксидантной способностью. Экстракты граната (ПЭ) также обладают антибактериальной, противовирусной, гиполипидемической и противовоспалительной биоактивностью благодаря содержанию полифенольных соединений, включая пуникалагины, галловую кислоту и производные эллаговой кислоты.В центре внимания данной рукописи было изучение пребиотического потенциала PE, растворимого в воде и охарактеризованного с помощью HPLC – PDA – ESI / MS n на предмет его фенольного содержания. Более того, поскольку сообщалось, что экстракты граната снижали уровень липидов в крови и что было показано, что ряд пробиотических штаммов влияет на адипогенез в культуре клеток, это исследование также было выполнено для проверки in vitro эффектов PE и пробиотик L.rhamnosus GG ATCC 53103 (LGG) на линии клеток 3T3-L1. PE и пробиотики существенно снижали содержание триглицеридов и увеличение внутриклеточных липидов по сравнению с контрольной группой. Однако комбинированная обработка отработанного бульона (SB), фильтрованного через PE и LGG, была наиболее эффективной в снижении содержания триглицеридов и накопления внутриклеточных липидов. Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно ниже в клетках 3T3-L1, обработанных PE и SB, отфильтрованных через LGG.Эти результаты свидетельствуют о том, что синергетический эффект пробиотиков и полифенолов, содержащихся в PE, может повлиять на адипогенез in vitro, и может способствовать разработке новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Ключевые слова: лактобацилл, антимикробная активность, экстракт граната, дифференциация адипоцитов, комбинирование продуктов

Введение

Гранат — это фрукт, положительное влияние на здоровье которого было тщательно изучено.Этот фрукт богат биологически активными соединениями, такими как эллагитаннины и антоцианы, которые защищают от дегенеративных заболеваний. Плод граната из-за его высокой питательной ценности, пользы для здоровья и биоактивных антиоксидантных соединений считается пищевым лекарством. Фактически, гранат широко используется в фитотерапии при нескольких патологиях, включая грипп и инфекции верхних дыхательных путей. Все части плодов граната, то есть кожура и семена, рассматриваемые как отходы, могут быть переработаны для получения продуктов с добавленной стоимостью, имеющих промышленную, медицинскую и косметическую ценность (Dhumal et al., 2014).

Отходы граната образуются на всех этапах жизненного цикла плодов, то есть во время сельскохозяйственного производства, промышленного производства и переработки. Можно использовать побочные продукты граната, поскольку они являются богатым источником биологически активных соединений, таких как флавоноиды, фенольные кислоты и дубильные вещества. Более того, многие исследователи описали, что экстракты граната, изготовленные из побочных продуктов перерабатывающих предприятий, обладают эффективным улавливанием свободных радикалов и антиоксидантной способностью (Lee et al., 2010; Panichayupakaranant et al., 2010; Fischer et al., 2011).

Кроме того, экстракты граната действуют как естественные ингибиторы патогенов, бактерий и грибков (Al-Zoreky, 2009; Tehranifar et al., 2011; Romeo et al., 2015).

Эллагитаннины граната гидролизуются микробиотой кишечника до более мелких фенольных соединений, таких как эллаговая кислота. Затем эллаговая кислота всасывается в кровоток, в то время как эллагитаннины не всасываются и метаболизируются в уролитины.

Сообщалось, что побочные продукты граната и пуникалагины в значительной степени способны подавлять рост патогенных Escherichia coli , Pseudomonas aeruginosa , Clostridia и Staphylococcus aureus (Reddy et al., 2007; Bialonska et al., 2009) и для увеличения роста полезных бактерий, включая Bifidobacterium spp. и Lactobacillus spp. (Reddy et al., 2007; Bialonska et al., 2010).

Экстракты граната также снижают уровень липидов в крови и обладают значительной противоопухолевой, противовирусной и противовоспалительной активностью (Li et al., 2006; Hossin, 2009; Lin et al., 2013; Bassiri- Джахроми, 2018).

Эти потенциальные полезные эффекты приписываются полифенольным соединениям, которые содержатся в экстрактах граната, включая пуникалагины, галловую кислоту и производные эллаговой кислоты (Vanella et al., 2013а, б, в; Romeo et al., 2015).

Поскольку ожирение является одной из основных проблем общественного здравоохранения, необходимы новые превентивные стратегии (Smith and Smith, 2016).

Адипоциты играют важную роль в начале или развитии метаболических осложнений, связанных с ожирением, таких как метаболический синдром и диабетические осложнения (Kim and Plutzky, 2016).

Интерес исследователей к выявлению натуральных продуктов, полученных из диетических растений, обладающих активностью против ожирения, возрос.Сообщалось, что ксантиген и фукоксантин, природные соединения масла косточек граната, значительно подавляли дифференцировку адипоцитов и накопление липидов (Lai et al., 2012).

Настоящая рукопись посвящена прежде всего изучению антиоксидантной и антимикробной активности, а также пребиотического потенциала ПЭ, богатого фенольными соединениями. Более того, обогащенный стандартизованный полиэтилен, содержащий высокий процент природных антиоксидантов граната, был химически охарактеризован с помощью ВЭЖХ – PDA – ESI / MSn.Во-вторых, поскольку гранатовый сок (Les et al., 2018) и различные типы экстрактов граната (PE), включая экстракт, полученный из цельного фрукта (Li et al., 2015), и экстракт, полученный из кожуры граната (Neyrinck et al., 2013), и было показано, что ряд пробиотических штаммов (Moon et al., 2012; Park et al., 2014) влияют на адипогенез, это исследование было проведено для проверки in vitro эффектов PE, пробиотика L rhamnosus GG ATCC 53103 (LGG), предварительно инкубированные с PE, отдельно или в комбинации, при дифференцировке клеток 3T3-L1.

Материалы и методы

Химические вещества

Порошкообразный экстракт граната (Dermogranate ® ), использованный в этом исследовании, был предоставлен Medinutrex (Катания, Италия). Вкратце, экстракт готовили из сушеных и измельченных плодов граната, смешанных с водно-спиртовыми растворами (пищевой), а затем фильтровали. Фильтрат концентрировали и затем сушили распылением для получения стандартизованного экстракта. Экстракт Dermogranate ® имел следующий химический состав: общие полифенолы (16%), пуникалагины (8%), эллаговая кислота и производные (8%).

Реагент Фолина – Чокальтеу (FCR), карбонат натрия (Na 2 CO 3 ), галловая кислота, пуникалин (смесь аномеров), пуникалагин и эллаговая кислота были приобретены у Sigma-Aldrich (Милан, Италия). Гранатин Б был приобретен у LGC Standards (Лондон, Великобритания). Для хроматографии использовали растворители степени чистоты для ВЭЖХ – МС (Merck KgaA, Дармштадт, Германия), а все остальные реагенты были аналитической чистоты.

Определение общего содержания полифенолов

Анализ Folin – Ciocalteu (Singleton et al., 1999) был использован для определения общего содержания полифенолов с небольшими модификациями. 0,1 мг / мл экстракта растворяли в дистиллированной воде. Затем к 500 мкл образца добавляли 5 мл 10% FCR и 4,5 мл раствора Na 2 CO 3 (7,5% мас. / Об.). Конечный раствор перемешивали в течение 2 часов в темноте, а затем измеряли Abs при λ = 765 нм. Анализы проводили в трех экземплярах, и общую концентрацию полифенолов выражали в граммах эквивалентов галловой кислоты (GAE) / 100 г экстракта.

HPLC – PDA – ESI / MS

n Анализ фенольных соединений

Разделение и количественное определение фенольных соединений выполняли, как описано ранее (Romeo et al., 2015). Для идентификации фенольных соединений времена удерживания (RT), спектры и данные МС в режиме отрицательного ESI сравнивали с данными аутентичных стандартов. Количественное определение каждого фенольного соединения проводили с использованием соответствующего стандарта в качестве внешнего стандарта. Количественное определение галловой кислоты проводили при 280 нм.Пуникалины, гранатин В, пуникалагины и эллаговая кислота определялись количественно при 378 нм; та же длина волны использовалась для количественного определения производных эллаговой кислоты с использованием эллаговой кислоты в качестве стандарта сравнения. Анализы проводили в трех экземплярах, и результаты выражали в г соединения / 100 г экстракта.

Тушение DPPH

Способность улавливать свободные радикалы различных концентраций экстракта PE (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) измеряли по 2, Безрадикальный метод 2-дифенил-1-пикрилгидразилгидрата (DPPH), как сообщалось ранее (Salerno et al., 2012). Результаты выражены в процентах от степени ингибирования ± SD .

Влияние поглотителя на супероксид-анион

Способность экстракт ПЭ различных концентраций улавливать супероксид-анион (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) определялась как сообщалось ранее (Салерно и др., 2012). Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Мышиные преадипоциты 3T3-L1 Жизнеспособность клеток

Мышиные преадипоциты 3T3-L1 были приобретены в Американской коллекции типовых культур (Роквилл, Мэриленд, США).Клетки высевали в концентрации 2 × 10 5 клеток на лунку 96-луночного микропланшета и культивировали при 37 ° C в инкубаторе с 5% CO 2 в течение 48 часов в отсутствие и в присутствии различных концентраций ЧП сообщалось выше. Жизнеспособность клеток измеряли с помощью анализа МТТ, как сообщалось ранее (Di Giacomo et al., 2015). МТТ, желтый тетразол, в живых клетках восстанавливается до пурпурного формазана. Результаты выражены в процентах формазана, продуцированного в обработанных мышиных преадипоцитах 3T3-L1 по сравнению с необработанными клетками.

Микробиология

Бактериальное культивирование

Использовали коммерческие штаммы патогенов E. coli ATCC 25922, S. aureus ATCC 29213, Listeria innocua ATCC 33090 и Salmonella enterica ATCC 14028. Штамм E. coli выращивали в бульоне Лурия-Бертани (LB) при 37 ° C в течение ночи; S. aureus , S. enterica и L. innocua обычно выращивали в течение ночи в триптон-соевом бульоне (TSB) при 37 и 30 ° C соответственно.Все материалы и приложения предоставлены Oxoid (Милан, Италия).

Коммерческие пробиотические штаммы LGG, Bifidobacterium animalis BB12, B. longum BB536 и дикий штамм Lactobacillus paracasei N 24, выделенные из кротонского сыра пекорино, культивировали в бульоне Демана – Рогоза – Шарпа (MRS). при 37 ° C в течение ночи.

Ночные бактериальные культуры инкубировали при 37 ° C в течение 24 часов в анаэробных условиях, пока они не достигли плотности клеток приблизительно 1.0 × 10 9 КОЕ / мл.

Определение скорости роста

На основании результатов, полученных по активности PE в качестве акцептора свободных радикалов, и экспериментов по жизнеспособности преадипоцитов мышей 3T3-L1, для обработки штаммов пробиотиков или патогенов, как описано ниже, использовали различные концентрации.

Антимикробная активность PE оценивалась против коммерческих штаммов патогенов, упомянутых выше. Ночные культуры патогенов совместно культивировали при 37 ° C в течение 24 ч с PE в различных концентрациях (1.7–0,34–0,17 мг / мл), а антимикробную активность оценивали подсчетом живых бактерий на чашках и выражали в КОЕ / мл.

Влияние PE на рост пробиотических штаммов, упомянутых выше, оценивали при совместном культивировании пробиотических штаммов с плотностью клеток приблизительно 1,0 × 10 9 КОЕ / мл с PE в различных концентрациях (0,085–0,042– 0,028 мг / мл). Влияние экстракта на рост пробиотических штаммов оценивали после инкубации при 37 ° C в течение 24 часов в анаэробных условиях путем посева живых бактерий и выражали в КОЕ / мл.

Все эксперименты проводились в двух экземплярах, а результаты выражались в виде средних значений и стандартного отклонения. Основываясь на предварительных результатах, для последующего анализа была выбрана LGG.

Свежие бульонные культуры центрифугировали при 5000 об / мин в течение 10 минут при 4 ° C, супернатант декантировали для сбора отработанного бульона (SB), который фильтровали (FSB) с использованием фильтра 0,22 мкм и затем использовали для дальнейшего использования. анализы.

Бактериальный осадок ресуспендировали в 1 мл PBS и пять раз обрабатывали ультразвуком с амплитудой 44% в течение 2 мин с 6 мин отдыха.Затем обработанный ультразвуком центрифугировали при 1100 × g в течение 15 мин при 4 ° C. Супернатант собирали, фильтровали через фильтр 0,22 мкм и меченный экстракт бактериальных клеток (CE). CE использовался для дальнейшего анализа.

Культура клеток и дифференцировка клеток адипоцитов

Преадипоциты мышей 3T3-L1 ресуспендировали в среде Игла, модифицированной Дульбекко (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS, Invitrogen, Карлсбад, Калифорния, США) и 1% антибиотика. / антимикотический раствор (Invitrogen, Карлсбад, Калифорния, США) и высевали в колбу размером 75 см 2 при плотности от 1 до 2 × 10 4 клеток.Дифференцировку клеток адипоцитов получали, как сообщалось ранее (Waldman et al., 2016).

Дифференцирующиеся преадипоциты 3T3-L1 обрабатывали в течение 7 дней PE (0,028 мг / мл), LGG CE (25 мкг / мл) и SB, профильтрованным через LGG (10 мкг / мл) из ночной бактериальной культуры, инкубированной с или без ПЭ (0,028 мг / мл).

Количественное определение содержания липидов

Для количественной оценки накопления липидов проводили масляное красное окрашивание, как сообщалось ранее (Barbagallo et al., 2017). Образование липидных капель измеряли с помощью инвертированного многоканального светодиодного флуоресцентного микроскопа (Evos, Life Technologies, Гранд-Айленд, Нью-Йорк, США).

Экстракция

РНК и qRT-PCR

Экспрессии адипонектина, PPAR-γ, SREBP, FAS, IL-6 и IL-10 оценивали с помощью ПЦР в реальном времени. РНК экстрагировали и количественно оценивали, как сообщалось ранее (Raffaele et al., 2018). Использовали соответствующие последовательности праймеров (). Относительный уровень экспрессии мРНК измеряли по значению порогового цикла (Ct) каждого продукта ПЦР и нормализовали с таковым для GAPDH с использованием сравнительного метода 2 -ΔΔCt .

Таблица 1

Праймеры для ПЦР, использованные в этом исследовании.

Gene Прямой праймер Обратный праймер
Адипонектин GAAGCCGCTTATGTGTATCGC GAATGGGTACATTGGGAACAGT
IL-6 TTCCTCTCTGCAAGAGACTTCC AGGAGAGCATTGGAAATTGGGG
FAS GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
GAPDH AGCTTCGGCACATATTTCATCTG CGTTCACTCCCATGACAAACA
IL-10 GCTGGACAACATACTGCTAACC ATTTCCGATAAGGCTTGGCAA
SREBP-1 GATGTGCGAACTGGACACAG CATAGGGGGCGTCAAACAG
PPAR-γ TCGCTGATGCACTGCCTATG ACCTGATGGCATTGTGAGACAT

Статистический анализ

Статистический анализ множественных сравнений был выполнен e Метод Фишера. P — значения ниже 0,05 были приняты как значимые. Данные были проанализированы с использованием либо однофакторного дисперсионного анализа (ANOVA) для нескольких групп, либо непарного t -теста для двух групп, и результаты представлены в виде среднего значения ± стандартное отклонение.

Результаты

HPLC – PDA – ESI / MS

n Анализ PE

Фенольный профиль PE () включал определение 1 гидроксибензойной кислоты и 19 эллагитаннинов. Основные пики соответствовали пуникалину (пик 4), гранатину B (пик 6), пуникалагину A и B (пики 10 и 14) и эллаговой кислоте (пик 19) ().Выявлено также присутствие галловой кислоты (пик 1) и производных эллаговой кислоты (пики 2, 3, 5, 7–9, 11–13, 15–18, 20). Как показано на хроматограмме, эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожуры), поскольку они составляют более 99% от общего содержания фенольных соединений граната. Пуникалагины, основные эллагитаннины побочных продуктов граната, составляли 47,6% от общего содержания фенольных соединений в ПЭ (). Производные эллаговой кислоты, эллаговая кислота и другие второстепенные фенольные соединения (пуникалин, гранатин B и галловая кислота) составили 38.4, 10,2 и 3,8% от общего содержания фенолов в ПЭ соответственно ().

ВЭЖХ-хроматограмма фенольных соединений ПЭ, обнаруженных при 378 нм. Об идентификации пиков см.

Таблица 2

Список пиков и количественное определение фенольных соединений в ПЭ.

0,07 0,07 966 9,5 9 9278 9027 301 9027 0,027 603 603 Ead d 8 9278 9027 0278 9027 9027 0278 9 9027 35,4 Ead d 902 7.82 фенол
Номер пика a RT (мин) λ (нм) [M – H] ( м / z ) MS n ( m / z ) Фенольные соединения г / 100 г b
1 3.9 269,310 169 125 Кислота галловая 0,07 ± 0,02
2 4,1 255,364 301 301 3 7,0 255,363 301 Ead ​​ d 0,41 ± 0,04
4 7,3 263,364403 9027 601 9027 9027 9027 P 263,36440727 ± 0,04
5 8,4 264,366 301 Ead ​​ d 0,19 ± 0,09
6
Гранатин В 0,28 ± 0,03
7 10,4 259,361 301 Ead ​​ d 0,02 ± 0,01 257,360 301 Ead ​​ d 0,05 ± 0,01
9 13,5 256,362
10 14,0 258,378 1083 781/601 Пуникалагин А 3,05 ± 0,05
11 15,1
15,1
0.13 ± 0,09
12 15,9 257,361 301 Ead ​​ d 0,95 ± 0,03
13
2,69 ± 0,11
14 17,7 257,378 1083 781/601 Пуникалагин B 4,77 ± 0,21 4,77 ± 0,21 257,362 301 Ead ​​ d 0,12 ± 0,01
16 25,2 256,363
17 29,3 254,361 301 Ead ​​ d 0,17 ± 0,01
18 32,2 32,2
0.08 ± 0,03
19 33,6 256,367 301 229/185 Эллаговая кислота 1,68 ± 0,01
20 9027
0,08 ± 0,02
Всего полифенолов c 16,48 ± 2,49
Производные эллаговой кислоты 6,31
Эллаговая кислота 0,62
Всего 16.43

Масс-спектрометрические свойства 20 идентифицированных фенольных соединений (пики 1–20) показаны на рис. Как сообщалось ранее (Romeo et al., 2015), наблюдались две изомерные формы (A и B) пуникалагинов (пики 10 и 14), а также было подчеркнуто присутствие гранатина B (пик 6). Кроме того, эти соединения также были охарактеризованы прямым анализом отрицательных ионов для инфузии ESI / MS n стандартных соединений.Пик 4 был идентифицирован как пуникалин ( m / z 781), тогда как пики 2, 3, 5, 7–9, 11–13, 15–18 и 20 были идентифицированы как производные эллаговой кислоты в соответствии с их УФ – видимой областью и массой. характеристики (λ max около 370 нм и фрагмент MS 1 на мкм / z 301, соответствующий эллаговой кислоте).

Активность PE по улавливанию свободных радикалов

Антиоксидантная активность PE проверялась по их способности восстанавливать стабильный радикал DPPH.

В частности, процент ингибирования DPPH достигал 75% при концентрациях ниже 0.21 мг / мл (76,78, 79 и 80% соответственно при концентрации ПЭ 0,17-0,11-0,085 и 0,028 мг / мл). При концентрациях выше 0,21 мг / мл процент ингибирования DPPH был ниже ().

Активность ПЭ по улавливанию радикалов DPPH в различных концентрациях. Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Экстракт граната ингибировал образование супероксид-аниона дозозависимым образом (). Как правило, в этом тесте PE оказался более эффективным, чем в предыдущем.Это может быть связано с меньшим размером супероксид-аниона по сравнению с радикалом DPPH.

Таблица 3

Активность по улавливанию супероксидных ионов при различных концентрациях ПЭ.

78 ± 2
концентрации PE % ингибирования концентрации PE % ингибирования
PE (3,4 мг / мл) 65 ± 2 PE (0,21 мг / мл)
PE (1,7 мг / мл) 73 ± 3 PE (0.17 мг / мл) 80 ± 1
PE (0,85 мг / мл) 75 ± 1 PE (0,11 мг / мл) 85 ± 3
PE (0,56 мг / мл ) 70 ± 2 PE (0,085 мг / мл 88 ± 4
PE (0,42 мг / мл) 68 ± 1 PE (0,028 мг / мл) 95 ± 1
PE (0,34 мг / мл) 75 ± 4

Влияние PE на жизнеспособность клеток 3T3-L1

3- (4,5-диметилтиазол ил) -2,5-дифенилтетразолийбромид (МТТ) проводили для оценки жизнеспособности клеток 3T3-L1.Результаты показывают значительное снижение жизнеспособности клеток при высоких концентрациях PE (3,4, 1,7, 0,85, 0,56 и 0,42 мг / мл), тогда как при более низких (0,34, 0,21, 0,17, 0,11 и 0,085 мг / мл) концентрациях наблюдается умеренная ингибирующий эффект и концентрация 0,028 мг / мл не оказали значительного влияния на жизнеспособность клеток преадипоцитов мышей 3T3-L1 ().

Процент выживаемости преадипоцитов мышей 3T3-L1 в присутствии PE в различных концентрациях. Результаты выражены как среднее значение ± стандартное отклонение четырех экспериментов, проведенных в трех повторностях.Значимые по сравнению с необработанными контролями: p <0,005; ∗∗ p <0,05.

Microbiology

Антимикробная активность PE в отношении штаммов патогенов

Данные анализа совместного культивирования показали, что патогены были по-разному чувствительны к PE. В деталях, как показано в, экстракт в концентрации 1,7 мг / мл показал наивысшую антимикробную активность против всех патогенов со значительным снижением на L. innocua (проксимально 4 log единицы).При концентрации 0,34 мг / мл экстракт был эффективен против E. coli , L. innocua и S. aureus , демонстрируя снижение плотности клеток на 1 и 2 log единицы соответственно. Когда PE тестировали при концентрации 0,17 мг / мл, штаммы S. aureus , S. enterica и L. innocua все еще подавлялись, в то время как рост E. coli не подвергался значительному влиянию.

Противомикробная активность PE различной концентрации в отношении патогенов, обнаруженных в T24 (24 ч инокулята).Плотность клеток выражается как Δlog КОЕ / мл.

Эффект PE на рост пробиотических штаммов

Результаты, показанные в, подчеркнули, что PE, при всех испытанных концентрациях, не обладал какой-либо ингибирующей активностью в отношении роста испытанных пробиотических штаммов. Небольшое увеличение роста наблюдалось для LGG, совместно культивируемых с PE в концентрации 0,028 мг / мл ().

Таблица 4

Количество бактерий, выраженное в логарифме 10 КОЕ / мл в трех повторностях ± стандартное отклонение L. rhamnosus GG ATCC 53103, Bifidobacterium animalis BB12, B.longum BB536 и дикий штамм Lactobacillus paracasei N 24 после инкубации с PE в различных концентрациях.

90CC3 ) 9027 a 9027 9027 9040 мг 9,57 ± 0,12 a
Журнал 10
L. rhamnosus GG Исходный уровень 8,83 ± 0,09 a

3

9,20 ± 0,10 b
PE (0.042 мг / мл) 9,24 ± 0,07 b
PE (0,028 мг / мл) 9,26 ± 0,04 b
Lactobacillus paracase8
Lactobacillus paracasei
N24 PE (0,085 мг / мл) 8,70 ± 0,08 a
PE (0,042 мг / мл) 8,79 ± 0,10
PE (0.028 мг / мл) 8,74 ± 0,09 a
Bifidobacterium animalis Исходный уровень 9,15 ± 0,05 a
BB40 0,12 a
PE (0,042 мг / мл) 9,44 ± 0,10 b
PE (0,028 мг / мл) 9,55 ± 0,07 9027 b Б.longum Исходный уровень 9,77 ± 0,03 a
BB536 PE (0,085 мг / мл) 9,54 ± 0,10 a
PE (0,028 мг / мл) 9,44 ± 0,16 a

Влияние полиэтилена и экстракта LGomenate на содержание липидов 9000Ggranate 9000Ggrana 9 фильтрованный SB значительно снизил содержание триглицеридов по сравнению с контрольной группой ().Однако эффект отфильтрованного SB, полученного из клеток, инкубированных с PE (LGG-T1) или без него (LGG-T0), был аналогичным. Одновременная обработка преадипоцитов мышей 3T3-L1 SB, отфильтрованным через PE и LGG, значительно снизила содержание триглицеридов по сравнению с обработкой только SB, отфильтрованного через LGG. Более того, эти данные свидетельствуют о том, что комбинированное лечение PE и LGG-T1 было наиболее эффективным для снижения содержания триглицеридов и накопления внутриклеточных липидов.

(A) Типичное масляное красное окрашивание O клеток 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE. (B) Содержание липидов определяли количественно с помощью окрашивания Oil Red O (среднее ± SD , p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с LGG T0 + PE).

Обработка преадипоцитов мышей 3T3-L1 клеточным экстрактом LGG (CE), полученным из клеток, инкубированных с PE (CE + PE) или без него (CE), не оказала влияния на накопление внутриклеточных липидов по сравнению с контрольной группой ( Контроль: ABS 490 нм = 0.200 ± 0,07; CE: ABS 490 нм = 0,187 ± 0,09; CE + PE = ABS 490 нм = 0,190 ± 0,05).

Влияние PE на адипогенные маркеры

Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно менее выражены в клетках 3T3-L1, обработанных SB, отфильтрованным через PE и LGG. В частности, PE, LGG-T0 и LGG-T1 были способны снижать уровни гена адипонектина, PPAR-γ, SREBP, FAS и IL-6 и повышать уровни гена IL-10 ().

(A – F) Анализ экспрессии генов с помощью qRT-PCR липогенного пути в клетках 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE.Результаты выражены в виде среднего значения ± стандартное отклонение четырех экспериментов, выполненных в трех повторностях ( * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с контролем. LGG T0 + PE).

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно снизила уровни экспрессии мРНК основных транскрипционных факторов, участвующих в адипогенезе, по сравнению с обработкой SB, отфильтрованных через LGG ( LGGT0 и LGGT1) отдельно ().

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно повысила уровни экспрессии мРНК IL10 по сравнению с обработкой только SB (LGGT0 и LGGT1), профильтрованных через LGG ( ). Более того, эти данные свидетельствуют о том, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10 (2).

Обсуждение

Благоприятные эффекты употребления плодов граната и / или сока вызвали значительный научный интерес (Basu and Penugonda, 2009).Многие исследователи сообщают, что полиэтилены, полученные из отходов перерабатывающих предприятий, обладают способностью улавливать свободные радикалы и обладают мощной антиоксидантной способностью (Panichayupakaranant et al., 2010; Fischer et al., 2011). ПЭ, использованный в настоящем исследовании, был растворим в воде и охарактеризован с помощью ВЭЖХ – PDA – ESI / MS n по содержанию фенолов и антоцианов. В соответствии с предыдущими сообщениями (Fischer et al., 2011; Qu et al., 2012; Romeo et al., 2015) эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожура), поскольку они составляют более 99% от общего содержания фенольных соединений граната.Основными эллагитаннинами побочных продуктов граната, а также продуктов из граната (фруктов и соков) являются пуникалагины (Gil et al., 2000; Fischer et al., 2011; Qu et al., 2012).

Экстракт граната содержит высокий процент фенольных соединений и проявляет антиоксидантную активность в зависимости от концентрации, как показано для анализа как DPPH, так и анализа поглощения супероксид-анионов.

Сообщалось, что диетические полифенолы растений способны избирательно модулировать рост чувствительных микроорганизмов (Tabasco et al., 2011). Экстракты растений обычно подавляют рост бактерий, но степень эффекта зависит от состава экстракта и типа бактериального штамма.

Результаты, полученные в условиях наших экспериментов, продемонстрировали, что высокие концентрации полифенолов граната оказывают противомикробное действие на некоторые штаммы патогенов, такие как L. innocua и S. aureus. Эти результаты согласуются с исследованиями Panichayupakaranant et al. (2010), Fawole et al.(2012) и Su et al. (2012).

Однако при концентрациях PE ниже 0,34 мг / мл, хотя не было обнаружено концентраций ингибирующей активности в отношении штаммов пробиотиков, оценивалось только небольшое увеличение роста LGG. Эти результаты не согласуются с исследованиями Li et al. (2015) и Neyrinck et al. (2013), которые продемонстрировали, что полифенолы граната потенциально могут работать как пребиотики.

Ожирение — это состояние, при котором накопление липидов приводит к расширению жировой ткани, которая действует как метаболический и эндокринный орган.Молекулярные механизмы, которые модулируют рост, дифференцировку и липогенез преадипоцитов жировых клеток, были предметом обширных исследований (Vanella et al., 2012; Stechschulte et al., 2014; Moseti et al., 2016; Palmeri et al., 2016; Waldman et al., 2016; Carpene et al., 2018).

Во время дифференцировки адипоцитов преадипоциты дифференцируются в зрелые адипоциты (Lefterova, Lazar, 2009). Повышенное накопление жира сильно коррелирует с количеством клеток и / или размером адипоцитов (Jiang et al., 2008).

Сообщалось, что степень ожирения связана с дифференцировкой преадипоцитов в адипоцитах и ​​с увеличением адипоцитов в жировой ткани (Wang and Jones, 2004).

Другие авторы сообщили, что PEs способны подавлять дифференцировку преадипоцитов и адипогенез и уменьшать жировую дистрофию печени у крыс с ожирением и диабетом 2 типа (Xu et al., 2009).

В соответствии с данными Moon et al. (2012) и Park et al. (2014) в наших экспериментальных условиях PE, LGG-T0 и LGG-T1 приводили к значительному снижению накопления липидов в клетках 3T3-L1 во время дифференцировки в адипоциты, предполагая, что PE, LGG-T0 и LGG-T1 способны подавлять дифференцировка адипоцитов.Однако обработка LGG-фильтрованным SB, полученным из клеток, инкубированных с PE (LGG-T1) или без (LGG-T1), была аналогичной. В наших экспериментальных условиях фактически не наблюдалось пребиотического эффекта, продемонстрированного другими авторами. Более того, комбинированное лечение PE и LGG-T1 было наиболее эффективным в снижении внутриклеточного накопления липидов. Эти данные демонстрируют, что, даже если в наших экспериментальных условиях не наблюдалось пребиотического эффекта, фильтрованный SB, полученный из LGG, инкубированного с PE (LGG-T1), мог бы содержать, помимо полезных бактериальных секретируемых биоактивных соединений, также небольшие количества PE- производные биоактивные соединения.Последний, присутствующий в небольших количествах в LGG-T1, не будет иметь более сильных положительных эффектов, чем LGG-T0, но в сочетании с PE может иметь потенциальные синергетические преимущества для здоровья.

Адипоцит-специфический рецептор, активируемый пролифератором пероксисом-γ (PPARγ), участвует в ранней стадии дифференцировки адипоцитов (Rosen et al., 2000), регулируя экспрессию адипогенных генов, таких как синтаза жирных кислот (FAS) и регуляторный элемент стерола. -связывающие белки (SREBP), а затем запускают накопление жира в клетках (Kawada et al., 2001; Бергер и Моллер, 2002).

Жировая ткань — это не только первичный резервуар жира, но и эндокринный орган, контролирующий гомеостаз липидов. Измененные уровни адипокинов жировой ткани могут способствовать развитию воспаления, что приводит к нарушению липидного обмена (Armani et al., 2010). При хроническом воспалении провоспалительные цитокины, такие как IL-6, активируются, тогда как противовоспалительные цитокины, такие как IL-10, подавляются (Kershaw and Flier, 2004; Bradley et al., 2008; Лира и др., 2012; Лю и др., 2018).

Наши результаты демонстрируют, что комбинированное лечение PE + LGG-T1 значительно снижает уровень мРНК адипонектина, FAS и IL-6 и повышает уровень IL-10.

Можно сделать вывод, что комбинированное лечение PE + LGG-T1 обладает противовоспалительными свойствами и способно ингибировать дифференцировку адипоцитов, модулируя уровни экспрессии ключевых факторов адипогенной транскрипции, участвующих в адипогенезе.

Заключение

SB, профильтрованный экстрактом граната и LGG, значительно снизил накопление внутриклеточных липидов.Наблюдали синергетический эффект пробиотиков и полифенолов, содержащихся в PE. Более того, наши результаты показали, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10.

Эти результаты свидетельствуют о том, что пробиотики и полифенолы, содержащиеся в ПЭ, могут влиять на адипогенез in vitro. Более того, наши результаты демонстрируют, что синергетические свойства сочетания таких продуктов, как гранат и пробиотики, могут оказывать комбинированное воздействие на здоровье.

Тогда гранат и пробиотики, такие как штамм LGG, могут внести свой вклад в разработку новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Вклад авторов

VS, LV, CR, CC, FR и GB собрали исследовательские статьи, разработали эксперименты, проанализировали результаты и написали рукопись. CR, MR, SF и NT проводили эксперименты.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Ссылки

  • Аль-Зореки Н.С. (2009). Антимикробная активность кожуры плодов граната ( Punica granatum L.). Внутр. J. Food Microbiol. 134 244–248. 10.1016 / j.ijfoodmicro.2009.07.002 [PubMed] [CrossRef] [Google Scholar]
  • Армани А., Мамми К., Марцолла В., Каланчини М., Антелми А., Розано Г. М. и др. (2010). Клеточные модели для понимания адипогенеза, дисфункции жировой ткани и ожирения. J. Cell Biochem. 110 564–572.10.1002 / jcb.22598 [PubMed] [CrossRef] [Google Scholar]
  • Барбагалло И., Ли Вольти Г., Сорренти В., Ди Джакомо К., Аквавива Р., Раффаэле М. и др. (2017). Фенетиловый эфир кофейной кислоты восстанавливает экспрессию гена адипоцитов после обработки липополисахаридом. Lett. Drug Des. Discov. 14 481–487. 10.2174 / 15701808136661604707 [CrossRef] [Google Scholar]
  • Бассири-Джахроми С. (2018). Активность Punica granatum (граната) в укреплении здоровья и профилактике рака. Онкол. Сборка 12: 345. 10.4081 / онкол.2018.345 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Басу А., Пенугонда К. (2009). Гранатовый сок: фруктовый сок, полезный для сердца. Nutr. Сборка 67 49–56. 10.1111 / j.1753-4887.2008.00133.x [PubMed] [CrossRef] [Google Scholar]
  • Бергер Дж., Моллер Д. Э. (2002). Механизмы действия PPAR. Annu. Rev. Med. 53 409–435. 10.1146 / annurev.med.53.082901.104018 [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Касимсетти С. Г., Шредер К. К., Феррейра Д. (2009). Влияние побочных продуктов граната ( Punica granatum L.) и эллагитаннинов на рост кишечных бактерий человека. J. Agric. Food Chem. 57 год 8344–8349. 10.1021 / jf1b [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Рамнани П., Касимсетти С. Г., Мунта К. Р., Гибсон Г. Р., Феррейра Д. (2010). Влияние побочного продукта граната и пуникалагинов на отдельные группы кишечной микробиоты человека. Внутр.J. Food Microbiol. 140 175–182. 10.1016 / j.ijfoodmicro.2010.03.038 [PubMed] [CrossRef] [Google Scholar]
  • Брэдли Р. Л., Фишер Ф. Ф., Маратос-Флиер Э. (2008). Пищевые жирные кислоты по-разному регулируют продукцию TNF-альфа и IL-10 адипоцитами 3T3-L1 мышей. Ожирение 16 938–944. 10.1038 / обы.2008.39 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Карпен К., Пеженауте Х., Дель Мораль Р., Буле Н., Хихона Э., Андраде Ф. и др. (2018). Диетический антиоксидант пицеатаннол ингибирует адипогенез мезенхимальных стволовых клеток жировой ткани человека и ограничивает транспорт глюкозы и липогенную активность в адипоцитах. Внутр. J. Mol. Sci. 19: E2081. 10.3390 / ijms181 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Дхумал С., Карале А. Р., Джадхав С. Б., Кад В. П. (2014). Последние достижения и разработки в области обработки и использования граната: обзор. J. Agric. Crop Sci. 1 1–17. [Google Scholar]
  • Ди Джакомо К., Ванелла Л., Сорренти В., Сантанджело Р., Барбагалло И., Калабрезе Г. и др. (2015). Эффекты tithonia diversifolia (Hemsl.) A.Серый экстракт о дифференцировке адипоцитов мезенхимальных стволовых клеток человека. PLoS One 10: e0122320. 10.1371 / journal.pone.0122320 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Фаволе О. А., Макунга Н. П., Опара Ю. Л. (2012). Метанольный экстракт кожуры плодов граната обладает антибактериальной, антиоксидантной и ингибирующей тирозиназой активностью. BMC Дополнение. Альтерн. Med. 12: 200. 10.1186 / 1472-6882-12-200 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Fischer U.А., Карл Р., Каммерер Д. Р. (2011). Идентификация и количественное определение фенольных соединений из кожуры граната ( Punica granatum L.), мезокарпа, арил и других соков с помощью HPLC-DAD-ESI / MS (n). Food Chem. 127 807–821. 10.1016 / j.foodchem.2010.12.156 [PubMed] [CrossRef] [Google Scholar]
  • Гил М. И., Томас-Барберан Ф. А., Хесс-Пирс Б., Холкрофт Д. М., Кадер А. А. (2000). Антиоксидантная активность гранатового сока и ее связь с фенольным составом и обработкой. J. Agric. Food Chem. 48 4581–4589. [PubMed] [Google Scholar]
  • Хоссин Ф. Л. А. (2009). Воздействие кожуры граната (Punica granatum) и его экстракта на крыс с ожирением и гиперхолестеринемией. Пак. J. Nutr. 8 1251–1257. 10.3923 / pjn.2009.1251.1257 [CrossRef] [Google Scholar]
  • Цзян Л., Чжан Н. X., Мо В., Ван Р., Ма К. Г., Ли X. и др. (2008). Ремания подавляет дифференцировку адипоцитов и адипогенез. Biochem. Биофиз. Res. Commun. 371 185–190.10.1016 / j.bbrc.2008.03.129 [PubMed] [CrossRef] [Google Scholar]
  • Кавада Т., Такахаши Н., Фушики Т. (2001). Биохимические и физиологические характеристики жировой клетки. J. Nutr. Sci. Витаминол. 47 1–12. [PubMed] [Google Scholar]
  • Кершоу Э. Э., Флиер Дж. С. (2004). Жировая ткань как эндокринный орган. J. Clin. Эндокринол. Метаб. 89 2548–2556. 10.1210 / jc.2004-0395 [PubMed] [CrossRef] [Google Scholar]
  • Ким С. Х., Плутцки Дж. (2016). Бурый жир и потемнение для лечения ожирения и связанных с ним нарушений обмена веществ. Diabetes Metab. J. 40 12–21. 10.4093 / dmj.2016.40.1.12 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лай С., Цай М. Л., Бадмаев В., Хименес М., Хо К. Т., Пан М. Х. (2012). Ксантиген подавляет дифференцировку преадипоцитов и адипогенез за счет подавления PPARgamma и C / EBP и модуляции путей SIRT-1, AMPK и FoxO. J. Agric. Food Chem. 60 1094–1101. 10.1021 / jf204862d [PubMed] [CrossRef] [Google Scholar]
  • Ли К.Дж., Чен Л. Г., Лян В. Л., Ван К. С. (2010). Противовоспалительное действие punica granatum Linne in vitro и in vivo. Food Chem. 118 315–322. [Google Scholar]
  • Лефтерова М. И., Лазарь М. А. (2009). Новые разработки в адипогенезе. Trends Endocrinol. Метаб. 20 107–114. 10.1016 / j.tem.2008.11.005 [PubMed] [CrossRef] [Google Scholar]
  • Лес Ф., Арбонес-Майнар Дж. М., Валеро М. С., Лопес В. (2018). Полифенолы граната и уролитин А ингибируют альфа-глюкозидазу, дипептидилпептидазу-4, липазу, накопление триглицеридов и гены, связанные с адипогенезом, в адипоцитоподобных клетках 3T3-L1. J. Ethnopharmacol. 220 67–74. 10.1016 / j.jep.2018.03.029 [PubMed] [CrossRef] [Google Scholar]
  • Ли Ю. Ф., Го К. Дж., Ян Дж. Дж., Вэй Дж. Ю., Сюй Дж., Ченг С. (2006). Оценка антиоксидантных свойств экстракта кожуры граната по сравнению с экстрактом мякоти граната. Food Chem. 96 254–260. [Google Scholar]
  • Ли З., Сумманен П. Х., Комория Т., Хеннинг С. М., Ли Р. П., Карлсон Э. и др. (2015). Эллагитаннины граната стимулируют рост кишечных бактерий in vitro: влияние на пребиотические и метаболические эффекты. Анаэроб 34 164–168. 10.1016 / j.anaerobe.2015.05.012 [PubMed] [CrossRef] [Google Scholar]
  • Лин Л. Т., Чен Т. Ю., Лин С. С., Чунг С. Ю., Лин Т. К., Ван Г. Х. и др. (2013). Противовирусная активность широкого спектра хебулаговой кислоты и пуникалагина против вирусов, которые используют гликозаминогликаны для проникновения. BMC Microbiol. 13: 187. 10.1186 / 1471-2180-13-187 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Lira F. S., Rosa J. C., Pimentel G. D., Seelaender M., Дамасо А. Р., Ояма Л. М. и др. (2012). И адипонектин, и интерлейкин-10 ингибируют LPS-индуцированную активацию пути NF-kappaB в адипоцитах 3T3-L1. Цитокин 57 год 98–106. 10.1016 / j.cyto.2011.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Лю Ю., Сюй Д., Инь С., Ван С., Ван М., Сяо Ю. (2018). Уровень IL-10 / STAT3 снижается при детском ожирении с гипертриглицеридемией и связан с уровнем триглицеридов у крыс с ожирением, вызванным диетой. BMC Endocr. Disord. 18:39.10.1186 / s12902-018-0265-z [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Moon Y. J., Soh J. R., Yu J. J., Sohn H. S., Cha Y. S., Oh S. H. (2012). Эффект ингибирования внутриклеточного накопления липидов Weissella koreensis OK1-6, выделенного из Kimchi, на дифференцирующиеся адипоциты. J. Appl. Microbiol. 113 652–658. 10.1111 / j.1365-2672.2012.05348.x [PubMed] [CrossRef] [Google Scholar]
  • Мосети Д., Регасса А., Ким В. К. (2016). Молекулярная регуляция адипогенеза и потенциальные антиадипогенные биоактивные молекулы. Внутр. J. Mol. Sci. 17: E124. 10.3390 / ijms17010124 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Нейринк А. М., Ван Хи В. Ф., Биндельс Л. Б., Де Бакер Ф., Кани П. Д., Делзен Н. М. (2013). Богатый полифенолами экстракт кожуры граната снимает воспаление тканей и гиперхолестеринемию у мышей с ожирением, вызванных диетой с высоким содержанием жиров: потенциальное влияние на микробиоту кишечника. Br. J. Nutr. 109 802–809. 10.1017 / S0007114512002206 [PubMed] [CrossRef] [Google Scholar]
  • Палмери Р., Монтелеоне Дж. И., Спанья Г., Рестучча К., Раффаэле М., Ванелла Л. и др. (2016). Экстракт оливковых листьев сицилийского сорта уменьшал накопление липидов, вызывая термогенный путь во время адипогенеза. Фронт. Pharmacol. 7: 143. 10.3389 / fphar.2016.00143 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Panichayupakaranant P., Tewtrakul S., Yuenyongsawad S. (2010). Антибактериальное, противовоспалительное и противоаллергическое действие стандартизированного экстракта кожуры граната. Food Chem. 123 400–403. 10.1055 / s-0030-1264706 [CrossRef] [Google Scholar]
  • Парк Дж. Э., О С. Х., Ча Ю. С. (2014). Lactobacillus brevis OPK-3, выделенный из кимчи, подавляет адипогенез и оказывает противовоспалительное действие в адипоцитах 3T3-L1. J. Sci. Продовольственное сельское хозяйство. 94 2514–2520. 10.1002 / jsfa.6588 [PubMed] [CrossRef] [Google Scholar]
  • Ку В., Брекса III А. П., Пан З., Ма Х. (2012). Количественное определение основных составляющих полифенолов в продуктах из граната. Food Chem. 132 1585–1591. 10.1016 / j.foodchem.2011.11.106 [PubMed] [CrossRef] [Google Scholar]
  • Раффаэле М., Барбагалло И., Ликари М., Карота Г., Сферраццо Г., Спампинато М. и др. (2018). N-ацетилцистеин (NAC) улучшает липидную метаболическую дисфункцию в адипоцитах, происходящих из стромальных клеток костного мозга. Evid. На основе дополнения. Альтерн. Med. 2018: 9. 10.1155 / 2018/5310961 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Редди М. К., Гупта С.К., Джейкоб М. Р., Хан С. И., Феррейра Д. (2007). Антиоксидантное, противомалярийное и противомикробное действие богатых танинами фракций, эллагитаннинов и фенольных кислот из Punica granatum L. Planta Med. 73 461–467. 10.1055 / с-2007-7 [PubMed] [CrossRef] [Google Scholar]
  • Ромео Ф. В., Баллистрери Г., Фаброни С., Пангалло С., Никосия М. Г., Шена Л. и др. (2015). Химическая характеристика различных экстрактов сумаха и граната, эффективных против гнили Botrytis cinerea. Молекулы 20 11941–11958. 10,3390 / молекул 200711941 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Розен Э. Д., Уолки К. Дж., Пуигсервер П., Шпигельман Б. М. (2000). Транскрипционная регуляция адипогенеза. Genes Dev. 14 1293–1307. [PubMed] [Google Scholar]
  • Салерно Л., Модика М. Н., Ромео Г., Питтала В., Сиракуза М. А., Амато М. Э. и др. (2012). Новые ингибиторы синтазы оксида азота с антиоксидантными свойствами. Eur.J. Med. Chem. 49 118–126. 10.1016 / j.ejmech.2012.01.002 [PubMed] [CrossRef] [Google Scholar]
  • Синглтон В. Л., Ортофер Р., Ламуэла-Равентос Р. М. (1999). Анализ общих фенолов и других субстратов окисления и антиоксидантов с помощью реактива Фолина – Чокальто. Methods Enzymol. 299 152–178. 10.1016 / S0076-6879 (99) 99017-1 [CrossRef] [Google Scholar]
  • Смит К. Б., Смит М. С. (2016). Статистика ожирения. Prim Care 43 год 121–135. 10.1016 / j.поп.2015.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Стечшульте Л. А., Хайндс Т. Д., мл., Худер С. С., Шоу В., Наджар С. М., Санчес Э. Р. (2014). FKBP51 контролирует клеточный адипогенез посредством опосредованного p38 киназой фосфорилирования GRalpha и PPARgamma. Мол. Эндокринол. 28 год 1265–1275. 10.1210 / мне.2014-1022 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Su X., Howell A. B., D’Souza D. H. (2012). Антибактериальные эффекты растительных экстрактов на устойчивый к метициллину Staphylococcus aureus. Патогенные микроорганизмы пищевого происхождения. Дис. 9 573–578. 10.1089 / fpd.2011.1046 [PubMed] [CrossRef] [Google Scholar]
  • Табаско Р., Санчес-Патан Ф., Монагас М., Бартоломе Б., Виктория Морено-Аррибас М., Пелаез К. и др. (2011). Влияние полифенолов винограда на рост молочнокислых бактерий и бифидобактерий: устойчивость и метаболизм. Food Microbiol. 28 год 1345–1352. 10.1016 / j.fm.2011.06.005 [PubMed] [CrossRef] [Google Scholar]
  • Тегеранифар А., Селахварзи Ю., Харрази М., Бахш В.J. (2011). Высокий потенциал побочных продуктов агропромышленного производства граната ( Punica granatum L.) как мощных противогрибковых и антиоксидантных веществ. Ind. Сельскохозяйственная продукция 34 1523–1527. 10.1016 / j.indcrop.2011.05.007 [CrossRef] [Google Scholar]
  • Ванелла Л., Барбагалло И., Аквавива Р., Ди Джакомо К., Кардил В., Абрахам Н. Г. и др. (2013a). Эллаговая кислота: цитодифференцирующие и антипролиферативные эффекты в клеточных линиях рака предстательной железы человека. Curr. Pharm.Des. 19 2728–2736. [PubMed] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Кардил В., Ким Д. Х. и др. (2013b). Маркеры апоптоза в клеточной линии рака простаты: эффект эллаговой кислоты. Онкол. Реп. 30 2804–2810. 10.3892 / или 2013.2757 [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Ли Вольти Г., Кардил В. и др. (2013c). Влияние эллаговой кислоты на ангиогенные факторы в клетках рака простаты. Раки 5 726–738. 10.3390 / раки5020726 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Сэнфорд К., мл., Ким Д. Х., Абрахам Н. Г., Эбрахейм Н. (2012). Окислительный стресс и гемоксигеназа-1 регулируют дифференцировку мезенхимальных стволовых клеток человека. Внутр. J. Hypertens. 2012: 8. 10.1155 / 2012/8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Waldman M., Bellner L., Vanella L., Schragenheim J., Sodhi K., Singh S.P., et al. (2016). Эпоксиэйкозатриеновые кислоты регулируют дифференцировку адипоцитов клеток 3T3 мыши посредством активации PGC-1alpha, которая необходима для экспрессии HO-1 и увеличения функции митохондрий. Stem Cells Dev. 25 1084–1094. 10.1089 / scd.2016.0072 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ван Ю. В., Джонс П. Дж. (2004). Конъюгированная линолевая кислота и контроль ожирения: эффективность и механизмы. Внутр. J. Obes. Relat. Метаб. Disord. 28 год 941–955.10.1038 / sj.ijo.0802641 [PubMed] [CrossRef] [Google Scholar]
  • Сюй К. З., Чжу К., Ким М. С., Ямахара Дж., Ли Ю. (2009). Цветок граната уменьшает ожирение печени у животных с диабетом 2 типа и ожирением. J. Ethnopharmacol. 123 280–287. 10.1016 / j.jep.2009.03.035 [PubMed] [CrossRef] [Google Scholar]

Положительное влияние экстракта кожуры граната и пробиотиков на преадипоцитную дифференцировку

Front Microbiol. 2019; 10: 660.

Валерия Сорренти

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Cinzia Lucia Randazzo

2 Dipaziena Di мы Università di Catania, Катания, Италия

Cinzia Caggia

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

Gabriele Ballistreri

) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Флора Валерия Ромео

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Симона Фаброни

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок и цитрусовых and Tree Fruit, Ачиреале, Италия

Николина Тимпанаро

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливковых, цитрусовых и древесных фруктов, Ачиреале, Италия

Марко Рафаэле

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Luca Vanella

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия , Италия Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

3 Совет по сельскохозяйственным исследованиям и исследованиям в области сельского хозяйства Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Под редакцией: Розальба Ланчотти, Болонский университет, Италия 90 003

Рецензент: Анна Реале, Институт науки и технологий (ISA), Италия; Коши Филип, Малайский университет, Малайзия

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы микробиологии»

Поступила в редакцию 22 октября 2018 г .; Принята в печать 15 марта 2019 г.

Авторские права © 2019 Сорренти, Рандаццо, Каджия, Баллистрери, Ромео, Фаброни, Тимпанаро, Раффаэле и Ванелла.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Благоприятные эффекты граната обусловлены содержанием эллагитаннинов и антоцианов, которые защищают от множества заболеваний, включая воспалительные. Многие исследователи сообщают, что экстракты отходов граната (кожуры и семян), полученные из отходов промышленной переработки, обладают акцептором свободных радикалов и обладают мощной антиоксидантной способностью. Экстракты граната (ПЭ) также обладают антибактериальной, противовирусной, гиполипидемической и противовоспалительной биоактивностью благодаря содержанию полифенольных соединений, включая пуникалагины, галловую кислоту и производные эллаговой кислоты.В центре внимания данной рукописи было изучение пребиотического потенциала PE, растворимого в воде и охарактеризованного с помощью HPLC – PDA – ESI / MS n на предмет его фенольного содержания. Более того, поскольку сообщалось, что экстракты граната снижали уровень липидов в крови и что было показано, что ряд пробиотических штаммов влияет на адипогенез в культуре клеток, это исследование также было выполнено для проверки in vitro эффектов PE и пробиотик L.rhamnosus GG ATCC 53103 (LGG) на линии клеток 3T3-L1. PE и пробиотики существенно снижали содержание триглицеридов и увеличение внутриклеточных липидов по сравнению с контрольной группой. Однако комбинированная обработка отработанного бульона (SB), фильтрованного через PE и LGG, была наиболее эффективной в снижении содержания триглицеридов и накопления внутриклеточных липидов. Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно ниже в клетках 3T3-L1, обработанных PE и SB, отфильтрованных через LGG.Эти результаты свидетельствуют о том, что синергетический эффект пробиотиков и полифенолов, содержащихся в PE, может повлиять на адипогенез in vitro, и может способствовать разработке новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Ключевые слова: лактобацилл, антимикробная активность, экстракт граната, дифференциация адипоцитов, комбинирование продуктов

Введение

Гранат — это фрукт, положительное влияние на здоровье которого было тщательно изучено.Этот фрукт богат биологически активными соединениями, такими как эллагитаннины и антоцианы, которые защищают от дегенеративных заболеваний. Плод граната из-за его высокой питательной ценности, пользы для здоровья и биоактивных антиоксидантных соединений считается пищевым лекарством. Фактически, гранат широко используется в фитотерапии при нескольких патологиях, включая грипп и инфекции верхних дыхательных путей. Все части плодов граната, то есть кожура и семена, рассматриваемые как отходы, могут быть переработаны для получения продуктов с добавленной стоимостью, имеющих промышленную, медицинскую и косметическую ценность (Dhumal et al., 2014).

Отходы граната образуются на всех этапах жизненного цикла плодов, то есть во время сельскохозяйственного производства, промышленного производства и переработки. Можно использовать побочные продукты граната, поскольку они являются богатым источником биологически активных соединений, таких как флавоноиды, фенольные кислоты и дубильные вещества. Более того, многие исследователи описали, что экстракты граната, изготовленные из побочных продуктов перерабатывающих предприятий, обладают эффективным улавливанием свободных радикалов и антиоксидантной способностью (Lee et al., 2010; Panichayupakaranant et al., 2010; Fischer et al., 2011).

Кроме того, экстракты граната действуют как естественные ингибиторы патогенов, бактерий и грибков (Al-Zoreky, 2009; Tehranifar et al., 2011; Romeo et al., 2015).

Эллагитаннины граната гидролизуются микробиотой кишечника до более мелких фенольных соединений, таких как эллаговая кислота. Затем эллаговая кислота всасывается в кровоток, в то время как эллагитаннины не всасываются и метаболизируются в уролитины.

Сообщалось, что побочные продукты граната и пуникалагины в значительной степени способны подавлять рост патогенных Escherichia coli , Pseudomonas aeruginosa , Clostridia и Staphylococcus aureus (Reddy et al., 2007; Bialonska et al., 2009) и для увеличения роста полезных бактерий, включая Bifidobacterium spp. и Lactobacillus spp. (Reddy et al., 2007; Bialonska et al., 2010).

Экстракты граната также снижают уровень липидов в крови и обладают значительной противоопухолевой, противовирусной и противовоспалительной активностью (Li et al., 2006; Hossin, 2009; Lin et al., 2013; Bassiri- Джахроми, 2018).

Эти потенциальные полезные эффекты приписываются полифенольным соединениям, которые содержатся в экстрактах граната, включая пуникалагины, галловую кислоту и производные эллаговой кислоты (Vanella et al., 2013а, б, в; Romeo et al., 2015).

Поскольку ожирение является одной из основных проблем общественного здравоохранения, необходимы новые превентивные стратегии (Smith and Smith, 2016).

Адипоциты играют важную роль в начале или развитии метаболических осложнений, связанных с ожирением, таких как метаболический синдром и диабетические осложнения (Kim and Plutzky, 2016).

Интерес исследователей к выявлению натуральных продуктов, полученных из диетических растений, обладающих активностью против ожирения, возрос.Сообщалось, что ксантиген и фукоксантин, природные соединения масла косточек граната, значительно подавляли дифференцировку адипоцитов и накопление липидов (Lai et al., 2012).

Настоящая рукопись посвящена прежде всего изучению антиоксидантной и антимикробной активности, а также пребиотического потенциала ПЭ, богатого фенольными соединениями. Более того, обогащенный стандартизованный полиэтилен, содержащий высокий процент природных антиоксидантов граната, был химически охарактеризован с помощью ВЭЖХ – PDA – ESI / MSn.Во-вторых, поскольку гранатовый сок (Les et al., 2018) и различные типы экстрактов граната (PE), включая экстракт, полученный из цельного фрукта (Li et al., 2015), и экстракт, полученный из кожуры граната (Neyrinck et al., 2013), и было показано, что ряд пробиотических штаммов (Moon et al., 2012; Park et al., 2014) влияют на адипогенез, это исследование было проведено для проверки in vitro эффектов PE, пробиотика L rhamnosus GG ATCC 53103 (LGG), предварительно инкубированные с PE, отдельно или в комбинации, при дифференцировке клеток 3T3-L1.

Материалы и методы

Химические вещества

Порошкообразный экстракт граната (Dermogranate ® ), использованный в этом исследовании, был предоставлен Medinutrex (Катания, Италия). Вкратце, экстракт готовили из сушеных и измельченных плодов граната, смешанных с водно-спиртовыми растворами (пищевой), а затем фильтровали. Фильтрат концентрировали и затем сушили распылением для получения стандартизованного экстракта. Экстракт Dermogranate ® имел следующий химический состав: общие полифенолы (16%), пуникалагины (8%), эллаговая кислота и производные (8%).

Реагент Фолина – Чокальтеу (FCR), карбонат натрия (Na 2 CO 3 ), галловая кислота, пуникалин (смесь аномеров), пуникалагин и эллаговая кислота были приобретены у Sigma-Aldrich (Милан, Италия). Гранатин Б был приобретен у LGC Standards (Лондон, Великобритания). Для хроматографии использовали растворители степени чистоты для ВЭЖХ – МС (Merck KgaA, Дармштадт, Германия), а все остальные реагенты были аналитической чистоты.

Определение общего содержания полифенолов

Анализ Folin – Ciocalteu (Singleton et al., 1999) был использован для определения общего содержания полифенолов с небольшими модификациями. 0,1 мг / мл экстракта растворяли в дистиллированной воде. Затем к 500 мкл образца добавляли 5 мл 10% FCR и 4,5 мл раствора Na 2 CO 3 (7,5% мас. / Об.). Конечный раствор перемешивали в течение 2 часов в темноте, а затем измеряли Abs при λ = 765 нм. Анализы проводили в трех экземплярах, и общую концентрацию полифенолов выражали в граммах эквивалентов галловой кислоты (GAE) / 100 г экстракта.

HPLC – PDA – ESI / MS

n Анализ фенольных соединений

Разделение и количественное определение фенольных соединений выполняли, как описано ранее (Romeo et al., 2015). Для идентификации фенольных соединений времена удерживания (RT), спектры и данные МС в режиме отрицательного ESI сравнивали с данными аутентичных стандартов. Количественное определение каждого фенольного соединения проводили с использованием соответствующего стандарта в качестве внешнего стандарта. Количественное определение галловой кислоты проводили при 280 нм.Пуникалины, гранатин В, пуникалагины и эллаговая кислота определялись количественно при 378 нм; та же длина волны использовалась для количественного определения производных эллаговой кислоты с использованием эллаговой кислоты в качестве стандарта сравнения. Анализы проводили в трех экземплярах, и результаты выражали в г соединения / 100 г экстракта.

Тушение DPPH

Способность улавливать свободные радикалы различных концентраций экстракта PE (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) измеряли по 2, Безрадикальный метод 2-дифенил-1-пикрилгидразилгидрата (DPPH), как сообщалось ранее (Salerno et al., 2012). Результаты выражены в процентах от степени ингибирования ± SD .

Влияние поглотителя на супероксид-анион

Способность экстракт ПЭ различных концентраций улавливать супероксид-анион (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) определялась как сообщалось ранее (Салерно и др., 2012). Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Мышиные преадипоциты 3T3-L1 Жизнеспособность клеток

Мышиные преадипоциты 3T3-L1 были приобретены в Американской коллекции типовых культур (Роквилл, Мэриленд, США).Клетки высевали в концентрации 2 × 10 5 клеток на лунку 96-луночного микропланшета и культивировали при 37 ° C в инкубаторе с 5% CO 2 в течение 48 часов в отсутствие и в присутствии различных концентраций ЧП сообщалось выше. Жизнеспособность клеток измеряли с помощью анализа МТТ, как сообщалось ранее (Di Giacomo et al., 2015). МТТ, желтый тетразол, в живых клетках восстанавливается до пурпурного формазана. Результаты выражены в процентах формазана, продуцированного в обработанных мышиных преадипоцитах 3T3-L1 по сравнению с необработанными клетками.

Микробиология

Бактериальное культивирование

Использовали коммерческие штаммы патогенов E. coli ATCC 25922, S. aureus ATCC 29213, Listeria innocua ATCC 33090 и Salmonella enterica ATCC 14028. Штамм E. coli выращивали в бульоне Лурия-Бертани (LB) при 37 ° C в течение ночи; S. aureus , S. enterica и L. innocua обычно выращивали в течение ночи в триптон-соевом бульоне (TSB) при 37 и 30 ° C соответственно.Все материалы и приложения предоставлены Oxoid (Милан, Италия).

Коммерческие пробиотические штаммы LGG, Bifidobacterium animalis BB12, B. longum BB536 и дикий штамм Lactobacillus paracasei N 24, выделенные из кротонского сыра пекорино, культивировали в бульоне Демана – Рогоза – Шарпа (MRS). при 37 ° C в течение ночи.

Ночные бактериальные культуры инкубировали при 37 ° C в течение 24 часов в анаэробных условиях, пока они не достигли плотности клеток приблизительно 1.0 × 10 9 КОЕ / мл.

Определение скорости роста

На основании результатов, полученных по активности PE в качестве акцептора свободных радикалов, и экспериментов по жизнеспособности преадипоцитов мышей 3T3-L1, для обработки штаммов пробиотиков или патогенов, как описано ниже, использовали различные концентрации.

Антимикробная активность PE оценивалась против коммерческих штаммов патогенов, упомянутых выше. Ночные культуры патогенов совместно культивировали при 37 ° C в течение 24 ч с PE в различных концентрациях (1.7–0,34–0,17 мг / мл), а антимикробную активность оценивали подсчетом живых бактерий на чашках и выражали в КОЕ / мл.

Влияние PE на рост пробиотических штаммов, упомянутых выше, оценивали при совместном культивировании пробиотических штаммов с плотностью клеток приблизительно 1,0 × 10 9 КОЕ / мл с PE в различных концентрациях (0,085–0,042– 0,028 мг / мл). Влияние экстракта на рост пробиотических штаммов оценивали после инкубации при 37 ° C в течение 24 часов в анаэробных условиях путем посева живых бактерий и выражали в КОЕ / мл.

Все эксперименты проводились в двух экземплярах, а результаты выражались в виде средних значений и стандартного отклонения. Основываясь на предварительных результатах, для последующего анализа была выбрана LGG.

Свежие бульонные культуры центрифугировали при 5000 об / мин в течение 10 минут при 4 ° C, супернатант декантировали для сбора отработанного бульона (SB), который фильтровали (FSB) с использованием фильтра 0,22 мкм и затем использовали для дальнейшего использования. анализы.

Бактериальный осадок ресуспендировали в 1 мл PBS и пять раз обрабатывали ультразвуком с амплитудой 44% в течение 2 мин с 6 мин отдыха.Затем обработанный ультразвуком центрифугировали при 1100 × g в течение 15 мин при 4 ° C. Супернатант собирали, фильтровали через фильтр 0,22 мкм и меченный экстракт бактериальных клеток (CE). CE использовался для дальнейшего анализа.

Культура клеток и дифференцировка клеток адипоцитов

Преадипоциты мышей 3T3-L1 ресуспендировали в среде Игла, модифицированной Дульбекко (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS, Invitrogen, Карлсбад, Калифорния, США) и 1% антибиотика. / антимикотический раствор (Invitrogen, Карлсбад, Калифорния, США) и высевали в колбу размером 75 см 2 при плотности от 1 до 2 × 10 4 клеток.Дифференцировку клеток адипоцитов получали, как сообщалось ранее (Waldman et al., 2016).

Дифференцирующиеся преадипоциты 3T3-L1 обрабатывали в течение 7 дней PE (0,028 мг / мл), LGG CE (25 мкг / мл) и SB, профильтрованным через LGG (10 мкг / мл) из ночной бактериальной культуры, инкубированной с или без ПЭ (0,028 мг / мл).

Количественное определение содержания липидов

Для количественной оценки накопления липидов проводили масляное красное окрашивание, как сообщалось ранее (Barbagallo et al., 2017). Образование липидных капель измеряли с помощью инвертированного многоканального светодиодного флуоресцентного микроскопа (Evos, Life Technologies, Гранд-Айленд, Нью-Йорк, США).

Экстракция

РНК и qRT-PCR

Экспрессии адипонектина, PPAR-γ, SREBP, FAS, IL-6 и IL-10 оценивали с помощью ПЦР в реальном времени. РНК экстрагировали и количественно оценивали, как сообщалось ранее (Raffaele et al., 2018). Использовали соответствующие последовательности праймеров (). Относительный уровень экспрессии мРНК измеряли по значению порогового цикла (Ct) каждого продукта ПЦР и нормализовали с таковым для GAPDH с использованием сравнительного метода 2 -ΔΔCt .

Таблица 1

Праймеры для ПЦР, использованные в этом исследовании.

Gene Прямой праймер Обратный праймер
Адипонектин GAAGCCGCTTATGTGTATCGC GAATGGGTACATTGGGAACAGT
IL-6 TTCCTCTCTGCAAGAGACTTCC AGGAGAGCATTGGAAATTGGGG
FAS GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
GAPDH AGCTTCGGCACATATTTCATCTG CGTTCACTCCCATGACAAACA
IL-10 GCTGGACAACATACTGCTAACC ATTTCCGATAAGGCTTGGCAA
SREBP-1 GATGTGCGAACTGGACACAG CATAGGGGGCGTCAAACAG
PPAR-γ TCGCTGATGCACTGCCTATG ACCTGATGGCATTGTGAGACAT

Статистический анализ

Статистический анализ множественных сравнений был выполнен e Метод Фишера. P — значения ниже 0,05 были приняты как значимые. Данные были проанализированы с использованием либо однофакторного дисперсионного анализа (ANOVA) для нескольких групп, либо непарного t -теста для двух групп, и результаты представлены в виде среднего значения ± стандартное отклонение.

Результаты

HPLC – PDA – ESI / MS

n Анализ PE

Фенольный профиль PE () включал определение 1 гидроксибензойной кислоты и 19 эллагитаннинов. Основные пики соответствовали пуникалину (пик 4), гранатину B (пик 6), пуникалагину A и B (пики 10 и 14) и эллаговой кислоте (пик 19) ().Выявлено также присутствие галловой кислоты (пик 1) и производных эллаговой кислоты (пики 2, 3, 5, 7–9, 11–13, 15–18, 20). Как показано на хроматограмме, эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожуры), поскольку они составляют более 99% от общего содержания фенольных соединений граната. Пуникалагины, основные эллагитаннины побочных продуктов граната, составляли 47,6% от общего содержания фенольных соединений в ПЭ (). Производные эллаговой кислоты, эллаговая кислота и другие второстепенные фенольные соединения (пуникалин, гранатин B и галловая кислота) составили 38.4, 10,2 и 3,8% от общего содержания фенолов в ПЭ соответственно ().

ВЭЖХ-хроматограмма фенольных соединений ПЭ, обнаруженных при 378 нм. Об идентификации пиков см.

Таблица 2

Список пиков и количественное определение фенольных соединений в ПЭ.

0,07 0,07 966 9,5 9 9278 9027 301 9027 0,027 603 603 Ead d 8 9278 9027 0278 9027 9027 0278 9 9027 35,4 Ead d 902 7.82 фенол
Номер пика a RT (мин) λ (нм) [M – H] ( м / z ) MS n ( m / z ) Фенольные соединения г / 100 г b
1 3.9 269,310 169 125 Кислота галловая 0,07 ± 0,02
2 4,1 255,364 301 301 3 7,0 255,363 301 Ead ​​ d 0,41 ± 0,04
4 7,3 263,364403 9027 601 9027 9027 9027 P 263,36440727 ± 0,04
5 8,4 264,366 301 Ead ​​ d 0,19 ± 0,09
6
Гранатин В 0,28 ± 0,03
7 10,4 259,361 301 Ead ​​ d 0,02 ± 0,01 257,360 301 Ead ​​ d 0,05 ± 0,01
9 13,5 256,362
10 14,0 258,378 1083 781/601 Пуникалагин А 3,05 ± 0,05
11 15,1
15,1
0.13 ± 0,09
12 15,9 257,361 301 Ead ​​ d 0,95 ± 0,03
13
2,69 ± 0,11
14 17,7 257,378 1083 781/601 Пуникалагин B 4,77 ± 0,21 4,77 ± 0,21 257,362 301 Ead ​​ d 0,12 ± 0,01
16 25,2 256,363
17 29,3 254,361 301 Ead ​​ d 0,17 ± 0,01
18 32,2 32,2
0.08 ± 0,03
19 33,6 256,367 301 229/185 Эллаговая кислота 1,68 ± 0,01
20 9027
0,08 ± 0,02
Всего полифенолов c 16,48 ± 2,49
Производные эллаговой кислоты 6,31
Эллаговая кислота 0,62
Всего 16.43

Масс-спектрометрические свойства 20 идентифицированных фенольных соединений (пики 1–20) показаны на рис. Как сообщалось ранее (Romeo et al., 2015), наблюдались две изомерные формы (A и B) пуникалагинов (пики 10 и 14), а также было подчеркнуто присутствие гранатина B (пик 6). Кроме того, эти соединения также были охарактеризованы прямым анализом отрицательных ионов для инфузии ESI / MS n стандартных соединений.Пик 4 был идентифицирован как пуникалин ( m / z 781), тогда как пики 2, 3, 5, 7–9, 11–13, 15–18 и 20 были идентифицированы как производные эллаговой кислоты в соответствии с их УФ – видимой областью и массой. характеристики (λ max около 370 нм и фрагмент MS 1 на мкм / z 301, соответствующий эллаговой кислоте).

Активность PE по улавливанию свободных радикалов

Антиоксидантная активность PE проверялась по их способности восстанавливать стабильный радикал DPPH.

В частности, процент ингибирования DPPH достигал 75% при концентрациях ниже 0.21 мг / мл (76,78, 79 и 80% соответственно при концентрации ПЭ 0,17-0,11-0,085 и 0,028 мг / мл). При концентрациях выше 0,21 мг / мл процент ингибирования DPPH был ниже ().

Активность ПЭ по улавливанию радикалов DPPH в различных концентрациях. Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Экстракт граната ингибировал образование супероксид-аниона дозозависимым образом (). Как правило, в этом тесте PE оказался более эффективным, чем в предыдущем.Это может быть связано с меньшим размером супероксид-аниона по сравнению с радикалом DPPH.

Таблица 3

Активность по улавливанию супероксидных ионов при различных концентрациях ПЭ.

78 ± 2
концентрации PE % ингибирования концентрации PE % ингибирования
PE (3,4 мг / мл) 65 ± 2 PE (0,21 мг / мл)
PE (1,7 мг / мл) 73 ± 3 PE (0.17 мг / мл) 80 ± 1
PE (0,85 мг / мл) 75 ± 1 PE (0,11 мг / мл) 85 ± 3
PE (0,56 мг / мл ) 70 ± 2 PE (0,085 мг / мл 88 ± 4
PE (0,42 мг / мл) 68 ± 1 PE (0,028 мг / мл) 95 ± 1
PE (0,34 мг / мл) 75 ± 4

Влияние PE на жизнеспособность клеток 3T3-L1

3- (4,5-диметилтиазол ил) -2,5-дифенилтетразолийбромид (МТТ) проводили для оценки жизнеспособности клеток 3T3-L1.Результаты показывают значительное снижение жизнеспособности клеток при высоких концентрациях PE (3,4, 1,7, 0,85, 0,56 и 0,42 мг / мл), тогда как при более низких (0,34, 0,21, 0,17, 0,11 и 0,085 мг / мл) концентрациях наблюдается умеренная ингибирующий эффект и концентрация 0,028 мг / мл не оказали значительного влияния на жизнеспособность клеток преадипоцитов мышей 3T3-L1 ().

Процент выживаемости преадипоцитов мышей 3T3-L1 в присутствии PE в различных концентрациях. Результаты выражены как среднее значение ± стандартное отклонение четырех экспериментов, проведенных в трех повторностях.Значимые по сравнению с необработанными контролями: p <0,005; ∗∗ p <0,05.

Microbiology

Антимикробная активность PE в отношении штаммов патогенов

Данные анализа совместного культивирования показали, что патогены были по-разному чувствительны к PE. В деталях, как показано в, экстракт в концентрации 1,7 мг / мл показал наивысшую антимикробную активность против всех патогенов со значительным снижением на L. innocua (проксимально 4 log единицы).При концентрации 0,34 мг / мл экстракт был эффективен против E. coli , L. innocua и S. aureus , демонстрируя снижение плотности клеток на 1 и 2 log единицы соответственно. Когда PE тестировали при концентрации 0,17 мг / мл, штаммы S. aureus , S. enterica и L. innocua все еще подавлялись, в то время как рост E. coli не подвергался значительному влиянию.

Противомикробная активность PE различной концентрации в отношении патогенов, обнаруженных в T24 (24 ч инокулята).Плотность клеток выражается как Δlog КОЕ / мл.

Эффект PE на рост пробиотических штаммов

Результаты, показанные в, подчеркнули, что PE, при всех испытанных концентрациях, не обладал какой-либо ингибирующей активностью в отношении роста испытанных пробиотических штаммов. Небольшое увеличение роста наблюдалось для LGG, совместно культивируемых с PE в концентрации 0,028 мг / мл ().

Таблица 4

Количество бактерий, выраженное в логарифме 10 КОЕ / мл в трех повторностях ± стандартное отклонение L. rhamnosus GG ATCC 53103, Bifidobacterium animalis BB12, B.longum BB536 и дикий штамм Lactobacillus paracasei N 24 после инкубации с PE в различных концентрациях.

90CC3 ) 9027 a 9027 9027 9040 мг 9,57 ± 0,12 a
Журнал 10
L. rhamnosus GG Исходный уровень 8,83 ± 0,09 a

3

9,20 ± 0,10 b
PE (0.042 мг / мл) 9,24 ± 0,07 b
PE (0,028 мг / мл) 9,26 ± 0,04 b
Lactobacillus paracase8
Lactobacillus paracasei
N24 PE (0,085 мг / мл) 8,70 ± 0,08 a
PE (0,042 мг / мл) 8,79 ± 0,10
PE (0.028 мг / мл) 8,74 ± 0,09 a
Bifidobacterium animalis Исходный уровень 9,15 ± 0,05 a
BB40 0,12 a
PE (0,042 мг / мл) 9,44 ± 0,10 b
PE (0,028 мг / мл) 9,55 ± 0,07 9027 b Б.longum Исходный уровень 9,77 ± 0,03 a
BB536 PE (0,085 мг / мл) 9,54 ± 0,10 a
PE (0,028 мг / мл) 9,44 ± 0,16 a

Влияние полиэтилена и экстракта LGomenate на содержание липидов 9000Ggranate 9000Ggrana 9 фильтрованный SB значительно снизил содержание триглицеридов по сравнению с контрольной группой ().Однако эффект отфильтрованного SB, полученного из клеток, инкубированных с PE (LGG-T1) или без него (LGG-T0), был аналогичным. Одновременная обработка преадипоцитов мышей 3T3-L1 SB, отфильтрованным через PE и LGG, значительно снизила содержание триглицеридов по сравнению с обработкой только SB, отфильтрованного через LGG. Более того, эти данные свидетельствуют о том, что комбинированное лечение PE и LGG-T1 было наиболее эффективным для снижения содержания триглицеридов и накопления внутриклеточных липидов.

(A) Типичное масляное красное окрашивание O клеток 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE. (B) Содержание липидов определяли количественно с помощью окрашивания Oil Red O (среднее ± SD , p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с LGG T0 + PE).

Обработка преадипоцитов мышей 3T3-L1 клеточным экстрактом LGG (CE), полученным из клеток, инкубированных с PE (CE + PE) или без него (CE), не оказала влияния на накопление внутриклеточных липидов по сравнению с контрольной группой ( Контроль: ABS 490 нм = 0.200 ± 0,07; CE: ABS 490 нм = 0,187 ± 0,09; CE + PE = ABS 490 нм = 0,190 ± 0,05).

Влияние PE на адипогенные маркеры

Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно менее выражены в клетках 3T3-L1, обработанных SB, отфильтрованным через PE и LGG. В частности, PE, LGG-T0 и LGG-T1 были способны снижать уровни гена адипонектина, PPAR-γ, SREBP, FAS и IL-6 и повышать уровни гена IL-10 ().

(A – F) Анализ экспрессии генов с помощью qRT-PCR липогенного пути в клетках 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE.Результаты выражены в виде среднего значения ± стандартное отклонение четырех экспериментов, выполненных в трех повторностях ( * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с контролем. LGG T0 + PE).

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно снизила уровни экспрессии мРНК основных транскрипционных факторов, участвующих в адипогенезе, по сравнению с обработкой SB, отфильтрованных через LGG ( LGGT0 и LGGT1) отдельно ().

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно повысила уровни экспрессии мРНК IL10 по сравнению с обработкой только SB (LGGT0 и LGGT1), профильтрованных через LGG ( ). Более того, эти данные свидетельствуют о том, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10 (2).

Обсуждение

Благоприятные эффекты употребления плодов граната и / или сока вызвали значительный научный интерес (Basu and Penugonda, 2009).Многие исследователи сообщают, что полиэтилены, полученные из отходов перерабатывающих предприятий, обладают способностью улавливать свободные радикалы и обладают мощной антиоксидантной способностью (Panichayupakaranant et al., 2010; Fischer et al., 2011). ПЭ, использованный в настоящем исследовании, был растворим в воде и охарактеризован с помощью ВЭЖХ – PDA – ESI / MS n по содержанию фенолов и антоцианов. В соответствии с предыдущими сообщениями (Fischer et al., 2011; Qu et al., 2012; Romeo et al., 2015) эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожура), поскольку они составляют более 99% от общего содержания фенольных соединений граната.Основными эллагитаннинами побочных продуктов граната, а также продуктов из граната (фруктов и соков) являются пуникалагины (Gil et al., 2000; Fischer et al., 2011; Qu et al., 2012).

Экстракт граната содержит высокий процент фенольных соединений и проявляет антиоксидантную активность в зависимости от концентрации, как показано для анализа как DPPH, так и анализа поглощения супероксид-анионов.

Сообщалось, что диетические полифенолы растений способны избирательно модулировать рост чувствительных микроорганизмов (Tabasco et al., 2011). Экстракты растений обычно подавляют рост бактерий, но степень эффекта зависит от состава экстракта и типа бактериального штамма.

Результаты, полученные в условиях наших экспериментов, продемонстрировали, что высокие концентрации полифенолов граната оказывают противомикробное действие на некоторые штаммы патогенов, такие как L. innocua и S. aureus. Эти результаты согласуются с исследованиями Panichayupakaranant et al. (2010), Fawole et al.(2012) и Su et al. (2012).

Однако при концентрациях PE ниже 0,34 мг / мл, хотя не было обнаружено концентраций ингибирующей активности в отношении штаммов пробиотиков, оценивалось только небольшое увеличение роста LGG. Эти результаты не согласуются с исследованиями Li et al. (2015) и Neyrinck et al. (2013), которые продемонстрировали, что полифенолы граната потенциально могут работать как пребиотики.

Ожирение — это состояние, при котором накопление липидов приводит к расширению жировой ткани, которая действует как метаболический и эндокринный орган.Молекулярные механизмы, которые модулируют рост, дифференцировку и липогенез преадипоцитов жировых клеток, были предметом обширных исследований (Vanella et al., 2012; Stechschulte et al., 2014; Moseti et al., 2016; Palmeri et al., 2016; Waldman et al., 2016; Carpene et al., 2018).

Во время дифференцировки адипоцитов преадипоциты дифференцируются в зрелые адипоциты (Lefterova, Lazar, 2009). Повышенное накопление жира сильно коррелирует с количеством клеток и / или размером адипоцитов (Jiang et al., 2008).

Сообщалось, что степень ожирения связана с дифференцировкой преадипоцитов в адипоцитах и ​​с увеличением адипоцитов в жировой ткани (Wang and Jones, 2004).

Другие авторы сообщили, что PEs способны подавлять дифференцировку преадипоцитов и адипогенез и уменьшать жировую дистрофию печени у крыс с ожирением и диабетом 2 типа (Xu et al., 2009).

В соответствии с данными Moon et al. (2012) и Park et al. (2014) в наших экспериментальных условиях PE, LGG-T0 и LGG-T1 приводили к значительному снижению накопления липидов в клетках 3T3-L1 во время дифференцировки в адипоциты, предполагая, что PE, LGG-T0 и LGG-T1 способны подавлять дифференцировка адипоцитов.Однако обработка LGG-фильтрованным SB, полученным из клеток, инкубированных с PE (LGG-T1) или без (LGG-T1), была аналогичной. В наших экспериментальных условиях фактически не наблюдалось пребиотического эффекта, продемонстрированного другими авторами. Более того, комбинированное лечение PE и LGG-T1 было наиболее эффективным в снижении внутриклеточного накопления липидов. Эти данные демонстрируют, что, даже если в наших экспериментальных условиях не наблюдалось пребиотического эффекта, фильтрованный SB, полученный из LGG, инкубированного с PE (LGG-T1), мог бы содержать, помимо полезных бактериальных секретируемых биоактивных соединений, также небольшие количества PE- производные биоактивные соединения.Последний, присутствующий в небольших количествах в LGG-T1, не будет иметь более сильных положительных эффектов, чем LGG-T0, но в сочетании с PE может иметь потенциальные синергетические преимущества для здоровья.

Адипоцит-специфический рецептор, активируемый пролифератором пероксисом-γ (PPARγ), участвует в ранней стадии дифференцировки адипоцитов (Rosen et al., 2000), регулируя экспрессию адипогенных генов, таких как синтаза жирных кислот (FAS) и регуляторный элемент стерола. -связывающие белки (SREBP), а затем запускают накопление жира в клетках (Kawada et al., 2001; Бергер и Моллер, 2002).

Жировая ткань — это не только первичный резервуар жира, но и эндокринный орган, контролирующий гомеостаз липидов. Измененные уровни адипокинов жировой ткани могут способствовать развитию воспаления, что приводит к нарушению липидного обмена (Armani et al., 2010). При хроническом воспалении провоспалительные цитокины, такие как IL-6, активируются, тогда как противовоспалительные цитокины, такие как IL-10, подавляются (Kershaw and Flier, 2004; Bradley et al., 2008; Лира и др., 2012; Лю и др., 2018).

Наши результаты демонстрируют, что комбинированное лечение PE + LGG-T1 значительно снижает уровень мРНК адипонектина, FAS и IL-6 и повышает уровень IL-10.

Можно сделать вывод, что комбинированное лечение PE + LGG-T1 обладает противовоспалительными свойствами и способно ингибировать дифференцировку адипоцитов, модулируя уровни экспрессии ключевых факторов адипогенной транскрипции, участвующих в адипогенезе.

Заключение

SB, профильтрованный экстрактом граната и LGG, значительно снизил накопление внутриклеточных липидов.Наблюдали синергетический эффект пробиотиков и полифенолов, содержащихся в PE. Более того, наши результаты показали, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10.

Эти результаты свидетельствуют о том, что пробиотики и полифенолы, содержащиеся в ПЭ, могут влиять на адипогенез in vitro. Более того, наши результаты демонстрируют, что синергетические свойства сочетания таких продуктов, как гранат и пробиотики, могут оказывать комбинированное воздействие на здоровье.

Тогда гранат и пробиотики, такие как штамм LGG, могут внести свой вклад в разработку новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Вклад авторов

VS, LV, CR, CC, FR и GB собрали исследовательские статьи, разработали эксперименты, проанализировали результаты и написали рукопись. CR, MR, SF и NT проводили эксперименты.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Ссылки

  • Аль-Зореки Н.С. (2009). Антимикробная активность кожуры плодов граната ( Punica granatum L.). Внутр. J. Food Microbiol. 134 244–248. 10.1016 / j.ijfoodmicro.2009.07.002 [PubMed] [CrossRef] [Google Scholar]
  • Армани А., Мамми К., Марцолла В., Каланчини М., Антелми А., Розано Г. М. и др. (2010). Клеточные модели для понимания адипогенеза, дисфункции жировой ткани и ожирения. J. Cell Biochem. 110 564–572.10.1002 / jcb.22598 [PubMed] [CrossRef] [Google Scholar]
  • Барбагалло И., Ли Вольти Г., Сорренти В., Ди Джакомо К., Аквавива Р., Раффаэле М. и др. (2017). Фенетиловый эфир кофейной кислоты восстанавливает экспрессию гена адипоцитов после обработки липополисахаридом. Lett. Drug Des. Discov. 14 481–487. 10.2174 / 15701808136661604707 [CrossRef] [Google Scholar]
  • Бассири-Джахроми С. (2018). Активность Punica granatum (граната) в укреплении здоровья и профилактике рака. Онкол. Сборка 12: 345. 10.4081 / онкол.2018.345 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Басу А., Пенугонда К. (2009). Гранатовый сок: фруктовый сок, полезный для сердца. Nutr. Сборка 67 49–56. 10.1111 / j.1753-4887.2008.00133.x [PubMed] [CrossRef] [Google Scholar]
  • Бергер Дж., Моллер Д. Э. (2002). Механизмы действия PPAR. Annu. Rev. Med. 53 409–435. 10.1146 / annurev.med.53.082901.104018 [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Касимсетти С. Г., Шредер К. К., Феррейра Д. (2009). Влияние побочных продуктов граната ( Punica granatum L.) и эллагитаннинов на рост кишечных бактерий человека. J. Agric. Food Chem. 57 год 8344–8349. 10.1021 / jf1b [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Рамнани П., Касимсетти С. Г., Мунта К. Р., Гибсон Г. Р., Феррейра Д. (2010). Влияние побочного продукта граната и пуникалагинов на отдельные группы кишечной микробиоты человека. Внутр.J. Food Microbiol. 140 175–182. 10.1016 / j.ijfoodmicro.2010.03.038 [PubMed] [CrossRef] [Google Scholar]
  • Брэдли Р. Л., Фишер Ф. Ф., Маратос-Флиер Э. (2008). Пищевые жирные кислоты по-разному регулируют продукцию TNF-альфа и IL-10 адипоцитами 3T3-L1 мышей. Ожирение 16 938–944. 10.1038 / обы.2008.39 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Карпен К., Пеженауте Х., Дель Мораль Р., Буле Н., Хихона Э., Андраде Ф. и др. (2018). Диетический антиоксидант пицеатаннол ингибирует адипогенез мезенхимальных стволовых клеток жировой ткани человека и ограничивает транспорт глюкозы и липогенную активность в адипоцитах. Внутр. J. Mol. Sci. 19: E2081. 10.3390 / ijms181 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Дхумал С., Карале А. Р., Джадхав С. Б., Кад В. П. (2014). Последние достижения и разработки в области обработки и использования граната: обзор. J. Agric. Crop Sci. 1 1–17. [Google Scholar]
  • Ди Джакомо К., Ванелла Л., Сорренти В., Сантанджело Р., Барбагалло И., Калабрезе Г. и др. (2015). Эффекты tithonia diversifolia (Hemsl.) A.Серый экстракт о дифференцировке адипоцитов мезенхимальных стволовых клеток человека. PLoS One 10: e0122320. 10.1371 / journal.pone.0122320 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Фаволе О. А., Макунга Н. П., Опара Ю. Л. (2012). Метанольный экстракт кожуры плодов граната обладает антибактериальной, антиоксидантной и ингибирующей тирозиназой активностью. BMC Дополнение. Альтерн. Med. 12: 200. 10.1186 / 1472-6882-12-200 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Fischer U.А., Карл Р., Каммерер Д. Р. (2011). Идентификация и количественное определение фенольных соединений из кожуры граната ( Punica granatum L.), мезокарпа, арил и других соков с помощью HPLC-DAD-ESI / MS (n). Food Chem. 127 807–821. 10.1016 / j.foodchem.2010.12.156 [PubMed] [CrossRef] [Google Scholar]
  • Гил М. И., Томас-Барберан Ф. А., Хесс-Пирс Б., Холкрофт Д. М., Кадер А. А. (2000). Антиоксидантная активность гранатового сока и ее связь с фенольным составом и обработкой. J. Agric. Food Chem. 48 4581–4589. [PubMed] [Google Scholar]
  • Хоссин Ф. Л. А. (2009). Воздействие кожуры граната (Punica granatum) и его экстракта на крыс с ожирением и гиперхолестеринемией. Пак. J. Nutr. 8 1251–1257. 10.3923 / pjn.2009.1251.1257 [CrossRef] [Google Scholar]
  • Цзян Л., Чжан Н. X., Мо В., Ван Р., Ма К. Г., Ли X. и др. (2008). Ремания подавляет дифференцировку адипоцитов и адипогенез. Biochem. Биофиз. Res. Commun. 371 185–190.10.1016 / j.bbrc.2008.03.129 [PubMed] [CrossRef] [Google Scholar]
  • Кавада Т., Такахаши Н., Фушики Т. (2001). Биохимические и физиологические характеристики жировой клетки. J. Nutr. Sci. Витаминол. 47 1–12. [PubMed] [Google Scholar]
  • Кершоу Э. Э., Флиер Дж. С. (2004). Жировая ткань как эндокринный орган. J. Clin. Эндокринол. Метаб. 89 2548–2556. 10.1210 / jc.2004-0395 [PubMed] [CrossRef] [Google Scholar]
  • Ким С. Х., Плутцки Дж. (2016). Бурый жир и потемнение для лечения ожирения и связанных с ним нарушений обмена веществ. Diabetes Metab. J. 40 12–21. 10.4093 / dmj.2016.40.1.12 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лай С., Цай М. Л., Бадмаев В., Хименес М., Хо К. Т., Пан М. Х. (2012). Ксантиген подавляет дифференцировку преадипоцитов и адипогенез за счет подавления PPARgamma и C / EBP и модуляции путей SIRT-1, AMPK и FoxO. J. Agric. Food Chem. 60 1094–1101. 10.1021 / jf204862d [PubMed] [CrossRef] [Google Scholar]
  • Ли К.Дж., Чен Л. Г., Лян В. Л., Ван К. С. (2010). Противовоспалительное действие punica granatum Linne in vitro и in vivo. Food Chem. 118 315–322. [Google Scholar]
  • Лефтерова М. И., Лазарь М. А. (2009). Новые разработки в адипогенезе. Trends Endocrinol. Метаб. 20 107–114. 10.1016 / j.tem.2008.11.005 [PubMed] [CrossRef] [Google Scholar]
  • Лес Ф., Арбонес-Майнар Дж. М., Валеро М. С., Лопес В. (2018). Полифенолы граната и уролитин А ингибируют альфа-глюкозидазу, дипептидилпептидазу-4, липазу, накопление триглицеридов и гены, связанные с адипогенезом, в адипоцитоподобных клетках 3T3-L1. J. Ethnopharmacol. 220 67–74. 10.1016 / j.jep.2018.03.029 [PubMed] [CrossRef] [Google Scholar]
  • Ли Ю. Ф., Го К. Дж., Ян Дж. Дж., Вэй Дж. Ю., Сюй Дж., Ченг С. (2006). Оценка антиоксидантных свойств экстракта кожуры граната по сравнению с экстрактом мякоти граната. Food Chem. 96 254–260. [Google Scholar]
  • Ли З., Сумманен П. Х., Комория Т., Хеннинг С. М., Ли Р. П., Карлсон Э. и др. (2015). Эллагитаннины граната стимулируют рост кишечных бактерий in vitro: влияние на пребиотические и метаболические эффекты. Анаэроб 34 164–168. 10.1016 / j.anaerobe.2015.05.012 [PubMed] [CrossRef] [Google Scholar]
  • Лин Л. Т., Чен Т. Ю., Лин С. С., Чунг С. Ю., Лин Т. К., Ван Г. Х. и др. (2013). Противовирусная активность широкого спектра хебулаговой кислоты и пуникалагина против вирусов, которые используют гликозаминогликаны для проникновения. BMC Microbiol. 13: 187. 10.1186 / 1471-2180-13-187 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Lira F. S., Rosa J. C., Pimentel G. D., Seelaender M., Дамасо А. Р., Ояма Л. М. и др. (2012). И адипонектин, и интерлейкин-10 ингибируют LPS-индуцированную активацию пути NF-kappaB в адипоцитах 3T3-L1. Цитокин 57 год 98–106. 10.1016 / j.cyto.2011.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Лю Ю., Сюй Д., Инь С., Ван С., Ван М., Сяо Ю. (2018). Уровень IL-10 / STAT3 снижается при детском ожирении с гипертриглицеридемией и связан с уровнем триглицеридов у крыс с ожирением, вызванным диетой. BMC Endocr. Disord. 18:39.10.1186 / s12902-018-0265-z [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Moon Y. J., Soh J. R., Yu J. J., Sohn H. S., Cha Y. S., Oh S. H. (2012). Эффект ингибирования внутриклеточного накопления липидов Weissella koreensis OK1-6, выделенного из Kimchi, на дифференцирующиеся адипоциты. J. Appl. Microbiol. 113 652–658. 10.1111 / j.1365-2672.2012.05348.x [PubMed] [CrossRef] [Google Scholar]
  • Мосети Д., Регасса А., Ким В. К. (2016). Молекулярная регуляция адипогенеза и потенциальные антиадипогенные биоактивные молекулы. Внутр. J. Mol. Sci. 17: E124. 10.3390 / ijms17010124 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Нейринк А. М., Ван Хи В. Ф., Биндельс Л. Б., Де Бакер Ф., Кани П. Д., Делзен Н. М. (2013). Богатый полифенолами экстракт кожуры граната снимает воспаление тканей и гиперхолестеринемию у мышей с ожирением, вызванных диетой с высоким содержанием жиров: потенциальное влияние на микробиоту кишечника. Br. J. Nutr. 109 802–809. 10.1017 / S0007114512002206 [PubMed] [CrossRef] [Google Scholar]
  • Палмери Р., Монтелеоне Дж. И., Спанья Г., Рестучча К., Раффаэле М., Ванелла Л. и др. (2016). Экстракт оливковых листьев сицилийского сорта уменьшал накопление липидов, вызывая термогенный путь во время адипогенеза. Фронт. Pharmacol. 7: 143. 10.3389 / fphar.2016.00143 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Panichayupakaranant P., Tewtrakul S., Yuenyongsawad S. (2010). Антибактериальное, противовоспалительное и противоаллергическое действие стандартизированного экстракта кожуры граната. Food Chem. 123 400–403. 10.1055 / s-0030-1264706 [CrossRef] [Google Scholar]
  • Парк Дж. Э., О С. Х., Ча Ю. С. (2014). Lactobacillus brevis OPK-3, выделенный из кимчи, подавляет адипогенез и оказывает противовоспалительное действие в адипоцитах 3T3-L1. J. Sci. Продовольственное сельское хозяйство. 94 2514–2520. 10.1002 / jsfa.6588 [PubMed] [CrossRef] [Google Scholar]
  • Ку В., Брекса III А. П., Пан З., Ма Х. (2012). Количественное определение основных составляющих полифенолов в продуктах из граната. Food Chem. 132 1585–1591. 10.1016 / j.foodchem.2011.11.106 [PubMed] [CrossRef] [Google Scholar]
  • Раффаэле М., Барбагалло И., Ликари М., Карота Г., Сферраццо Г., Спампинато М. и др. (2018). N-ацетилцистеин (NAC) улучшает липидную метаболическую дисфункцию в адипоцитах, происходящих из стромальных клеток костного мозга. Evid. На основе дополнения. Альтерн. Med. 2018: 9. 10.1155 / 2018/5310961 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Редди М. К., Гупта С.К., Джейкоб М. Р., Хан С. И., Феррейра Д. (2007). Антиоксидантное, противомалярийное и противомикробное действие богатых танинами фракций, эллагитаннинов и фенольных кислот из Punica granatum L. Planta Med. 73 461–467. 10.1055 / с-2007-7 [PubMed] [CrossRef] [Google Scholar]
  • Ромео Ф. В., Баллистрери Г., Фаброни С., Пангалло С., Никосия М. Г., Шена Л. и др. (2015). Химическая характеристика различных экстрактов сумаха и граната, эффективных против гнили Botrytis cinerea. Молекулы 20 11941–11958. 10,3390 / молекул 200711941 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Розен Э. Д., Уолки К. Дж., Пуигсервер П., Шпигельман Б. М. (2000). Транскрипционная регуляция адипогенеза. Genes Dev. 14 1293–1307. [PubMed] [Google Scholar]
  • Салерно Л., Модика М. Н., Ромео Г., Питтала В., Сиракуза М. А., Амато М. Э. и др. (2012). Новые ингибиторы синтазы оксида азота с антиоксидантными свойствами. Eur.J. Med. Chem. 49 118–126. 10.1016 / j.ejmech.2012.01.002 [PubMed] [CrossRef] [Google Scholar]
  • Синглтон В. Л., Ортофер Р., Ламуэла-Равентос Р. М. (1999). Анализ общих фенолов и других субстратов окисления и антиоксидантов с помощью реактива Фолина – Чокальто. Methods Enzymol. 299 152–178. 10.1016 / S0076-6879 (99) 99017-1 [CrossRef] [Google Scholar]
  • Смит К. Б., Смит М. С. (2016). Статистика ожирения. Prim Care 43 год 121–135. 10.1016 / j.поп.2015.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Стечшульте Л. А., Хайндс Т. Д., мл., Худер С. С., Шоу В., Наджар С. М., Санчес Э. Р. (2014). FKBP51 контролирует клеточный адипогенез посредством опосредованного p38 киназой фосфорилирования GRalpha и PPARgamma. Мол. Эндокринол. 28 год 1265–1275. 10.1210 / мне.2014-1022 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Su X., Howell A. B., D’Souza D. H. (2012). Антибактериальные эффекты растительных экстрактов на устойчивый к метициллину Staphylococcus aureus. Патогенные микроорганизмы пищевого происхождения. Дис. 9 573–578. 10.1089 / fpd.2011.1046 [PubMed] [CrossRef] [Google Scholar]
  • Табаско Р., Санчес-Патан Ф., Монагас М., Бартоломе Б., Виктория Морено-Аррибас М., Пелаез К. и др. (2011). Влияние полифенолов винограда на рост молочнокислых бактерий и бифидобактерий: устойчивость и метаболизм. Food Microbiol. 28 год 1345–1352. 10.1016 / j.fm.2011.06.005 [PubMed] [CrossRef] [Google Scholar]
  • Тегеранифар А., Селахварзи Ю., Харрази М., Бахш В.J. (2011). Высокий потенциал побочных продуктов агропромышленного производства граната ( Punica granatum L.) как мощных противогрибковых и антиоксидантных веществ. Ind. Сельскохозяйственная продукция 34 1523–1527. 10.1016 / j.indcrop.2011.05.007 [CrossRef] [Google Scholar]
  • Ванелла Л., Барбагалло И., Аквавива Р., Ди Джакомо К., Кардил В., Абрахам Н. Г. и др. (2013a). Эллаговая кислота: цитодифференцирующие и антипролиферативные эффекты в клеточных линиях рака предстательной железы человека. Curr. Pharm.Des. 19 2728–2736. [PubMed] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Кардил В., Ким Д. Х. и др. (2013b). Маркеры апоптоза в клеточной линии рака простаты: эффект эллаговой кислоты. Онкол. Реп. 30 2804–2810. 10.3892 / или 2013.2757 [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Ли Вольти Г., Кардил В. и др. (2013c). Влияние эллаговой кислоты на ангиогенные факторы в клетках рака простаты. Раки 5 726–738. 10.3390 / раки5020726 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Сэнфорд К., мл., Ким Д. Х., Абрахам Н. Г., Эбрахейм Н. (2012). Окислительный стресс и гемоксигеназа-1 регулируют дифференцировку мезенхимальных стволовых клеток человека. Внутр. J. Hypertens. 2012: 8. 10.1155 / 2012/8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Waldman M., Bellner L., Vanella L., Schragenheim J., Sodhi K., Singh S.P., et al. (2016). Эпоксиэйкозатриеновые кислоты регулируют дифференцировку адипоцитов клеток 3T3 мыши посредством активации PGC-1alpha, которая необходима для экспрессии HO-1 и увеличения функции митохондрий. Stem Cells Dev. 25 1084–1094. 10.1089 / scd.2016.0072 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ван Ю. В., Джонс П. Дж. (2004). Конъюгированная линолевая кислота и контроль ожирения: эффективность и механизмы. Внутр. J. Obes. Relat. Метаб. Disord. 28 год 941–955.10.1038 / sj.ijo.0802641 [PubMed] [CrossRef] [Google Scholar]
  • Сюй К. З., Чжу К., Ким М. С., Ямахара Дж., Ли Ю. (2009). Цветок граната уменьшает ожирение печени у животных с диабетом 2 типа и ожирением. J. Ethnopharmacol. 123 280–287. 10.1016 / j.jep.2009.03.035 [PubMed] [CrossRef] [Google Scholar]

Положительное влияние экстракта кожуры граната и пробиотиков на преадипоцитную дифференцировку

Front Microbiol. 2019; 10: 660.

Валерия Сорренти

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Cinzia Lucia Randazzo

2 Dipaziena Di мы Università di Catania, Катания, Италия

Cinzia Caggia

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

Gabriele Ballistreri

) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Флора Валерия Ромео

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Симона Фаброни

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок и цитрусовых and Tree Fruit, Ачиреале, Италия

Николина Тимпанаро

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливковых, цитрусовых и древесных фруктов, Ачиреале, Италия

Марко Рафаэле

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Luca Vanella

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия , Италия Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

3 Совет по сельскохозяйственным исследованиям и исследованиям в области сельского хозяйства Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Под редакцией: Розальба Ланчотти, Болонский университет, Италия 90 003

Рецензент: Анна Реале, Институт науки и технологий (ISA), Италия; Коши Филип, Малайский университет, Малайзия

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы микробиологии»

Поступила в редакцию 22 октября 2018 г .; Принята в печать 15 марта 2019 г.

Авторские права © 2019 Сорренти, Рандаццо, Каджия, Баллистрери, Ромео, Фаброни, Тимпанаро, Раффаэле и Ванелла.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Благоприятные эффекты граната обусловлены содержанием эллагитаннинов и антоцианов, которые защищают от множества заболеваний, включая воспалительные. Многие исследователи сообщают, что экстракты отходов граната (кожуры и семян), полученные из отходов промышленной переработки, обладают акцептором свободных радикалов и обладают мощной антиоксидантной способностью. Экстракты граната (ПЭ) также обладают антибактериальной, противовирусной, гиполипидемической и противовоспалительной биоактивностью благодаря содержанию полифенольных соединений, включая пуникалагины, галловую кислоту и производные эллаговой кислоты.В центре внимания данной рукописи было изучение пребиотического потенциала PE, растворимого в воде и охарактеризованного с помощью HPLC – PDA – ESI / MS n на предмет его фенольного содержания. Более того, поскольку сообщалось, что экстракты граната снижали уровень липидов в крови и что было показано, что ряд пробиотических штаммов влияет на адипогенез в культуре клеток, это исследование также было выполнено для проверки in vitro эффектов PE и пробиотик L.rhamnosus GG ATCC 53103 (LGG) на линии клеток 3T3-L1. PE и пробиотики существенно снижали содержание триглицеридов и увеличение внутриклеточных липидов по сравнению с контрольной группой. Однако комбинированная обработка отработанного бульона (SB), фильтрованного через PE и LGG, была наиболее эффективной в снижении содержания триглицеридов и накопления внутриклеточных липидов. Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно ниже в клетках 3T3-L1, обработанных PE и SB, отфильтрованных через LGG.Эти результаты свидетельствуют о том, что синергетический эффект пробиотиков и полифенолов, содержащихся в PE, может повлиять на адипогенез in vitro, и может способствовать разработке новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Ключевые слова: лактобацилл, антимикробная активность, экстракт граната, дифференциация адипоцитов, комбинирование продуктов

Введение

Гранат — это фрукт, положительное влияние на здоровье которого было тщательно изучено.Этот фрукт богат биологически активными соединениями, такими как эллагитаннины и антоцианы, которые защищают от дегенеративных заболеваний. Плод граната из-за его высокой питательной ценности, пользы для здоровья и биоактивных антиоксидантных соединений считается пищевым лекарством. Фактически, гранат широко используется в фитотерапии при нескольких патологиях, включая грипп и инфекции верхних дыхательных путей. Все части плодов граната, то есть кожура и семена, рассматриваемые как отходы, могут быть переработаны для получения продуктов с добавленной стоимостью, имеющих промышленную, медицинскую и косметическую ценность (Dhumal et al., 2014).

Отходы граната образуются на всех этапах жизненного цикла плодов, то есть во время сельскохозяйственного производства, промышленного производства и переработки. Можно использовать побочные продукты граната, поскольку они являются богатым источником биологически активных соединений, таких как флавоноиды, фенольные кислоты и дубильные вещества. Более того, многие исследователи описали, что экстракты граната, изготовленные из побочных продуктов перерабатывающих предприятий, обладают эффективным улавливанием свободных радикалов и антиоксидантной способностью (Lee et al., 2010; Panichayupakaranant et al., 2010; Fischer et al., 2011).

Кроме того, экстракты граната действуют как естественные ингибиторы патогенов, бактерий и грибков (Al-Zoreky, 2009; Tehranifar et al., 2011; Romeo et al., 2015).

Эллагитаннины граната гидролизуются микробиотой кишечника до более мелких фенольных соединений, таких как эллаговая кислота. Затем эллаговая кислота всасывается в кровоток, в то время как эллагитаннины не всасываются и метаболизируются в уролитины.

Сообщалось, что побочные продукты граната и пуникалагины в значительной степени способны подавлять рост патогенных Escherichia coli , Pseudomonas aeruginosa , Clostridia и Staphylococcus aureus (Reddy et al., 2007; Bialonska et al., 2009) и для увеличения роста полезных бактерий, включая Bifidobacterium spp. и Lactobacillus spp. (Reddy et al., 2007; Bialonska et al., 2010).

Экстракты граната также снижают уровень липидов в крови и обладают значительной противоопухолевой, противовирусной и противовоспалительной активностью (Li et al., 2006; Hossin, 2009; Lin et al., 2013; Bassiri- Джахроми, 2018).

Эти потенциальные полезные эффекты приписываются полифенольным соединениям, которые содержатся в экстрактах граната, включая пуникалагины, галловую кислоту и производные эллаговой кислоты (Vanella et al., 2013а, б, в; Romeo et al., 2015).

Поскольку ожирение является одной из основных проблем общественного здравоохранения, необходимы новые превентивные стратегии (Smith and Smith, 2016).

Адипоциты играют важную роль в начале или развитии метаболических осложнений, связанных с ожирением, таких как метаболический синдром и диабетические осложнения (Kim and Plutzky, 2016).

Интерес исследователей к выявлению натуральных продуктов, полученных из диетических растений, обладающих активностью против ожирения, возрос.Сообщалось, что ксантиген и фукоксантин, природные соединения масла косточек граната, значительно подавляли дифференцировку адипоцитов и накопление липидов (Lai et al., 2012).

Настоящая рукопись посвящена прежде всего изучению антиоксидантной и антимикробной активности, а также пребиотического потенциала ПЭ, богатого фенольными соединениями. Более того, обогащенный стандартизованный полиэтилен, содержащий высокий процент природных антиоксидантов граната, был химически охарактеризован с помощью ВЭЖХ – PDA – ESI / MSn.Во-вторых, поскольку гранатовый сок (Les et al., 2018) и различные типы экстрактов граната (PE), включая экстракт, полученный из цельного фрукта (Li et al., 2015), и экстракт, полученный из кожуры граната (Neyrinck et al., 2013), и было показано, что ряд пробиотических штаммов (Moon et al., 2012; Park et al., 2014) влияют на адипогенез, это исследование было проведено для проверки in vitro эффектов PE, пробиотика L rhamnosus GG ATCC 53103 (LGG), предварительно инкубированные с PE, отдельно или в комбинации, при дифференцировке клеток 3T3-L1.

Материалы и методы

Химические вещества

Порошкообразный экстракт граната (Dermogranate ® ), использованный в этом исследовании, был предоставлен Medinutrex (Катания, Италия). Вкратце, экстракт готовили из сушеных и измельченных плодов граната, смешанных с водно-спиртовыми растворами (пищевой), а затем фильтровали. Фильтрат концентрировали и затем сушили распылением для получения стандартизованного экстракта. Экстракт Dermogranate ® имел следующий химический состав: общие полифенолы (16%), пуникалагины (8%), эллаговая кислота и производные (8%).

Реагент Фолина – Чокальтеу (FCR), карбонат натрия (Na 2 CO 3 ), галловая кислота, пуникалин (смесь аномеров), пуникалагин и эллаговая кислота были приобретены у Sigma-Aldrich (Милан, Италия). Гранатин Б был приобретен у LGC Standards (Лондон, Великобритания). Для хроматографии использовали растворители степени чистоты для ВЭЖХ – МС (Merck KgaA, Дармштадт, Германия), а все остальные реагенты были аналитической чистоты.

Определение общего содержания полифенолов

Анализ Folin – Ciocalteu (Singleton et al., 1999) был использован для определения общего содержания полифенолов с небольшими модификациями. 0,1 мг / мл экстракта растворяли в дистиллированной воде. Затем к 500 мкл образца добавляли 5 мл 10% FCR и 4,5 мл раствора Na 2 CO 3 (7,5% мас. / Об.). Конечный раствор перемешивали в течение 2 часов в темноте, а затем измеряли Abs при λ = 765 нм. Анализы проводили в трех экземплярах, и общую концентрацию полифенолов выражали в граммах эквивалентов галловой кислоты (GAE) / 100 г экстракта.

HPLC – PDA – ESI / MS

n Анализ фенольных соединений

Разделение и количественное определение фенольных соединений выполняли, как описано ранее (Romeo et al., 2015). Для идентификации фенольных соединений времена удерживания (RT), спектры и данные МС в режиме отрицательного ESI сравнивали с данными аутентичных стандартов. Количественное определение каждого фенольного соединения проводили с использованием соответствующего стандарта в качестве внешнего стандарта. Количественное определение галловой кислоты проводили при 280 нм.Пуникалины, гранатин В, пуникалагины и эллаговая кислота определялись количественно при 378 нм; та же длина волны использовалась для количественного определения производных эллаговой кислоты с использованием эллаговой кислоты в качестве стандарта сравнения. Анализы проводили в трех экземплярах, и результаты выражали в г соединения / 100 г экстракта.

Тушение DPPH

Способность улавливать свободные радикалы различных концентраций экстракта PE (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) измеряли по 2, Безрадикальный метод 2-дифенил-1-пикрилгидразилгидрата (DPPH), как сообщалось ранее (Salerno et al., 2012). Результаты выражены в процентах от степени ингибирования ± SD .

Влияние поглотителя на супероксид-анион

Способность экстракт ПЭ различных концентраций улавливать супероксид-анион (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) определялась как сообщалось ранее (Салерно и др., 2012). Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Мышиные преадипоциты 3T3-L1 Жизнеспособность клеток

Мышиные преадипоциты 3T3-L1 были приобретены в Американской коллекции типовых культур (Роквилл, Мэриленд, США).Клетки высевали в концентрации 2 × 10 5 клеток на лунку 96-луночного микропланшета и культивировали при 37 ° C в инкубаторе с 5% CO 2 в течение 48 часов в отсутствие и в присутствии различных концентраций ЧП сообщалось выше. Жизнеспособность клеток измеряли с помощью анализа МТТ, как сообщалось ранее (Di Giacomo et al., 2015). МТТ, желтый тетразол, в живых клетках восстанавливается до пурпурного формазана. Результаты выражены в процентах формазана, продуцированного в обработанных мышиных преадипоцитах 3T3-L1 по сравнению с необработанными клетками.

Микробиология

Бактериальное культивирование

Использовали коммерческие штаммы патогенов E. coli ATCC 25922, S. aureus ATCC 29213, Listeria innocua ATCC 33090 и Salmonella enterica ATCC 14028. Штамм E. coli выращивали в бульоне Лурия-Бертани (LB) при 37 ° C в течение ночи; S. aureus , S. enterica и L. innocua обычно выращивали в течение ночи в триптон-соевом бульоне (TSB) при 37 и 30 ° C соответственно.Все материалы и приложения предоставлены Oxoid (Милан, Италия).

Коммерческие пробиотические штаммы LGG, Bifidobacterium animalis BB12, B. longum BB536 и дикий штамм Lactobacillus paracasei N 24, выделенные из кротонского сыра пекорино, культивировали в бульоне Демана – Рогоза – Шарпа (MRS). при 37 ° C в течение ночи.

Ночные бактериальные культуры инкубировали при 37 ° C в течение 24 часов в анаэробных условиях, пока они не достигли плотности клеток приблизительно 1.0 × 10 9 КОЕ / мл.

Определение скорости роста

На основании результатов, полученных по активности PE в качестве акцептора свободных радикалов, и экспериментов по жизнеспособности преадипоцитов мышей 3T3-L1, для обработки штаммов пробиотиков или патогенов, как описано ниже, использовали различные концентрации.

Антимикробная активность PE оценивалась против коммерческих штаммов патогенов, упомянутых выше. Ночные культуры патогенов совместно культивировали при 37 ° C в течение 24 ч с PE в различных концентрациях (1.7–0,34–0,17 мг / мл), а антимикробную активность оценивали подсчетом живых бактерий на чашках и выражали в КОЕ / мл.

Влияние PE на рост пробиотических штаммов, упомянутых выше, оценивали при совместном культивировании пробиотических штаммов с плотностью клеток приблизительно 1,0 × 10 9 КОЕ / мл с PE в различных концентрациях (0,085–0,042– 0,028 мг / мл). Влияние экстракта на рост пробиотических штаммов оценивали после инкубации при 37 ° C в течение 24 часов в анаэробных условиях путем посева живых бактерий и выражали в КОЕ / мл.

Все эксперименты проводились в двух экземплярах, а результаты выражались в виде средних значений и стандартного отклонения. Основываясь на предварительных результатах, для последующего анализа была выбрана LGG.

Свежие бульонные культуры центрифугировали при 5000 об / мин в течение 10 минут при 4 ° C, супернатант декантировали для сбора отработанного бульона (SB), который фильтровали (FSB) с использованием фильтра 0,22 мкм и затем использовали для дальнейшего использования. анализы.

Бактериальный осадок ресуспендировали в 1 мл PBS и пять раз обрабатывали ультразвуком с амплитудой 44% в течение 2 мин с 6 мин отдыха.Затем обработанный ультразвуком центрифугировали при 1100 × g в течение 15 мин при 4 ° C. Супернатант собирали, фильтровали через фильтр 0,22 мкм и меченный экстракт бактериальных клеток (CE). CE использовался для дальнейшего анализа.

Культура клеток и дифференцировка клеток адипоцитов

Преадипоциты мышей 3T3-L1 ресуспендировали в среде Игла, модифицированной Дульбекко (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS, Invitrogen, Карлсбад, Калифорния, США) и 1% антибиотика. / антимикотический раствор (Invitrogen, Карлсбад, Калифорния, США) и высевали в колбу размером 75 см 2 при плотности от 1 до 2 × 10 4 клеток.Дифференцировку клеток адипоцитов получали, как сообщалось ранее (Waldman et al., 2016).

Дифференцирующиеся преадипоциты 3T3-L1 обрабатывали в течение 7 дней PE (0,028 мг / мл), LGG CE (25 мкг / мл) и SB, профильтрованным через LGG (10 мкг / мл) из ночной бактериальной культуры, инкубированной с или без ПЭ (0,028 мг / мл).

Количественное определение содержания липидов

Для количественной оценки накопления липидов проводили масляное красное окрашивание, как сообщалось ранее (Barbagallo et al., 2017). Образование липидных капель измеряли с помощью инвертированного многоканального светодиодного флуоресцентного микроскопа (Evos, Life Technologies, Гранд-Айленд, Нью-Йорк, США).

Экстракция

РНК и qRT-PCR

Экспрессии адипонектина, PPAR-γ, SREBP, FAS, IL-6 и IL-10 оценивали с помощью ПЦР в реальном времени. РНК экстрагировали и количественно оценивали, как сообщалось ранее (Raffaele et al., 2018). Использовали соответствующие последовательности праймеров (). Относительный уровень экспрессии мРНК измеряли по значению порогового цикла (Ct) каждого продукта ПЦР и нормализовали с таковым для GAPDH с использованием сравнительного метода 2 -ΔΔCt .

Таблица 1

Праймеры для ПЦР, использованные в этом исследовании.

Gene Прямой праймер Обратный праймер
Адипонектин GAAGCCGCTTATGTGTATCGC GAATGGGTACATTGGGAACAGT
IL-6 TTCCTCTCTGCAAGAGACTTCC AGGAGAGCATTGGAAATTGGGG
FAS GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
GAPDH AGCTTCGGCACATATTTCATCTG CGTTCACTCCCATGACAAACA
IL-10 GCTGGACAACATACTGCTAACC ATTTCCGATAAGGCTTGGCAA
SREBP-1 GATGTGCGAACTGGACACAG CATAGGGGGCGTCAAACAG
PPAR-γ TCGCTGATGCACTGCCTATG ACCTGATGGCATTGTGAGACAT

Статистический анализ

Статистический анализ множественных сравнений был выполнен e Метод Фишера. P — значения ниже 0,05 были приняты как значимые. Данные были проанализированы с использованием либо однофакторного дисперсионного анализа (ANOVA) для нескольких групп, либо непарного t -теста для двух групп, и результаты представлены в виде среднего значения ± стандартное отклонение.

Результаты

HPLC – PDA – ESI / MS

n Анализ PE

Фенольный профиль PE () включал определение 1 гидроксибензойной кислоты и 19 эллагитаннинов. Основные пики соответствовали пуникалину (пик 4), гранатину B (пик 6), пуникалагину A и B (пики 10 и 14) и эллаговой кислоте (пик 19) ().Выявлено также присутствие галловой кислоты (пик 1) и производных эллаговой кислоты (пики 2, 3, 5, 7–9, 11–13, 15–18, 20). Как показано на хроматограмме, эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожуры), поскольку они составляют более 99% от общего содержания фенольных соединений граната. Пуникалагины, основные эллагитаннины побочных продуктов граната, составляли 47,6% от общего содержания фенольных соединений в ПЭ (). Производные эллаговой кислоты, эллаговая кислота и другие второстепенные фенольные соединения (пуникалин, гранатин B и галловая кислота) составили 38.4, 10,2 и 3,8% от общего содержания фенолов в ПЭ соответственно ().

ВЭЖХ-хроматограмма фенольных соединений ПЭ, обнаруженных при 378 нм. Об идентификации пиков см.

Таблица 2

Список пиков и количественное определение фенольных соединений в ПЭ.

0,07 0,07 966 9,5 9 9278 9027 301 9027 0,027 603 603 Ead d 8 9278 9027 0278 9027 9027 0278 9 9027 35,4 Ead d 902 7.82 фенол
Номер пика a RT (мин) λ (нм) [M – H] ( м / z ) MS n ( m / z ) Фенольные соединения г / 100 г b
1 3.9 269,310 169 125 Кислота галловая 0,07 ± 0,02
2 4,1 255,364 301 301 3 7,0 255,363 301 Ead ​​ d 0,41 ± 0,04
4 7,3 263,364403 9027 601 9027 9027 9027 P 263,36440727 ± 0,04
5 8,4 264,366 301 Ead ​​ d 0,19 ± 0,09
6
Гранатин В 0,28 ± 0,03
7 10,4 259,361 301 Ead ​​ d 0,02 ± 0,01 257,360 301 Ead ​​ d 0,05 ± 0,01
9 13,5 256,362
10 14,0 258,378 1083 781/601 Пуникалагин А 3,05 ± 0,05
11 15,1
15,1
0.13 ± 0,09
12 15,9 257,361 301 Ead ​​ d 0,95 ± 0,03
13
2,69 ± 0,11
14 17,7 257,378 1083 781/601 Пуникалагин B 4,77 ± 0,21 4,77 ± 0,21 257,362 301 Ead ​​ d 0,12 ± 0,01
16 25,2 256,363
17 29,3 254,361 301 Ead ​​ d 0,17 ± 0,01
18 32,2 32,2
0.08 ± 0,03
19 33,6 256,367 301 229/185 Эллаговая кислота 1,68 ± 0,01
20 9027
0,08 ± 0,02
Всего полифенолов c 16,48 ± 2,49
Производные эллаговой кислоты 6,31
Эллаговая кислота 0,62
Всего 16.43

Масс-спектрометрические свойства 20 идентифицированных фенольных соединений (пики 1–20) показаны на рис. Как сообщалось ранее (Romeo et al., 2015), наблюдались две изомерные формы (A и B) пуникалагинов (пики 10 и 14), а также было подчеркнуто присутствие гранатина B (пик 6). Кроме того, эти соединения также были охарактеризованы прямым анализом отрицательных ионов для инфузии ESI / MS n стандартных соединений.Пик 4 был идентифицирован как пуникалин ( m / z 781), тогда как пики 2, 3, 5, 7–9, 11–13, 15–18 и 20 были идентифицированы как производные эллаговой кислоты в соответствии с их УФ – видимой областью и массой. характеристики (λ max около 370 нм и фрагмент MS 1 на мкм / z 301, соответствующий эллаговой кислоте).

Активность PE по улавливанию свободных радикалов

Антиоксидантная активность PE проверялась по их способности восстанавливать стабильный радикал DPPH.

В частности, процент ингибирования DPPH достигал 75% при концентрациях ниже 0.21 мг / мл (76,78, 79 и 80% соответственно при концентрации ПЭ 0,17-0,11-0,085 и 0,028 мг / мл). При концентрациях выше 0,21 мг / мл процент ингибирования DPPH был ниже ().

Активность ПЭ по улавливанию радикалов DPPH в различных концентрациях. Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Экстракт граната ингибировал образование супероксид-аниона дозозависимым образом (). Как правило, в этом тесте PE оказался более эффективным, чем в предыдущем.Это может быть связано с меньшим размером супероксид-аниона по сравнению с радикалом DPPH.

Таблица 3

Активность по улавливанию супероксидных ионов при различных концентрациях ПЭ.

78 ± 2
концентрации PE % ингибирования концентрации PE % ингибирования
PE (3,4 мг / мл) 65 ± 2 PE (0,21 мг / мл)
PE (1,7 мг / мл) 73 ± 3 PE (0.17 мг / мл) 80 ± 1
PE (0,85 мг / мл) 75 ± 1 PE (0,11 мг / мл) 85 ± 3
PE (0,56 мг / мл ) 70 ± 2 PE (0,085 мг / мл 88 ± 4
PE (0,42 мг / мл) 68 ± 1 PE (0,028 мг / мл) 95 ± 1
PE (0,34 мг / мл) 75 ± 4

Влияние PE на жизнеспособность клеток 3T3-L1

3- (4,5-диметилтиазол ил) -2,5-дифенилтетразолийбромид (МТТ) проводили для оценки жизнеспособности клеток 3T3-L1.Результаты показывают значительное снижение жизнеспособности клеток при высоких концентрациях PE (3,4, 1,7, 0,85, 0,56 и 0,42 мг / мл), тогда как при более низких (0,34, 0,21, 0,17, 0,11 и 0,085 мг / мл) концентрациях наблюдается умеренная ингибирующий эффект и концентрация 0,028 мг / мл не оказали значительного влияния на жизнеспособность клеток преадипоцитов мышей 3T3-L1 ().

Процент выживаемости преадипоцитов мышей 3T3-L1 в присутствии PE в различных концентрациях. Результаты выражены как среднее значение ± стандартное отклонение четырех экспериментов, проведенных в трех повторностях.Значимые по сравнению с необработанными контролями: p <0,005; ∗∗ p <0,05.

Microbiology

Антимикробная активность PE в отношении штаммов патогенов

Данные анализа совместного культивирования показали, что патогены были по-разному чувствительны к PE. В деталях, как показано в, экстракт в концентрации 1,7 мг / мл показал наивысшую антимикробную активность против всех патогенов со значительным снижением на L. innocua (проксимально 4 log единицы).При концентрации 0,34 мг / мл экстракт был эффективен против E. coli , L. innocua и S. aureus , демонстрируя снижение плотности клеток на 1 и 2 log единицы соответственно. Когда PE тестировали при концентрации 0,17 мг / мл, штаммы S. aureus , S. enterica и L. innocua все еще подавлялись, в то время как рост E. coli не подвергался значительному влиянию.

Противомикробная активность PE различной концентрации в отношении патогенов, обнаруженных в T24 (24 ч инокулята).Плотность клеток выражается как Δlog КОЕ / мл.

Эффект PE на рост пробиотических штаммов

Результаты, показанные в, подчеркнули, что PE, при всех испытанных концентрациях, не обладал какой-либо ингибирующей активностью в отношении роста испытанных пробиотических штаммов. Небольшое увеличение роста наблюдалось для LGG, совместно культивируемых с PE в концентрации 0,028 мг / мл ().

Таблица 4

Количество бактерий, выраженное в логарифме 10 КОЕ / мл в трех повторностях ± стандартное отклонение L. rhamnosus GG ATCC 53103, Bifidobacterium animalis BB12, B.longum BB536 и дикий штамм Lactobacillus paracasei N 24 после инкубации с PE в различных концентрациях.

90CC3 ) 9027 a 9027 9027 9040 мг 9,57 ± 0,12 a
Журнал 10
L. rhamnosus GG Исходный уровень 8,83 ± 0,09 a

3

9,20 ± 0,10 b
PE (0.042 мг / мл) 9,24 ± 0,07 b
PE (0,028 мг / мл) 9,26 ± 0,04 b
Lactobacillus paracase8
Lactobacillus paracasei
N24 PE (0,085 мг / мл) 8,70 ± 0,08 a
PE (0,042 мг / мл) 8,79 ± 0,10
PE (0.028 мг / мл) 8,74 ± 0,09 a
Bifidobacterium animalis Исходный уровень 9,15 ± 0,05 a
BB40 0,12 a
PE (0,042 мг / мл) 9,44 ± 0,10 b
PE (0,028 мг / мл) 9,55 ± 0,07 9027 b Б.longum Исходный уровень 9,77 ± 0,03 a
BB536 PE (0,085 мг / мл) 9,54 ± 0,10 a
PE (0,028 мг / мл) 9,44 ± 0,16 a

Влияние полиэтилена и экстракта LGomenate на содержание липидов 9000Ggranate 9000Ggrana 9 фильтрованный SB значительно снизил содержание триглицеридов по сравнению с контрольной группой ().Однако эффект отфильтрованного SB, полученного из клеток, инкубированных с PE (LGG-T1) или без него (LGG-T0), был аналогичным. Одновременная обработка преадипоцитов мышей 3T3-L1 SB, отфильтрованным через PE и LGG, значительно снизила содержание триглицеридов по сравнению с обработкой только SB, отфильтрованного через LGG. Более того, эти данные свидетельствуют о том, что комбинированное лечение PE и LGG-T1 было наиболее эффективным для снижения содержания триглицеридов и накопления внутриклеточных липидов.

(A) Типичное масляное красное окрашивание O клеток 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE. (B) Содержание липидов определяли количественно с помощью окрашивания Oil Red O (среднее ± SD , p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с LGG T0 + PE).

Обработка преадипоцитов мышей 3T3-L1 клеточным экстрактом LGG (CE), полученным из клеток, инкубированных с PE (CE + PE) или без него (CE), не оказала влияния на накопление внутриклеточных липидов по сравнению с контрольной группой ( Контроль: ABS 490 нм = 0.200 ± 0,07; CE: ABS 490 нм = 0,187 ± 0,09; CE + PE = ABS 490 нм = 0,190 ± 0,05).

Влияние PE на адипогенные маркеры

Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно менее выражены в клетках 3T3-L1, обработанных SB, отфильтрованным через PE и LGG. В частности, PE, LGG-T0 и LGG-T1 были способны снижать уровни гена адипонектина, PPAR-γ, SREBP, FAS и IL-6 и повышать уровни гена IL-10 ().

(A – F) Анализ экспрессии генов с помощью qRT-PCR липогенного пути в клетках 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE.Результаты выражены в виде среднего значения ± стандартное отклонение четырех экспериментов, выполненных в трех повторностях ( * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с контролем. LGG T0 + PE).

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно снизила уровни экспрессии мРНК основных транскрипционных факторов, участвующих в адипогенезе, по сравнению с обработкой SB, отфильтрованных через LGG ( LGGT0 и LGGT1) отдельно ().

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно повысила уровни экспрессии мРНК IL10 по сравнению с обработкой только SB (LGGT0 и LGGT1), профильтрованных через LGG ( ). Более того, эти данные свидетельствуют о том, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10 (2).

Обсуждение

Благоприятные эффекты употребления плодов граната и / или сока вызвали значительный научный интерес (Basu and Penugonda, 2009).Многие исследователи сообщают, что полиэтилены, полученные из отходов перерабатывающих предприятий, обладают способностью улавливать свободные радикалы и обладают мощной антиоксидантной способностью (Panichayupakaranant et al., 2010; Fischer et al., 2011). ПЭ, использованный в настоящем исследовании, был растворим в воде и охарактеризован с помощью ВЭЖХ – PDA – ESI / MS n по содержанию фенолов и антоцианов. В соответствии с предыдущими сообщениями (Fischer et al., 2011; Qu et al., 2012; Romeo et al., 2015) эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожура), поскольку они составляют более 99% от общего содержания фенольных соединений граната.Основными эллагитаннинами побочных продуктов граната, а также продуктов из граната (фруктов и соков) являются пуникалагины (Gil et al., 2000; Fischer et al., 2011; Qu et al., 2012).

Экстракт граната содержит высокий процент фенольных соединений и проявляет антиоксидантную активность в зависимости от концентрации, как показано для анализа как DPPH, так и анализа поглощения супероксид-анионов.

Сообщалось, что диетические полифенолы растений способны избирательно модулировать рост чувствительных микроорганизмов (Tabasco et al., 2011). Экстракты растений обычно подавляют рост бактерий, но степень эффекта зависит от состава экстракта и типа бактериального штамма.

Результаты, полученные в условиях наших экспериментов, продемонстрировали, что высокие концентрации полифенолов граната оказывают противомикробное действие на некоторые штаммы патогенов, такие как L. innocua и S. aureus. Эти результаты согласуются с исследованиями Panichayupakaranant et al. (2010), Fawole et al.(2012) и Su et al. (2012).

Однако при концентрациях PE ниже 0,34 мг / мл, хотя не было обнаружено концентраций ингибирующей активности в отношении штаммов пробиотиков, оценивалось только небольшое увеличение роста LGG. Эти результаты не согласуются с исследованиями Li et al. (2015) и Neyrinck et al. (2013), которые продемонстрировали, что полифенолы граната потенциально могут работать как пребиотики.

Ожирение — это состояние, при котором накопление липидов приводит к расширению жировой ткани, которая действует как метаболический и эндокринный орган.Молекулярные механизмы, которые модулируют рост, дифференцировку и липогенез преадипоцитов жировых клеток, были предметом обширных исследований (Vanella et al., 2012; Stechschulte et al., 2014; Moseti et al., 2016; Palmeri et al., 2016; Waldman et al., 2016; Carpene et al., 2018).

Во время дифференцировки адипоцитов преадипоциты дифференцируются в зрелые адипоциты (Lefterova, Lazar, 2009). Повышенное накопление жира сильно коррелирует с количеством клеток и / или размером адипоцитов (Jiang et al., 2008).

Сообщалось, что степень ожирения связана с дифференцировкой преадипоцитов в адипоцитах и ​​с увеличением адипоцитов в жировой ткани (Wang and Jones, 2004).

Другие авторы сообщили, что PEs способны подавлять дифференцировку преадипоцитов и адипогенез и уменьшать жировую дистрофию печени у крыс с ожирением и диабетом 2 типа (Xu et al., 2009).

В соответствии с данными Moon et al. (2012) и Park et al. (2014) в наших экспериментальных условиях PE, LGG-T0 и LGG-T1 приводили к значительному снижению накопления липидов в клетках 3T3-L1 во время дифференцировки в адипоциты, предполагая, что PE, LGG-T0 и LGG-T1 способны подавлять дифференцировка адипоцитов.Однако обработка LGG-фильтрованным SB, полученным из клеток, инкубированных с PE (LGG-T1) или без (LGG-T1), была аналогичной. В наших экспериментальных условиях фактически не наблюдалось пребиотического эффекта, продемонстрированного другими авторами. Более того, комбинированное лечение PE и LGG-T1 было наиболее эффективным в снижении внутриклеточного накопления липидов. Эти данные демонстрируют, что, даже если в наших экспериментальных условиях не наблюдалось пребиотического эффекта, фильтрованный SB, полученный из LGG, инкубированного с PE (LGG-T1), мог бы содержать, помимо полезных бактериальных секретируемых биоактивных соединений, также небольшие количества PE- производные биоактивные соединения.Последний, присутствующий в небольших количествах в LGG-T1, не будет иметь более сильных положительных эффектов, чем LGG-T0, но в сочетании с PE может иметь потенциальные синергетические преимущества для здоровья.

Адипоцит-специфический рецептор, активируемый пролифератором пероксисом-γ (PPARγ), участвует в ранней стадии дифференцировки адипоцитов (Rosen et al., 2000), регулируя экспрессию адипогенных генов, таких как синтаза жирных кислот (FAS) и регуляторный элемент стерола. -связывающие белки (SREBP), а затем запускают накопление жира в клетках (Kawada et al., 2001; Бергер и Моллер, 2002).

Жировая ткань — это не только первичный резервуар жира, но и эндокринный орган, контролирующий гомеостаз липидов. Измененные уровни адипокинов жировой ткани могут способствовать развитию воспаления, что приводит к нарушению липидного обмена (Armani et al., 2010). При хроническом воспалении провоспалительные цитокины, такие как IL-6, активируются, тогда как противовоспалительные цитокины, такие как IL-10, подавляются (Kershaw and Flier, 2004; Bradley et al., 2008; Лира и др., 2012; Лю и др., 2018).

Наши результаты демонстрируют, что комбинированное лечение PE + LGG-T1 значительно снижает уровень мРНК адипонектина, FAS и IL-6 и повышает уровень IL-10.

Можно сделать вывод, что комбинированное лечение PE + LGG-T1 обладает противовоспалительными свойствами и способно ингибировать дифференцировку адипоцитов, модулируя уровни экспрессии ключевых факторов адипогенной транскрипции, участвующих в адипогенезе.

Заключение

SB, профильтрованный экстрактом граната и LGG, значительно снизил накопление внутриклеточных липидов.Наблюдали синергетический эффект пробиотиков и полифенолов, содержащихся в PE. Более того, наши результаты показали, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10.

Эти результаты свидетельствуют о том, что пробиотики и полифенолы, содержащиеся в ПЭ, могут влиять на адипогенез in vitro. Более того, наши результаты демонстрируют, что синергетические свойства сочетания таких продуктов, как гранат и пробиотики, могут оказывать комбинированное воздействие на здоровье.

Тогда гранат и пробиотики, такие как штамм LGG, могут внести свой вклад в разработку новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Вклад авторов

VS, LV, CR, CC, FR и GB собрали исследовательские статьи, разработали эксперименты, проанализировали результаты и написали рукопись. CR, MR, SF и NT проводили эксперименты.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Ссылки

  • Аль-Зореки Н.С. (2009). Антимикробная активность кожуры плодов граната ( Punica granatum L.). Внутр. J. Food Microbiol. 134 244–248. 10.1016 / j.ijfoodmicro.2009.07.002 [PubMed] [CrossRef] [Google Scholar]
  • Армани А., Мамми К., Марцолла В., Каланчини М., Антелми А., Розано Г. М. и др. (2010). Клеточные модели для понимания адипогенеза, дисфункции жировой ткани и ожирения. J. Cell Biochem. 110 564–572.10.1002 / jcb.22598 [PubMed] [CrossRef] [Google Scholar]
  • Барбагалло И., Ли Вольти Г., Сорренти В., Ди Джакомо К., Аквавива Р., Раффаэле М. и др. (2017). Фенетиловый эфир кофейной кислоты восстанавливает экспрессию гена адипоцитов после обработки липополисахаридом. Lett. Drug Des. Discov. 14 481–487. 10.2174 / 15701808136661604707 [CrossRef] [Google Scholar]
  • Бассири-Джахроми С. (2018). Активность Punica granatum (граната) в укреплении здоровья и профилактике рака. Онкол. Сборка 12: 345. 10.4081 / онкол.2018.345 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Басу А., Пенугонда К. (2009). Гранатовый сок: фруктовый сок, полезный для сердца. Nutr. Сборка 67 49–56. 10.1111 / j.1753-4887.2008.00133.x [PubMed] [CrossRef] [Google Scholar]
  • Бергер Дж., Моллер Д. Э. (2002). Механизмы действия PPAR. Annu. Rev. Med. 53 409–435. 10.1146 / annurev.med.53.082901.104018 [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Касимсетти С. Г., Шредер К. К., Феррейра Д. (2009). Влияние побочных продуктов граната ( Punica granatum L.) и эллагитаннинов на рост кишечных бактерий человека. J. Agric. Food Chem. 57 год 8344–8349. 10.1021 / jf1b [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Рамнани П., Касимсетти С. Г., Мунта К. Р., Гибсон Г. Р., Феррейра Д. (2010). Влияние побочного продукта граната и пуникалагинов на отдельные группы кишечной микробиоты человека. Внутр.J. Food Microbiol. 140 175–182. 10.1016 / j.ijfoodmicro.2010.03.038 [PubMed] [CrossRef] [Google Scholar]
  • Брэдли Р. Л., Фишер Ф. Ф., Маратос-Флиер Э. (2008). Пищевые жирные кислоты по-разному регулируют продукцию TNF-альфа и IL-10 адипоцитами 3T3-L1 мышей. Ожирение 16 938–944. 10.1038 / обы.2008.39 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Карпен К., Пеженауте Х., Дель Мораль Р., Буле Н., Хихона Э., Андраде Ф. и др. (2018). Диетический антиоксидант пицеатаннол ингибирует адипогенез мезенхимальных стволовых клеток жировой ткани человека и ограничивает транспорт глюкозы и липогенную активность в адипоцитах. Внутр. J. Mol. Sci. 19: E2081. 10.3390 / ijms181 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Дхумал С., Карале А. Р., Джадхав С. Б., Кад В. П. (2014). Последние достижения и разработки в области обработки и использования граната: обзор. J. Agric. Crop Sci. 1 1–17. [Google Scholar]
  • Ди Джакомо К., Ванелла Л., Сорренти В., Сантанджело Р., Барбагалло И., Калабрезе Г. и др. (2015). Эффекты tithonia diversifolia (Hemsl.) A.Серый экстракт о дифференцировке адипоцитов мезенхимальных стволовых клеток человека. PLoS One 10: e0122320. 10.1371 / journal.pone.0122320 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Фаволе О. А., Макунга Н. П., Опара Ю. Л. (2012). Метанольный экстракт кожуры плодов граната обладает антибактериальной, антиоксидантной и ингибирующей тирозиназой активностью. BMC Дополнение. Альтерн. Med. 12: 200. 10.1186 / 1472-6882-12-200 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Fischer U.А., Карл Р., Каммерер Д. Р. (2011). Идентификация и количественное определение фенольных соединений из кожуры граната ( Punica granatum L.), мезокарпа, арил и других соков с помощью HPLC-DAD-ESI / MS (n). Food Chem. 127 807–821. 10.1016 / j.foodchem.2010.12.156 [PubMed] [CrossRef] [Google Scholar]
  • Гил М. И., Томас-Барберан Ф. А., Хесс-Пирс Б., Холкрофт Д. М., Кадер А. А. (2000). Антиоксидантная активность гранатового сока и ее связь с фенольным составом и обработкой. J. Agric. Food Chem. 48 4581–4589. [PubMed] [Google Scholar]
  • Хоссин Ф. Л. А. (2009). Воздействие кожуры граната (Punica granatum) и его экстракта на крыс с ожирением и гиперхолестеринемией. Пак. J. Nutr. 8 1251–1257. 10.3923 / pjn.2009.1251.1257 [CrossRef] [Google Scholar]
  • Цзян Л., Чжан Н. X., Мо В., Ван Р., Ма К. Г., Ли X. и др. (2008). Ремания подавляет дифференцировку адипоцитов и адипогенез. Biochem. Биофиз. Res. Commun. 371 185–190.10.1016 / j.bbrc.2008.03.129 [PubMed] [CrossRef] [Google Scholar]
  • Кавада Т., Такахаши Н., Фушики Т. (2001). Биохимические и физиологические характеристики жировой клетки. J. Nutr. Sci. Витаминол. 47 1–12. [PubMed] [Google Scholar]
  • Кершоу Э. Э., Флиер Дж. С. (2004). Жировая ткань как эндокринный орган. J. Clin. Эндокринол. Метаб. 89 2548–2556. 10.1210 / jc.2004-0395 [PubMed] [CrossRef] [Google Scholar]
  • Ким С. Х., Плутцки Дж. (2016). Бурый жир и потемнение для лечения ожирения и связанных с ним нарушений обмена веществ. Diabetes Metab. J. 40 12–21. 10.4093 / dmj.2016.40.1.12 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лай С., Цай М. Л., Бадмаев В., Хименес М., Хо К. Т., Пан М. Х. (2012). Ксантиген подавляет дифференцировку преадипоцитов и адипогенез за счет подавления PPARgamma и C / EBP и модуляции путей SIRT-1, AMPK и FoxO. J. Agric. Food Chem. 60 1094–1101. 10.1021 / jf204862d [PubMed] [CrossRef] [Google Scholar]
  • Ли К.Дж., Чен Л. Г., Лян В. Л., Ван К. С. (2010). Противовоспалительное действие punica granatum Linne in vitro и in vivo. Food Chem. 118 315–322. [Google Scholar]
  • Лефтерова М. И., Лазарь М. А. (2009). Новые разработки в адипогенезе. Trends Endocrinol. Метаб. 20 107–114. 10.1016 / j.tem.2008.11.005 [PubMed] [CrossRef] [Google Scholar]
  • Лес Ф., Арбонес-Майнар Дж. М., Валеро М. С., Лопес В. (2018). Полифенолы граната и уролитин А ингибируют альфа-глюкозидазу, дипептидилпептидазу-4, липазу, накопление триглицеридов и гены, связанные с адипогенезом, в адипоцитоподобных клетках 3T3-L1. J. Ethnopharmacol. 220 67–74. 10.1016 / j.jep.2018.03.029 [PubMed] [CrossRef] [Google Scholar]
  • Ли Ю. Ф., Го К. Дж., Ян Дж. Дж., Вэй Дж. Ю., Сюй Дж., Ченг С. (2006). Оценка антиоксидантных свойств экстракта кожуры граната по сравнению с экстрактом мякоти граната. Food Chem. 96 254–260. [Google Scholar]
  • Ли З., Сумманен П. Х., Комория Т., Хеннинг С. М., Ли Р. П., Карлсон Э. и др. (2015). Эллагитаннины граната стимулируют рост кишечных бактерий in vitro: влияние на пребиотические и метаболические эффекты. Анаэроб 34 164–168. 10.1016 / j.anaerobe.2015.05.012 [PubMed] [CrossRef] [Google Scholar]
  • Лин Л. Т., Чен Т. Ю., Лин С. С., Чунг С. Ю., Лин Т. К., Ван Г. Х. и др. (2013). Противовирусная активность широкого спектра хебулаговой кислоты и пуникалагина против вирусов, которые используют гликозаминогликаны для проникновения. BMC Microbiol. 13: 187. 10.1186 / 1471-2180-13-187 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Lira F. S., Rosa J. C., Pimentel G. D., Seelaender M., Дамасо А. Р., Ояма Л. М. и др. (2012). И адипонектин, и интерлейкин-10 ингибируют LPS-индуцированную активацию пути NF-kappaB в адипоцитах 3T3-L1. Цитокин 57 год 98–106. 10.1016 / j.cyto.2011.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Лю Ю., Сюй Д., Инь С., Ван С., Ван М., Сяо Ю. (2018). Уровень IL-10 / STAT3 снижается при детском ожирении с гипертриглицеридемией и связан с уровнем триглицеридов у крыс с ожирением, вызванным диетой. BMC Endocr. Disord. 18:39.10.1186 / s12902-018-0265-z [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Moon Y. J., Soh J. R., Yu J. J., Sohn H. S., Cha Y. S., Oh S. H. (2012). Эффект ингибирования внутриклеточного накопления липидов Weissella koreensis OK1-6, выделенного из Kimchi, на дифференцирующиеся адипоциты. J. Appl. Microbiol. 113 652–658. 10.1111 / j.1365-2672.2012.05348.x [PubMed] [CrossRef] [Google Scholar]
  • Мосети Д., Регасса А., Ким В. К. (2016). Молекулярная регуляция адипогенеза и потенциальные антиадипогенные биоактивные молекулы. Внутр. J. Mol. Sci. 17: E124. 10.3390 / ijms17010124 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Нейринк А. М., Ван Хи В. Ф., Биндельс Л. Б., Де Бакер Ф., Кани П. Д., Делзен Н. М. (2013). Богатый полифенолами экстракт кожуры граната снимает воспаление тканей и гиперхолестеринемию у мышей с ожирением, вызванных диетой с высоким содержанием жиров: потенциальное влияние на микробиоту кишечника. Br. J. Nutr. 109 802–809. 10.1017 / S0007114512002206 [PubMed] [CrossRef] [Google Scholar]
  • Палмери Р., Монтелеоне Дж. И., Спанья Г., Рестучча К., Раффаэле М., Ванелла Л. и др. (2016). Экстракт оливковых листьев сицилийского сорта уменьшал накопление липидов, вызывая термогенный путь во время адипогенеза. Фронт. Pharmacol. 7: 143. 10.3389 / fphar.2016.00143 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Panichayupakaranant P., Tewtrakul S., Yuenyongsawad S. (2010). Антибактериальное, противовоспалительное и противоаллергическое действие стандартизированного экстракта кожуры граната. Food Chem. 123 400–403. 10.1055 / s-0030-1264706 [CrossRef] [Google Scholar]
  • Парк Дж. Э., О С. Х., Ча Ю. С. (2014). Lactobacillus brevis OPK-3, выделенный из кимчи, подавляет адипогенез и оказывает противовоспалительное действие в адипоцитах 3T3-L1. J. Sci. Продовольственное сельское хозяйство. 94 2514–2520. 10.1002 / jsfa.6588 [PubMed] [CrossRef] [Google Scholar]
  • Ку В., Брекса III А. П., Пан З., Ма Х. (2012). Количественное определение основных составляющих полифенолов в продуктах из граната. Food Chem. 132 1585–1591. 10.1016 / j.foodchem.2011.11.106 [PubMed] [CrossRef] [Google Scholar]
  • Раффаэле М., Барбагалло И., Ликари М., Карота Г., Сферраццо Г., Спампинато М. и др. (2018). N-ацетилцистеин (NAC) улучшает липидную метаболическую дисфункцию в адипоцитах, происходящих из стромальных клеток костного мозга. Evid. На основе дополнения. Альтерн. Med. 2018: 9. 10.1155 / 2018/5310961 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Редди М. К., Гупта С.К., Джейкоб М. Р., Хан С. И., Феррейра Д. (2007). Антиоксидантное, противомалярийное и противомикробное действие богатых танинами фракций, эллагитаннинов и фенольных кислот из Punica granatum L. Planta Med. 73 461–467. 10.1055 / с-2007-7 [PubMed] [CrossRef] [Google Scholar]
  • Ромео Ф. В., Баллистрери Г., Фаброни С., Пангалло С., Никосия М. Г., Шена Л. и др. (2015). Химическая характеристика различных экстрактов сумаха и граната, эффективных против гнили Botrytis cinerea. Молекулы 20 11941–11958. 10,3390 / молекул 200711941 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Розен Э. Д., Уолки К. Дж., Пуигсервер П., Шпигельман Б. М. (2000). Транскрипционная регуляция адипогенеза. Genes Dev. 14 1293–1307. [PubMed] [Google Scholar]
  • Салерно Л., Модика М. Н., Ромео Г., Питтала В., Сиракуза М. А., Амато М. Э. и др. (2012). Новые ингибиторы синтазы оксида азота с антиоксидантными свойствами. Eur.J. Med. Chem. 49 118–126. 10.1016 / j.ejmech.2012.01.002 [PubMed] [CrossRef] [Google Scholar]
  • Синглтон В. Л., Ортофер Р., Ламуэла-Равентос Р. М. (1999). Анализ общих фенолов и других субстратов окисления и антиоксидантов с помощью реактива Фолина – Чокальто. Methods Enzymol. 299 152–178. 10.1016 / S0076-6879 (99) 99017-1 [CrossRef] [Google Scholar]
  • Смит К. Б., Смит М. С. (2016). Статистика ожирения. Prim Care 43 год 121–135. 10.1016 / j.поп.2015.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Стечшульте Л. А., Хайндс Т. Д., мл., Худер С. С., Шоу В., Наджар С. М., Санчес Э. Р. (2014). FKBP51 контролирует клеточный адипогенез посредством опосредованного p38 киназой фосфорилирования GRalpha и PPARgamma. Мол. Эндокринол. 28 год 1265–1275. 10.1210 / мне.2014-1022 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Su X., Howell A. B., D’Souza D. H. (2012). Антибактериальные эффекты растительных экстрактов на устойчивый к метициллину Staphylococcus aureus. Патогенные микроорганизмы пищевого происхождения. Дис. 9 573–578. 10.1089 / fpd.2011.1046 [PubMed] [CrossRef] [Google Scholar]
  • Табаско Р., Санчес-Патан Ф., Монагас М., Бартоломе Б., Виктория Морено-Аррибас М., Пелаез К. и др. (2011). Влияние полифенолов винограда на рост молочнокислых бактерий и бифидобактерий: устойчивость и метаболизм. Food Microbiol. 28 год 1345–1352. 10.1016 / j.fm.2011.06.005 [PubMed] [CrossRef] [Google Scholar]
  • Тегеранифар А., Селахварзи Ю., Харрази М., Бахш В.J. (2011). Высокий потенциал побочных продуктов агропромышленного производства граната ( Punica granatum L.) как мощных противогрибковых и антиоксидантных веществ. Ind. Сельскохозяйственная продукция 34 1523–1527. 10.1016 / j.indcrop.2011.05.007 [CrossRef] [Google Scholar]
  • Ванелла Л., Барбагалло И., Аквавива Р., Ди Джакомо К., Кардил В., Абрахам Н. Г. и др. (2013a). Эллаговая кислота: цитодифференцирующие и антипролиферативные эффекты в клеточных линиях рака предстательной железы человека. Curr. Pharm.Des. 19 2728–2736. [PubMed] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Кардил В., Ким Д. Х. и др. (2013b). Маркеры апоптоза в клеточной линии рака простаты: эффект эллаговой кислоты. Онкол. Реп. 30 2804–2810. 10.3892 / или 2013.2757 [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Ли Вольти Г., Кардил В. и др. (2013c). Влияние эллаговой кислоты на ангиогенные факторы в клетках рака простаты. Раки 5 726–738. 10.3390 / раки5020726 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Сэнфорд К., мл., Ким Д. Х., Абрахам Н. Г., Эбрахейм Н. (2012). Окислительный стресс и гемоксигеназа-1 регулируют дифференцировку мезенхимальных стволовых клеток человека. Внутр. J. Hypertens. 2012: 8. 10.1155 / 2012/8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Waldman M., Bellner L., Vanella L., Schragenheim J., Sodhi K., Singh S.P., et al. (2016). Эпоксиэйкозатриеновые кислоты регулируют дифференцировку адипоцитов клеток 3T3 мыши посредством активации PGC-1alpha, которая необходима для экспрессии HO-1 и увеличения функции митохондрий. Stem Cells Dev. 25 1084–1094. 10.1089 / scd.2016.0072 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ван Ю. В., Джонс П. Дж. (2004). Конъюгированная линолевая кислота и контроль ожирения: эффективность и механизмы. Внутр. J. Obes. Relat. Метаб. Disord. 28 год 941–955.10.1038 / sj.ijo.0802641 [PubMed] [CrossRef] [Google Scholar]
  • Сюй К. З., Чжу К., Ким М. С., Ямахара Дж., Ли Ю. (2009). Цветок граната уменьшает ожирение печени у животных с диабетом 2 типа и ожирением. J. Ethnopharmacol. 123 280–287. 10.1016 / j.jep.2009.03.035 [PubMed] [CrossRef] [Google Scholar]

Положительное влияние экстракта кожуры граната и пробиотиков на преадипоцитную дифференцировку

Front Microbiol. 2019; 10: 660.

Валерия Сорренти

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Cinzia Lucia Randazzo

2 Dipaziena Di мы Università di Catania, Катания, Италия

Cinzia Caggia

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

Gabriele Ballistreri

) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Флора Валерия Ромео

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Симона Фаброни

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок и цитрусовых and Tree Fruit, Ачиреале, Италия

Николина Тимпанаро

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливковых, цитрусовых и древесных фруктов, Ачиреале, Италия

Марко Рафаэле

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Luca Vanella

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия , Италия Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

3 Совет по сельскохозяйственным исследованиям и исследованиям в области сельского хозяйства Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Под редакцией: Розальба Ланчотти, Болонский университет, Италия 90 003

Рецензент: Анна Реале, Институт науки и технологий (ISA), Италия; Коши Филип, Малайский университет, Малайзия

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы микробиологии»

Поступила в редакцию 22 октября 2018 г .; Принята в печать 15 марта 2019 г.

Авторские права © 2019 Сорренти, Рандаццо, Каджия, Баллистрери, Ромео, Фаброни, Тимпанаро, Раффаэле и Ванелла.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Благоприятные эффекты граната обусловлены содержанием эллагитаннинов и антоцианов, которые защищают от множества заболеваний, включая воспалительные. Многие исследователи сообщают, что экстракты отходов граната (кожуры и семян), полученные из отходов промышленной переработки, обладают акцептором свободных радикалов и обладают мощной антиоксидантной способностью. Экстракты граната (ПЭ) также обладают антибактериальной, противовирусной, гиполипидемической и противовоспалительной биоактивностью благодаря содержанию полифенольных соединений, включая пуникалагины, галловую кислоту и производные эллаговой кислоты.В центре внимания данной рукописи было изучение пребиотического потенциала PE, растворимого в воде и охарактеризованного с помощью HPLC – PDA – ESI / MS n на предмет его фенольного содержания. Более того, поскольку сообщалось, что экстракты граната снижали уровень липидов в крови и что было показано, что ряд пробиотических штаммов влияет на адипогенез в культуре клеток, это исследование также было выполнено для проверки in vitro эффектов PE и пробиотик L.rhamnosus GG ATCC 53103 (LGG) на линии клеток 3T3-L1. PE и пробиотики существенно снижали содержание триглицеридов и увеличение внутриклеточных липидов по сравнению с контрольной группой. Однако комбинированная обработка отработанного бульона (SB), фильтрованного через PE и LGG, была наиболее эффективной в снижении содержания триглицеридов и накопления внутриклеточных липидов. Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно ниже в клетках 3T3-L1, обработанных PE и SB, отфильтрованных через LGG.Эти результаты свидетельствуют о том, что синергетический эффект пробиотиков и полифенолов, содержащихся в PE, может повлиять на адипогенез in vitro, и может способствовать разработке новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Ключевые слова: лактобацилл, антимикробная активность, экстракт граната, дифференциация адипоцитов, комбинирование продуктов

Введение

Гранат — это фрукт, положительное влияние на здоровье которого было тщательно изучено.Этот фрукт богат биологически активными соединениями, такими как эллагитаннины и антоцианы, которые защищают от дегенеративных заболеваний. Плод граната из-за его высокой питательной ценности, пользы для здоровья и биоактивных антиоксидантных соединений считается пищевым лекарством. Фактически, гранат широко используется в фитотерапии при нескольких патологиях, включая грипп и инфекции верхних дыхательных путей. Все части плодов граната, то есть кожура и семена, рассматриваемые как отходы, могут быть переработаны для получения продуктов с добавленной стоимостью, имеющих промышленную, медицинскую и косметическую ценность (Dhumal et al., 2014).

Отходы граната образуются на всех этапах жизненного цикла плодов, то есть во время сельскохозяйственного производства, промышленного производства и переработки. Можно использовать побочные продукты граната, поскольку они являются богатым источником биологически активных соединений, таких как флавоноиды, фенольные кислоты и дубильные вещества. Более того, многие исследователи описали, что экстракты граната, изготовленные из побочных продуктов перерабатывающих предприятий, обладают эффективным улавливанием свободных радикалов и антиоксидантной способностью (Lee et al., 2010; Panichayupakaranant et al., 2010; Fischer et al., 2011).

Кроме того, экстракты граната действуют как естественные ингибиторы патогенов, бактерий и грибков (Al-Zoreky, 2009; Tehranifar et al., 2011; Romeo et al., 2015).

Эллагитаннины граната гидролизуются микробиотой кишечника до более мелких фенольных соединений, таких как эллаговая кислота. Затем эллаговая кислота всасывается в кровоток, в то время как эллагитаннины не всасываются и метаболизируются в уролитины.

Сообщалось, что побочные продукты граната и пуникалагины в значительной степени способны подавлять рост патогенных Escherichia coli , Pseudomonas aeruginosa , Clostridia и Staphylococcus aureus (Reddy et al., 2007; Bialonska et al., 2009) и для увеличения роста полезных бактерий, включая Bifidobacterium spp. и Lactobacillus spp. (Reddy et al., 2007; Bialonska et al., 2010).

Экстракты граната также снижают уровень липидов в крови и обладают значительной противоопухолевой, противовирусной и противовоспалительной активностью (Li et al., 2006; Hossin, 2009; Lin et al., 2013; Bassiri- Джахроми, 2018).

Эти потенциальные полезные эффекты приписываются полифенольным соединениям, которые содержатся в экстрактах граната, включая пуникалагины, галловую кислоту и производные эллаговой кислоты (Vanella et al., 2013а, б, в; Romeo et al., 2015).

Поскольку ожирение является одной из основных проблем общественного здравоохранения, необходимы новые превентивные стратегии (Smith and Smith, 2016).

Адипоциты играют важную роль в начале или развитии метаболических осложнений, связанных с ожирением, таких как метаболический синдром и диабетические осложнения (Kim and Plutzky, 2016).

Интерес исследователей к выявлению натуральных продуктов, полученных из диетических растений, обладающих активностью против ожирения, возрос.Сообщалось, что ксантиген и фукоксантин, природные соединения масла косточек граната, значительно подавляли дифференцировку адипоцитов и накопление липидов (Lai et al., 2012).

Настоящая рукопись посвящена прежде всего изучению антиоксидантной и антимикробной активности, а также пребиотического потенциала ПЭ, богатого фенольными соединениями. Более того, обогащенный стандартизованный полиэтилен, содержащий высокий процент природных антиоксидантов граната, был химически охарактеризован с помощью ВЭЖХ – PDA – ESI / MSn.Во-вторых, поскольку гранатовый сок (Les et al., 2018) и различные типы экстрактов граната (PE), включая экстракт, полученный из цельного фрукта (Li et al., 2015), и экстракт, полученный из кожуры граната (Neyrinck et al., 2013), и было показано, что ряд пробиотических штаммов (Moon et al., 2012; Park et al., 2014) влияют на адипогенез, это исследование было проведено для проверки in vitro эффектов PE, пробиотика L rhamnosus GG ATCC 53103 (LGG), предварительно инкубированные с PE, отдельно или в комбинации, при дифференцировке клеток 3T3-L1.

Материалы и методы

Химические вещества

Порошкообразный экстракт граната (Dermogranate ® ), использованный в этом исследовании, был предоставлен Medinutrex (Катания, Италия). Вкратце, экстракт готовили из сушеных и измельченных плодов граната, смешанных с водно-спиртовыми растворами (пищевой), а затем фильтровали. Фильтрат концентрировали и затем сушили распылением для получения стандартизованного экстракта. Экстракт Dermogranate ® имел следующий химический состав: общие полифенолы (16%), пуникалагины (8%), эллаговая кислота и производные (8%).

Реагент Фолина – Чокальтеу (FCR), карбонат натрия (Na 2 CO 3 ), галловая кислота, пуникалин (смесь аномеров), пуникалагин и эллаговая кислота были приобретены у Sigma-Aldrich (Милан, Италия). Гранатин Б был приобретен у LGC Standards (Лондон, Великобритания). Для хроматографии использовали растворители степени чистоты для ВЭЖХ – МС (Merck KgaA, Дармштадт, Германия), а все остальные реагенты были аналитической чистоты.

Определение общего содержания полифенолов

Анализ Folin – Ciocalteu (Singleton et al., 1999) был использован для определения общего содержания полифенолов с небольшими модификациями. 0,1 мг / мл экстракта растворяли в дистиллированной воде. Затем к 500 мкл образца добавляли 5 мл 10% FCR и 4,5 мл раствора Na 2 CO 3 (7,5% мас. / Об.). Конечный раствор перемешивали в течение 2 часов в темноте, а затем измеряли Abs при λ = 765 нм. Анализы проводили в трех экземплярах, и общую концентрацию полифенолов выражали в граммах эквивалентов галловой кислоты (GAE) / 100 г экстракта.

HPLC – PDA – ESI / MS

n Анализ фенольных соединений

Разделение и количественное определение фенольных соединений выполняли, как описано ранее (Romeo et al., 2015). Для идентификации фенольных соединений времена удерживания (RT), спектры и данные МС в режиме отрицательного ESI сравнивали с данными аутентичных стандартов. Количественное определение каждого фенольного соединения проводили с использованием соответствующего стандарта в качестве внешнего стандарта. Количественное определение галловой кислоты проводили при 280 нм.Пуникалины, гранатин В, пуникалагины и эллаговая кислота определялись количественно при 378 нм; та же длина волны использовалась для количественного определения производных эллаговой кислоты с использованием эллаговой кислоты в качестве стандарта сравнения. Анализы проводили в трех экземплярах, и результаты выражали в г соединения / 100 г экстракта.

Тушение DPPH

Способность улавливать свободные радикалы различных концентраций экстракта PE (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) измеряли по 2, Безрадикальный метод 2-дифенил-1-пикрилгидразилгидрата (DPPH), как сообщалось ранее (Salerno et al., 2012). Результаты выражены в процентах от степени ингибирования ± SD .

Влияние поглотителя на супероксид-анион

Способность экстракт ПЭ различных концентраций улавливать супероксид-анион (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) определялась как сообщалось ранее (Салерно и др., 2012). Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Мышиные преадипоциты 3T3-L1 Жизнеспособность клеток

Мышиные преадипоциты 3T3-L1 были приобретены в Американской коллекции типовых культур (Роквилл, Мэриленд, США).Клетки высевали в концентрации 2 × 10 5 клеток на лунку 96-луночного микропланшета и культивировали при 37 ° C в инкубаторе с 5% CO 2 в течение 48 часов в отсутствие и в присутствии различных концентраций ЧП сообщалось выше. Жизнеспособность клеток измеряли с помощью анализа МТТ, как сообщалось ранее (Di Giacomo et al., 2015). МТТ, желтый тетразол, в живых клетках восстанавливается до пурпурного формазана. Результаты выражены в процентах формазана, продуцированного в обработанных мышиных преадипоцитах 3T3-L1 по сравнению с необработанными клетками.

Микробиология

Бактериальное культивирование

Использовали коммерческие штаммы патогенов E. coli ATCC 25922, S. aureus ATCC 29213, Listeria innocua ATCC 33090 и Salmonella enterica ATCC 14028. Штамм E. coli выращивали в бульоне Лурия-Бертани (LB) при 37 ° C в течение ночи; S. aureus , S. enterica и L. innocua обычно выращивали в течение ночи в триптон-соевом бульоне (TSB) при 37 и 30 ° C соответственно.Все материалы и приложения предоставлены Oxoid (Милан, Италия).

Коммерческие пробиотические штаммы LGG, Bifidobacterium animalis BB12, B. longum BB536 и дикий штамм Lactobacillus paracasei N 24, выделенные из кротонского сыра пекорино, культивировали в бульоне Демана – Рогоза – Шарпа (MRS). при 37 ° C в течение ночи.

Ночные бактериальные культуры инкубировали при 37 ° C в течение 24 часов в анаэробных условиях, пока они не достигли плотности клеток приблизительно 1.0 × 10 9 КОЕ / мл.

Определение скорости роста

На основании результатов, полученных по активности PE в качестве акцептора свободных радикалов, и экспериментов по жизнеспособности преадипоцитов мышей 3T3-L1, для обработки штаммов пробиотиков или патогенов, как описано ниже, использовали различные концентрации.

Антимикробная активность PE оценивалась против коммерческих штаммов патогенов, упомянутых выше. Ночные культуры патогенов совместно культивировали при 37 ° C в течение 24 ч с PE в различных концентрациях (1.7–0,34–0,17 мг / мл), а антимикробную активность оценивали подсчетом живых бактерий на чашках и выражали в КОЕ / мл.

Влияние PE на рост пробиотических штаммов, упомянутых выше, оценивали при совместном культивировании пробиотических штаммов с плотностью клеток приблизительно 1,0 × 10 9 КОЕ / мл с PE в различных концентрациях (0,085–0,042– 0,028 мг / мл). Влияние экстракта на рост пробиотических штаммов оценивали после инкубации при 37 ° C в течение 24 часов в анаэробных условиях путем посева живых бактерий и выражали в КОЕ / мл.

Все эксперименты проводились в двух экземплярах, а результаты выражались в виде средних значений и стандартного отклонения. Основываясь на предварительных результатах, для последующего анализа была выбрана LGG.

Свежие бульонные культуры центрифугировали при 5000 об / мин в течение 10 минут при 4 ° C, супернатант декантировали для сбора отработанного бульона (SB), который фильтровали (FSB) с использованием фильтра 0,22 мкм и затем использовали для дальнейшего использования. анализы.

Бактериальный осадок ресуспендировали в 1 мл PBS и пять раз обрабатывали ультразвуком с амплитудой 44% в течение 2 мин с 6 мин отдыха.Затем обработанный ультразвуком центрифугировали при 1100 × g в течение 15 мин при 4 ° C. Супернатант собирали, фильтровали через фильтр 0,22 мкм и меченный экстракт бактериальных клеток (CE). CE использовался для дальнейшего анализа.

Культура клеток и дифференцировка клеток адипоцитов

Преадипоциты мышей 3T3-L1 ресуспендировали в среде Игла, модифицированной Дульбекко (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS, Invitrogen, Карлсбад, Калифорния, США) и 1% антибиотика. / антимикотический раствор (Invitrogen, Карлсбад, Калифорния, США) и высевали в колбу размером 75 см 2 при плотности от 1 до 2 × 10 4 клеток.Дифференцировку клеток адипоцитов получали, как сообщалось ранее (Waldman et al., 2016).

Дифференцирующиеся преадипоциты 3T3-L1 обрабатывали в течение 7 дней PE (0,028 мг / мл), LGG CE (25 мкг / мл) и SB, профильтрованным через LGG (10 мкг / мл) из ночной бактериальной культуры, инкубированной с или без ПЭ (0,028 мг / мл).

Количественное определение содержания липидов

Для количественной оценки накопления липидов проводили масляное красное окрашивание, как сообщалось ранее (Barbagallo et al., 2017). Образование липидных капель измеряли с помощью инвертированного многоканального светодиодного флуоресцентного микроскопа (Evos, Life Technologies, Гранд-Айленд, Нью-Йорк, США).

Экстракция

РНК и qRT-PCR

Экспрессии адипонектина, PPAR-γ, SREBP, FAS, IL-6 и IL-10 оценивали с помощью ПЦР в реальном времени. РНК экстрагировали и количественно оценивали, как сообщалось ранее (Raffaele et al., 2018). Использовали соответствующие последовательности праймеров (). Относительный уровень экспрессии мРНК измеряли по значению порогового цикла (Ct) каждого продукта ПЦР и нормализовали с таковым для GAPDH с использованием сравнительного метода 2 -ΔΔCt .

Таблица 1

Праймеры для ПЦР, использованные в этом исследовании.

Gene Прямой праймер Обратный праймер
Адипонектин GAAGCCGCTTATGTGTATCGC GAATGGGTACATTGGGAACAGT
IL-6 TTCCTCTCTGCAAGAGACTTCC AGGAGAGCATTGGAAATTGGGG
FAS GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
GAPDH AGCTTCGGCACATATTTCATCTG CGTTCACTCCCATGACAAACA
IL-10 GCTGGACAACATACTGCTAACC ATTTCCGATAAGGCTTGGCAA
SREBP-1 GATGTGCGAACTGGACACAG CATAGGGGGCGTCAAACAG
PPAR-γ TCGCTGATGCACTGCCTATG ACCTGATGGCATTGTGAGACAT

Статистический анализ

Статистический анализ множественных сравнений был выполнен e Метод Фишера. P — значения ниже 0,05 были приняты как значимые. Данные были проанализированы с использованием либо однофакторного дисперсионного анализа (ANOVA) для нескольких групп, либо непарного t -теста для двух групп, и результаты представлены в виде среднего значения ± стандартное отклонение.

Результаты

HPLC – PDA – ESI / MS

n Анализ PE

Фенольный профиль PE () включал определение 1 гидроксибензойной кислоты и 19 эллагитаннинов. Основные пики соответствовали пуникалину (пик 4), гранатину B (пик 6), пуникалагину A и B (пики 10 и 14) и эллаговой кислоте (пик 19) ().Выявлено также присутствие галловой кислоты (пик 1) и производных эллаговой кислоты (пики 2, 3, 5, 7–9, 11–13, 15–18, 20). Как показано на хроматограмме, эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожуры), поскольку они составляют более 99% от общего содержания фенольных соединений граната. Пуникалагины, основные эллагитаннины побочных продуктов граната, составляли 47,6% от общего содержания фенольных соединений в ПЭ (). Производные эллаговой кислоты, эллаговая кислота и другие второстепенные фенольные соединения (пуникалин, гранатин B и галловая кислота) составили 38.4, 10,2 и 3,8% от общего содержания фенолов в ПЭ соответственно ().

ВЭЖХ-хроматограмма фенольных соединений ПЭ, обнаруженных при 378 нм. Об идентификации пиков см.

Таблица 2

Список пиков и количественное определение фенольных соединений в ПЭ.

0,07 0,07 966 9,5 9 9278 9027 301 9027 0,027 603 603 Ead d 8 9278 9027 0278 9027 9027 0278 9 9027 35,4 Ead d 902 7.82 фенол
Номер пика a RT (мин) λ (нм) [M – H] ( м / z ) MS n ( m / z ) Фенольные соединения г / 100 г b
1 3.9 269,310 169 125 Кислота галловая 0,07 ± 0,02
2 4,1 255,364 301 301 3 7,0 255,363 301 Ead ​​ d 0,41 ± 0,04
4 7,3 263,364403 9027 601 9027 9027 9027 P 263,36440727 ± 0,04
5 8,4 264,366 301 Ead ​​ d 0,19 ± 0,09
6
Гранатин В 0,28 ± 0,03
7 10,4 259,361 301 Ead ​​ d 0,02 ± 0,01 257,360 301 Ead ​​ d 0,05 ± 0,01
9 13,5 256,362
10 14,0 258,378 1083 781/601 Пуникалагин А 3,05 ± 0,05
11 15,1
15,1
0.13 ± 0,09
12 15,9 257,361 301 Ead ​​ d 0,95 ± 0,03
13
2,69 ± 0,11
14 17,7 257,378 1083 781/601 Пуникалагин B 4,77 ± 0,21 4,77 ± 0,21 257,362 301 Ead ​​ d 0,12 ± 0,01
16 25,2 256,363
17 29,3 254,361 301 Ead ​​ d 0,17 ± 0,01
18 32,2 32,2
0.08 ± 0,03
19 33,6 256,367 301 229/185 Эллаговая кислота 1,68 ± 0,01
20 9027
0,08 ± 0,02
Всего полифенолов c 16,48 ± 2,49
Производные эллаговой кислоты 6,31
Эллаговая кислота 0,62
Всего 16.43

Масс-спектрометрические свойства 20 идентифицированных фенольных соединений (пики 1–20) показаны на рис. Как сообщалось ранее (Romeo et al., 2015), наблюдались две изомерные формы (A и B) пуникалагинов (пики 10 и 14), а также было подчеркнуто присутствие гранатина B (пик 6). Кроме того, эти соединения также были охарактеризованы прямым анализом отрицательных ионов для инфузии ESI / MS n стандартных соединений.Пик 4 был идентифицирован как пуникалин ( m / z 781), тогда как пики 2, 3, 5, 7–9, 11–13, 15–18 и 20 были идентифицированы как производные эллаговой кислоты в соответствии с их УФ – видимой областью и массой. характеристики (λ max около 370 нм и фрагмент MS 1 на мкм / z 301, соответствующий эллаговой кислоте).

Активность PE по улавливанию свободных радикалов

Антиоксидантная активность PE проверялась по их способности восстанавливать стабильный радикал DPPH.

В частности, процент ингибирования DPPH достигал 75% при концентрациях ниже 0.21 мг / мл (76,78, 79 и 80% соответственно при концентрации ПЭ 0,17-0,11-0,085 и 0,028 мг / мл). При концентрациях выше 0,21 мг / мл процент ингибирования DPPH был ниже ().

Активность ПЭ по улавливанию радикалов DPPH в различных концентрациях. Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Экстракт граната ингибировал образование супероксид-аниона дозозависимым образом (). Как правило, в этом тесте PE оказался более эффективным, чем в предыдущем.Это может быть связано с меньшим размером супероксид-аниона по сравнению с радикалом DPPH.

Таблица 3

Активность по улавливанию супероксидных ионов при различных концентрациях ПЭ.

78 ± 2
концентрации PE % ингибирования концентрации PE % ингибирования
PE (3,4 мг / мл) 65 ± 2 PE (0,21 мг / мл)
PE (1,7 мг / мл) 73 ± 3 PE (0.17 мг / мл) 80 ± 1
PE (0,85 мг / мл) 75 ± 1 PE (0,11 мг / мл) 85 ± 3
PE (0,56 мг / мл ) 70 ± 2 PE (0,085 мг / мл 88 ± 4
PE (0,42 мг / мл) 68 ± 1 PE (0,028 мг / мл) 95 ± 1
PE (0,34 мг / мл) 75 ± 4

Влияние PE на жизнеспособность клеток 3T3-L1

3- (4,5-диметилтиазол ил) -2,5-дифенилтетразолийбромид (МТТ) проводили для оценки жизнеспособности клеток 3T3-L1.Результаты показывают значительное снижение жизнеспособности клеток при высоких концентрациях PE (3,4, 1,7, 0,85, 0,56 и 0,42 мг / мл), тогда как при более низких (0,34, 0,21, 0,17, 0,11 и 0,085 мг / мл) концентрациях наблюдается умеренная ингибирующий эффект и концентрация 0,028 мг / мл не оказали значительного влияния на жизнеспособность клеток преадипоцитов мышей 3T3-L1 ().

Процент выживаемости преадипоцитов мышей 3T3-L1 в присутствии PE в различных концентрациях. Результаты выражены как среднее значение ± стандартное отклонение четырех экспериментов, проведенных в трех повторностях.Значимые по сравнению с необработанными контролями: p <0,005; ∗∗ p <0,05.

Microbiology

Антимикробная активность PE в отношении штаммов патогенов

Данные анализа совместного культивирования показали, что патогены были по-разному чувствительны к PE. В деталях, как показано в, экстракт в концентрации 1,7 мг / мл показал наивысшую антимикробную активность против всех патогенов со значительным снижением на L. innocua (проксимально 4 log единицы).При концентрации 0,34 мг / мл экстракт был эффективен против E. coli , L. innocua и S. aureus , демонстрируя снижение плотности клеток на 1 и 2 log единицы соответственно. Когда PE тестировали при концентрации 0,17 мг / мл, штаммы S. aureus , S. enterica и L. innocua все еще подавлялись, в то время как рост E. coli не подвергался значительному влиянию.

Противомикробная активность PE различной концентрации в отношении патогенов, обнаруженных в T24 (24 ч инокулята).Плотность клеток выражается как Δlog КОЕ / мл.

Эффект PE на рост пробиотических штаммов

Результаты, показанные в, подчеркнули, что PE, при всех испытанных концентрациях, не обладал какой-либо ингибирующей активностью в отношении роста испытанных пробиотических штаммов. Небольшое увеличение роста наблюдалось для LGG, совместно культивируемых с PE в концентрации 0,028 мг / мл ().

Таблица 4

Количество бактерий, выраженное в логарифме 10 КОЕ / мл в трех повторностях ± стандартное отклонение L. rhamnosus GG ATCC 53103, Bifidobacterium animalis BB12, B.longum BB536 и дикий штамм Lactobacillus paracasei N 24 после инкубации с PE в различных концентрациях.

90CC3 ) 9027 a 9027 9027 9040 мг 9,57 ± 0,12 a
Журнал 10
L. rhamnosus GG Исходный уровень 8,83 ± 0,09 a

3

9,20 ± 0,10 b
PE (0.042 мг / мл) 9,24 ± 0,07 b
PE (0,028 мг / мл) 9,26 ± 0,04 b
Lactobacillus paracase8
Lactobacillus paracasei
N24 PE (0,085 мг / мл) 8,70 ± 0,08 a
PE (0,042 мг / мл) 8,79 ± 0,10
PE (0.028 мг / мл) 8,74 ± 0,09 a
Bifidobacterium animalis Исходный уровень 9,15 ± 0,05 a
BB40 0,12 a
PE (0,042 мг / мл) 9,44 ± 0,10 b
PE (0,028 мг / мл) 9,55 ± 0,07 9027 b Б.longum Исходный уровень 9,77 ± 0,03 a
BB536 PE (0,085 мг / мл) 9,54 ± 0,10 a
PE (0,028 мг / мл) 9,44 ± 0,16 a

Влияние полиэтилена и экстракта LGomenate на содержание липидов 9000Ggranate 9000Ggrana 9 фильтрованный SB значительно снизил содержание триглицеридов по сравнению с контрольной группой ().Однако эффект отфильтрованного SB, полученного из клеток, инкубированных с PE (LGG-T1) или без него (LGG-T0), был аналогичным. Одновременная обработка преадипоцитов мышей 3T3-L1 SB, отфильтрованным через PE и LGG, значительно снизила содержание триглицеридов по сравнению с обработкой только SB, отфильтрованного через LGG. Более того, эти данные свидетельствуют о том, что комбинированное лечение PE и LGG-T1 было наиболее эффективным для снижения содержания триглицеридов и накопления внутриклеточных липидов.

(A) Типичное масляное красное окрашивание O клеток 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE. (B) Содержание липидов определяли количественно с помощью окрашивания Oil Red O (среднее ± SD , p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с LGG T0 + PE).

Обработка преадипоцитов мышей 3T3-L1 клеточным экстрактом LGG (CE), полученным из клеток, инкубированных с PE (CE + PE) или без него (CE), не оказала влияния на накопление внутриклеточных липидов по сравнению с контрольной группой ( Контроль: ABS 490 нм = 0.200 ± 0,07; CE: ABS 490 нм = 0,187 ± 0,09; CE + PE = ABS 490 нм = 0,190 ± 0,05).

Влияние PE на адипогенные маркеры

Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно менее выражены в клетках 3T3-L1, обработанных SB, отфильтрованным через PE и LGG. В частности, PE, LGG-T0 и LGG-T1 были способны снижать уровни гена адипонектина, PPAR-γ, SREBP, FAS и IL-6 и повышать уровни гена IL-10 ().

(A – F) Анализ экспрессии генов с помощью qRT-PCR липогенного пути в клетках 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE.Результаты выражены в виде среднего значения ± стандартное отклонение четырех экспериментов, выполненных в трех повторностях ( * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с контролем. LGG T0 + PE).

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно снизила уровни экспрессии мРНК основных транскрипционных факторов, участвующих в адипогенезе, по сравнению с обработкой SB, отфильтрованных через LGG ( LGGT0 и LGGT1) отдельно ().

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно повысила уровни экспрессии мРНК IL10 по сравнению с обработкой только SB (LGGT0 и LGGT1), профильтрованных через LGG ( ). Более того, эти данные свидетельствуют о том, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10 (2).

Обсуждение

Благоприятные эффекты употребления плодов граната и / или сока вызвали значительный научный интерес (Basu and Penugonda, 2009).Многие исследователи сообщают, что полиэтилены, полученные из отходов перерабатывающих предприятий, обладают способностью улавливать свободные радикалы и обладают мощной антиоксидантной способностью (Panichayupakaranant et al., 2010; Fischer et al., 2011). ПЭ, использованный в настоящем исследовании, был растворим в воде и охарактеризован с помощью ВЭЖХ – PDA – ESI / MS n по содержанию фенолов и антоцианов. В соответствии с предыдущими сообщениями (Fischer et al., 2011; Qu et al., 2012; Romeo et al., 2015) эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожура), поскольку они составляют более 99% от общего содержания фенольных соединений граната.Основными эллагитаннинами побочных продуктов граната, а также продуктов из граната (фруктов и соков) являются пуникалагины (Gil et al., 2000; Fischer et al., 2011; Qu et al., 2012).

Экстракт граната содержит высокий процент фенольных соединений и проявляет антиоксидантную активность в зависимости от концентрации, как показано для анализа как DPPH, так и анализа поглощения супероксид-анионов.

Сообщалось, что диетические полифенолы растений способны избирательно модулировать рост чувствительных микроорганизмов (Tabasco et al., 2011). Экстракты растений обычно подавляют рост бактерий, но степень эффекта зависит от состава экстракта и типа бактериального штамма.

Результаты, полученные в условиях наших экспериментов, продемонстрировали, что высокие концентрации полифенолов граната оказывают противомикробное действие на некоторые штаммы патогенов, такие как L. innocua и S. aureus. Эти результаты согласуются с исследованиями Panichayupakaranant et al. (2010), Fawole et al.(2012) и Su et al. (2012).

Однако при концентрациях PE ниже 0,34 мг / мл, хотя не было обнаружено концентраций ингибирующей активности в отношении штаммов пробиотиков, оценивалось только небольшое увеличение роста LGG. Эти результаты не согласуются с исследованиями Li et al. (2015) и Neyrinck et al. (2013), которые продемонстрировали, что полифенолы граната потенциально могут работать как пребиотики.

Ожирение — это состояние, при котором накопление липидов приводит к расширению жировой ткани, которая действует как метаболический и эндокринный орган.Молекулярные механизмы, которые модулируют рост, дифференцировку и липогенез преадипоцитов жировых клеток, были предметом обширных исследований (Vanella et al., 2012; Stechschulte et al., 2014; Moseti et al., 2016; Palmeri et al., 2016; Waldman et al., 2016; Carpene et al., 2018).

Во время дифференцировки адипоцитов преадипоциты дифференцируются в зрелые адипоциты (Lefterova, Lazar, 2009). Повышенное накопление жира сильно коррелирует с количеством клеток и / или размером адипоцитов (Jiang et al., 2008).

Сообщалось, что степень ожирения связана с дифференцировкой преадипоцитов в адипоцитах и ​​с увеличением адипоцитов в жировой ткани (Wang and Jones, 2004).

Другие авторы сообщили, что PEs способны подавлять дифференцировку преадипоцитов и адипогенез и уменьшать жировую дистрофию печени у крыс с ожирением и диабетом 2 типа (Xu et al., 2009).

В соответствии с данными Moon et al. (2012) и Park et al. (2014) в наших экспериментальных условиях PE, LGG-T0 и LGG-T1 приводили к значительному снижению накопления липидов в клетках 3T3-L1 во время дифференцировки в адипоциты, предполагая, что PE, LGG-T0 и LGG-T1 способны подавлять дифференцировка адипоцитов.Однако обработка LGG-фильтрованным SB, полученным из клеток, инкубированных с PE (LGG-T1) или без (LGG-T1), была аналогичной. В наших экспериментальных условиях фактически не наблюдалось пребиотического эффекта, продемонстрированного другими авторами. Более того, комбинированное лечение PE и LGG-T1 было наиболее эффективным в снижении внутриклеточного накопления липидов. Эти данные демонстрируют, что, даже если в наших экспериментальных условиях не наблюдалось пребиотического эффекта, фильтрованный SB, полученный из LGG, инкубированного с PE (LGG-T1), мог бы содержать, помимо полезных бактериальных секретируемых биоактивных соединений, также небольшие количества PE- производные биоактивные соединения.Последний, присутствующий в небольших количествах в LGG-T1, не будет иметь более сильных положительных эффектов, чем LGG-T0, но в сочетании с PE может иметь потенциальные синергетические преимущества для здоровья.

Адипоцит-специфический рецептор, активируемый пролифератором пероксисом-γ (PPARγ), участвует в ранней стадии дифференцировки адипоцитов (Rosen et al., 2000), регулируя экспрессию адипогенных генов, таких как синтаза жирных кислот (FAS) и регуляторный элемент стерола. -связывающие белки (SREBP), а затем запускают накопление жира в клетках (Kawada et al., 2001; Бергер и Моллер, 2002).

Жировая ткань — это не только первичный резервуар жира, но и эндокринный орган, контролирующий гомеостаз липидов. Измененные уровни адипокинов жировой ткани могут способствовать развитию воспаления, что приводит к нарушению липидного обмена (Armani et al., 2010). При хроническом воспалении провоспалительные цитокины, такие как IL-6, активируются, тогда как противовоспалительные цитокины, такие как IL-10, подавляются (Kershaw and Flier, 2004; Bradley et al., 2008; Лира и др., 2012; Лю и др., 2018).

Наши результаты демонстрируют, что комбинированное лечение PE + LGG-T1 значительно снижает уровень мРНК адипонектина, FAS и IL-6 и повышает уровень IL-10.

Можно сделать вывод, что комбинированное лечение PE + LGG-T1 обладает противовоспалительными свойствами и способно ингибировать дифференцировку адипоцитов, модулируя уровни экспрессии ключевых факторов адипогенной транскрипции, участвующих в адипогенезе.

Заключение

SB, профильтрованный экстрактом граната и LGG, значительно снизил накопление внутриклеточных липидов.Наблюдали синергетический эффект пробиотиков и полифенолов, содержащихся в PE. Более того, наши результаты показали, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10.

Эти результаты свидетельствуют о том, что пробиотики и полифенолы, содержащиеся в ПЭ, могут влиять на адипогенез in vitro. Более того, наши результаты демонстрируют, что синергетические свойства сочетания таких продуктов, как гранат и пробиотики, могут оказывать комбинированное воздействие на здоровье.

Тогда гранат и пробиотики, такие как штамм LGG, могут внести свой вклад в разработку новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Вклад авторов

VS, LV, CR, CC, FR и GB собрали исследовательские статьи, разработали эксперименты, проанализировали результаты и написали рукопись. CR, MR, SF и NT проводили эксперименты.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Ссылки

  • Аль-Зореки Н.С. (2009). Антимикробная активность кожуры плодов граната ( Punica granatum L.). Внутр. J. Food Microbiol. 134 244–248. 10.1016 / j.ijfoodmicro.2009.07.002 [PubMed] [CrossRef] [Google Scholar]
  • Армани А., Мамми К., Марцолла В., Каланчини М., Антелми А., Розано Г. М. и др. (2010). Клеточные модели для понимания адипогенеза, дисфункции жировой ткани и ожирения. J. Cell Biochem. 110 564–572.10.1002 / jcb.22598 [PubMed] [CrossRef] [Google Scholar]
  • Барбагалло И., Ли Вольти Г., Сорренти В., Ди Джакомо К., Аквавива Р., Раффаэле М. и др. (2017). Фенетиловый эфир кофейной кислоты восстанавливает экспрессию гена адипоцитов после обработки липополисахаридом. Lett. Drug Des. Discov. 14 481–487. 10.2174 / 15701808136661604707 [CrossRef] [Google Scholar]
  • Бассири-Джахроми С. (2018). Активность Punica granatum (граната) в укреплении здоровья и профилактике рака. Онкол. Сборка 12: 345. 10.4081 / онкол.2018.345 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Басу А., Пенугонда К. (2009). Гранатовый сок: фруктовый сок, полезный для сердца. Nutr. Сборка 67 49–56. 10.1111 / j.1753-4887.2008.00133.x [PubMed] [CrossRef] [Google Scholar]
  • Бергер Дж., Моллер Д. Э. (2002). Механизмы действия PPAR. Annu. Rev. Med. 53 409–435. 10.1146 / annurev.med.53.082901.104018 [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Касимсетти С. Г., Шредер К. К., Феррейра Д. (2009). Влияние побочных продуктов граната ( Punica granatum L.) и эллагитаннинов на рост кишечных бактерий человека. J. Agric. Food Chem. 57 год 8344–8349. 10.1021 / jf1b [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Рамнани П., Касимсетти С. Г., Мунта К. Р., Гибсон Г. Р., Феррейра Д. (2010). Влияние побочного продукта граната и пуникалагинов на отдельные группы кишечной микробиоты человека. Внутр.J. Food Microbiol. 140 175–182. 10.1016 / j.ijfoodmicro.2010.03.038 [PubMed] [CrossRef] [Google Scholar]
  • Брэдли Р. Л., Фишер Ф. Ф., Маратос-Флиер Э. (2008). Пищевые жирные кислоты по-разному регулируют продукцию TNF-альфа и IL-10 адипоцитами 3T3-L1 мышей. Ожирение 16 938–944. 10.1038 / обы.2008.39 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Карпен К., Пеженауте Х., Дель Мораль Р., Буле Н., Хихона Э., Андраде Ф. и др. (2018). Диетический антиоксидант пицеатаннол ингибирует адипогенез мезенхимальных стволовых клеток жировой ткани человека и ограничивает транспорт глюкозы и липогенную активность в адипоцитах. Внутр. J. Mol. Sci. 19: E2081. 10.3390 / ijms181 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Дхумал С., Карале А. Р., Джадхав С. Б., Кад В. П. (2014). Последние достижения и разработки в области обработки и использования граната: обзор. J. Agric. Crop Sci. 1 1–17. [Google Scholar]
  • Ди Джакомо К., Ванелла Л., Сорренти В., Сантанджело Р., Барбагалло И., Калабрезе Г. и др. (2015). Эффекты tithonia diversifolia (Hemsl.) A.Серый экстракт о дифференцировке адипоцитов мезенхимальных стволовых клеток человека. PLoS One 10: e0122320. 10.1371 / journal.pone.0122320 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Фаволе О. А., Макунга Н. П., Опара Ю. Л. (2012). Метанольный экстракт кожуры плодов граната обладает антибактериальной, антиоксидантной и ингибирующей тирозиназой активностью. BMC Дополнение. Альтерн. Med. 12: 200. 10.1186 / 1472-6882-12-200 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Fischer U.А., Карл Р., Каммерер Д. Р. (2011). Идентификация и количественное определение фенольных соединений из кожуры граната ( Punica granatum L.), мезокарпа, арил и других соков с помощью HPLC-DAD-ESI / MS (n). Food Chem. 127 807–821. 10.1016 / j.foodchem.2010.12.156 [PubMed] [CrossRef] [Google Scholar]
  • Гил М. И., Томас-Барберан Ф. А., Хесс-Пирс Б., Холкрофт Д. М., Кадер А. А. (2000). Антиоксидантная активность гранатового сока и ее связь с фенольным составом и обработкой. J. Agric. Food Chem. 48 4581–4589. [PubMed] [Google Scholar]
  • Хоссин Ф. Л. А. (2009). Воздействие кожуры граната (Punica granatum) и его экстракта на крыс с ожирением и гиперхолестеринемией. Пак. J. Nutr. 8 1251–1257. 10.3923 / pjn.2009.1251.1257 [CrossRef] [Google Scholar]
  • Цзян Л., Чжан Н. X., Мо В., Ван Р., Ма К. Г., Ли X. и др. (2008). Ремания подавляет дифференцировку адипоцитов и адипогенез. Biochem. Биофиз. Res. Commun. 371 185–190.10.1016 / j.bbrc.2008.03.129 [PubMed] [CrossRef] [Google Scholar]
  • Кавада Т., Такахаши Н., Фушики Т. (2001). Биохимические и физиологические характеристики жировой клетки. J. Nutr. Sci. Витаминол. 47 1–12. [PubMed] [Google Scholar]
  • Кершоу Э. Э., Флиер Дж. С. (2004). Жировая ткань как эндокринный орган. J. Clin. Эндокринол. Метаб. 89 2548–2556. 10.1210 / jc.2004-0395 [PubMed] [CrossRef] [Google Scholar]
  • Ким С. Х., Плутцки Дж. (2016). Бурый жир и потемнение для лечения ожирения и связанных с ним нарушений обмена веществ. Diabetes Metab. J. 40 12–21. 10.4093 / dmj.2016.40.1.12 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лай С., Цай М. Л., Бадмаев В., Хименес М., Хо К. Т., Пан М. Х. (2012). Ксантиген подавляет дифференцировку преадипоцитов и адипогенез за счет подавления PPARgamma и C / EBP и модуляции путей SIRT-1, AMPK и FoxO. J. Agric. Food Chem. 60 1094–1101. 10.1021 / jf204862d [PubMed] [CrossRef] [Google Scholar]
  • Ли К.Дж., Чен Л. Г., Лян В. Л., Ван К. С. (2010). Противовоспалительное действие punica granatum Linne in vitro и in vivo. Food Chem. 118 315–322. [Google Scholar]
  • Лефтерова М. И., Лазарь М. А. (2009). Новые разработки в адипогенезе. Trends Endocrinol. Метаб. 20 107–114. 10.1016 / j.tem.2008.11.005 [PubMed] [CrossRef] [Google Scholar]
  • Лес Ф., Арбонес-Майнар Дж. М., Валеро М. С., Лопес В. (2018). Полифенолы граната и уролитин А ингибируют альфа-глюкозидазу, дипептидилпептидазу-4, липазу, накопление триглицеридов и гены, связанные с адипогенезом, в адипоцитоподобных клетках 3T3-L1. J. Ethnopharmacol. 220 67–74. 10.1016 / j.jep.2018.03.029 [PubMed] [CrossRef] [Google Scholar]
  • Ли Ю. Ф., Го К. Дж., Ян Дж. Дж., Вэй Дж. Ю., Сюй Дж., Ченг С. (2006). Оценка антиоксидантных свойств экстракта кожуры граната по сравнению с экстрактом мякоти граната. Food Chem. 96 254–260. [Google Scholar]
  • Ли З., Сумманен П. Х., Комория Т., Хеннинг С. М., Ли Р. П., Карлсон Э. и др. (2015). Эллагитаннины граната стимулируют рост кишечных бактерий in vitro: влияние на пребиотические и метаболические эффекты. Анаэроб 34 164–168. 10.1016 / j.anaerobe.2015.05.012 [PubMed] [CrossRef] [Google Scholar]
  • Лин Л. Т., Чен Т. Ю., Лин С. С., Чунг С. Ю., Лин Т. К., Ван Г. Х. и др. (2013). Противовирусная активность широкого спектра хебулаговой кислоты и пуникалагина против вирусов, которые используют гликозаминогликаны для проникновения. BMC Microbiol. 13: 187. 10.1186 / 1471-2180-13-187 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Lira F. S., Rosa J. C., Pimentel G. D., Seelaender M., Дамасо А. Р., Ояма Л. М. и др. (2012). И адипонектин, и интерлейкин-10 ингибируют LPS-индуцированную активацию пути NF-kappaB в адипоцитах 3T3-L1. Цитокин 57 год 98–106. 10.1016 / j.cyto.2011.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Лю Ю., Сюй Д., Инь С., Ван С., Ван М., Сяо Ю. (2018). Уровень IL-10 / STAT3 снижается при детском ожирении с гипертриглицеридемией и связан с уровнем триглицеридов у крыс с ожирением, вызванным диетой. BMC Endocr. Disord. 18:39.10.1186 / s12902-018-0265-z [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Moon Y. J., Soh J. R., Yu J. J., Sohn H. S., Cha Y. S., Oh S. H. (2012). Эффект ингибирования внутриклеточного накопления липидов Weissella koreensis OK1-6, выделенного из Kimchi, на дифференцирующиеся адипоциты. J. Appl. Microbiol. 113 652–658. 10.1111 / j.1365-2672.2012.05348.x [PubMed] [CrossRef] [Google Scholar]
  • Мосети Д., Регасса А., Ким В. К. (2016). Молекулярная регуляция адипогенеза и потенциальные антиадипогенные биоактивные молекулы. Внутр. J. Mol. Sci. 17: E124. 10.3390 / ijms17010124 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Нейринк А. М., Ван Хи В. Ф., Биндельс Л. Б., Де Бакер Ф., Кани П. Д., Делзен Н. М. (2013). Богатый полифенолами экстракт кожуры граната снимает воспаление тканей и гиперхолестеринемию у мышей с ожирением, вызванных диетой с высоким содержанием жиров: потенциальное влияние на микробиоту кишечника. Br. J. Nutr. 109 802–809. 10.1017 / S0007114512002206 [PubMed] [CrossRef] [Google Scholar]
  • Палмери Р., Монтелеоне Дж. И., Спанья Г., Рестучча К., Раффаэле М., Ванелла Л. и др. (2016). Экстракт оливковых листьев сицилийского сорта уменьшал накопление липидов, вызывая термогенный путь во время адипогенеза. Фронт. Pharmacol. 7: 143. 10.3389 / fphar.2016.00143 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Panichayupakaranant P., Tewtrakul S., Yuenyongsawad S. (2010). Антибактериальное, противовоспалительное и противоаллергическое действие стандартизированного экстракта кожуры граната. Food Chem. 123 400–403. 10.1055 / s-0030-1264706 [CrossRef] [Google Scholar]
  • Парк Дж. Э., О С. Х., Ча Ю. С. (2014). Lactobacillus brevis OPK-3, выделенный из кимчи, подавляет адипогенез и оказывает противовоспалительное действие в адипоцитах 3T3-L1. J. Sci. Продовольственное сельское хозяйство. 94 2514–2520. 10.1002 / jsfa.6588 [PubMed] [CrossRef] [Google Scholar]
  • Ку В., Брекса III А. П., Пан З., Ма Х. (2012). Количественное определение основных составляющих полифенолов в продуктах из граната. Food Chem. 132 1585–1591. 10.1016 / j.foodchem.2011.11.106 [PubMed] [CrossRef] [Google Scholar]
  • Раффаэле М., Барбагалло И., Ликари М., Карота Г., Сферраццо Г., Спампинато М. и др. (2018). N-ацетилцистеин (NAC) улучшает липидную метаболическую дисфункцию в адипоцитах, происходящих из стромальных клеток костного мозга. Evid. На основе дополнения. Альтерн. Med. 2018: 9. 10.1155 / 2018/5310961 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Редди М. К., Гупта С.К., Джейкоб М. Р., Хан С. И., Феррейра Д. (2007). Антиоксидантное, противомалярийное и противомикробное действие богатых танинами фракций, эллагитаннинов и фенольных кислот из Punica granatum L. Planta Med. 73 461–467. 10.1055 / с-2007-7 [PubMed] [CrossRef] [Google Scholar]
  • Ромео Ф. В., Баллистрери Г., Фаброни С., Пангалло С., Никосия М. Г., Шена Л. и др. (2015). Химическая характеристика различных экстрактов сумаха и граната, эффективных против гнили Botrytis cinerea. Молекулы 20 11941–11958. 10,3390 / молекул 200711941 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Розен Э. Д., Уолки К. Дж., Пуигсервер П., Шпигельман Б. М. (2000). Транскрипционная регуляция адипогенеза. Genes Dev. 14 1293–1307. [PubMed] [Google Scholar]
  • Салерно Л., Модика М. Н., Ромео Г., Питтала В., Сиракуза М. А., Амато М. Э. и др. (2012). Новые ингибиторы синтазы оксида азота с антиоксидантными свойствами. Eur.J. Med. Chem. 49 118–126. 10.1016 / j.ejmech.2012.01.002 [PubMed] [CrossRef] [Google Scholar]
  • Синглтон В. Л., Ортофер Р., Ламуэла-Равентос Р. М. (1999). Анализ общих фенолов и других субстратов окисления и антиоксидантов с помощью реактива Фолина – Чокальто. Methods Enzymol. 299 152–178. 10.1016 / S0076-6879 (99) 99017-1 [CrossRef] [Google Scholar]
  • Смит К. Б., Смит М. С. (2016). Статистика ожирения. Prim Care 43 год 121–135. 10.1016 / j.поп.2015.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Стечшульте Л. А., Хайндс Т. Д., мл., Худер С. С., Шоу В., Наджар С. М., Санчес Э. Р. (2014). FKBP51 контролирует клеточный адипогенез посредством опосредованного p38 киназой фосфорилирования GRalpha и PPARgamma. Мол. Эндокринол. 28 год 1265–1275. 10.1210 / мне.2014-1022 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Su X., Howell A. B., D’Souza D. H. (2012). Антибактериальные эффекты растительных экстрактов на устойчивый к метициллину Staphylococcus aureus. Патогенные микроорганизмы пищевого происхождения. Дис. 9 573–578. 10.1089 / fpd.2011.1046 [PubMed] [CrossRef] [Google Scholar]
  • Табаско Р., Санчес-Патан Ф., Монагас М., Бартоломе Б., Виктория Морено-Аррибас М., Пелаез К. и др. (2011). Влияние полифенолов винограда на рост молочнокислых бактерий и бифидобактерий: устойчивость и метаболизм. Food Microbiol. 28 год 1345–1352. 10.1016 / j.fm.2011.06.005 [PubMed] [CrossRef] [Google Scholar]
  • Тегеранифар А., Селахварзи Ю., Харрази М., Бахш В.J. (2011). Высокий потенциал побочных продуктов агропромышленного производства граната ( Punica granatum L.) как мощных противогрибковых и антиоксидантных веществ. Ind. Сельскохозяйственная продукция 34 1523–1527. 10.1016 / j.indcrop.2011.05.007 [CrossRef] [Google Scholar]
  • Ванелла Л., Барбагалло И., Аквавива Р., Ди Джакомо К., Кардил В., Абрахам Н. Г. и др. (2013a). Эллаговая кислота: цитодифференцирующие и антипролиферативные эффекты в клеточных линиях рака предстательной железы человека. Curr. Pharm.Des. 19 2728–2736. [PubMed] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Кардил В., Ким Д. Х. и др. (2013b). Маркеры апоптоза в клеточной линии рака простаты: эффект эллаговой кислоты. Онкол. Реп. 30 2804–2810. 10.3892 / или 2013.2757 [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Ли Вольти Г., Кардил В. и др. (2013c). Влияние эллаговой кислоты на ангиогенные факторы в клетках рака простаты. Раки 5 726–738. 10.3390 / раки5020726 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Сэнфорд К., мл., Ким Д. Х., Абрахам Н. Г., Эбрахейм Н. (2012). Окислительный стресс и гемоксигеназа-1 регулируют дифференцировку мезенхимальных стволовых клеток человека. Внутр. J. Hypertens. 2012: 8. 10.1155 / 2012/8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Waldman M., Bellner L., Vanella L., Schragenheim J., Sodhi K., Singh S.P., et al. (2016). Эпоксиэйкозатриеновые кислоты регулируют дифференцировку адипоцитов клеток 3T3 мыши посредством активации PGC-1alpha, которая необходима для экспрессии HO-1 и увеличения функции митохондрий. Stem Cells Dev. 25 1084–1094. 10.1089 / scd.2016.0072 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ван Ю. В., Джонс П. Дж. (2004). Конъюгированная линолевая кислота и контроль ожирения: эффективность и механизмы. Внутр. J. Obes. Relat. Метаб. Disord. 28 год 941–955.10.1038 / sj.ijo.0802641 [PubMed] [CrossRef] [Google Scholar]
  • Сюй К. З., Чжу К., Ким М. С., Ямахара Дж., Ли Ю. (2009). Цветок граната уменьшает ожирение печени у животных с диабетом 2 типа и ожирением. J. Ethnopharmacol. 123 280–287. 10.1016 / j.jep.2009.03.035 [PubMed] [CrossRef] [Google Scholar]

Положительное влияние экстракта кожуры граната и пробиотиков на преадипоцитную дифференцировку

Front Microbiol. 2019; 10: 660.

Валерия Сорренти

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Cinzia Lucia Randazzo

2 Dipaziena Di мы Università di Catania, Катания, Италия

Cinzia Caggia

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

Gabriele Ballistreri

) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Флора Валерия Ромео

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Симона Фаброни

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок и цитрусовых and Tree Fruit, Ачиреале, Италия

Николина Тимпанаро

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливковых, цитрусовых и древесных фруктов, Ачиреале, Италия

Марко Рафаэле

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Luca Vanella

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия , Италия Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

3 Совет по сельскохозяйственным исследованиям и исследованиям в области сельского хозяйства Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Под редакцией: Розальба Ланчотти, Болонский университет, Италия 90 003

Рецензент: Анна Реале, Институт науки и технологий (ISA), Италия; Коши Филип, Малайский университет, Малайзия

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы микробиологии»

Поступила в редакцию 22 октября 2018 г .; Принята в печать 15 марта 2019 г.

Авторские права © 2019 Сорренти, Рандаццо, Каджия, Баллистрери, Ромео, Фаброни, Тимпанаро, Раффаэле и Ванелла.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Благоприятные эффекты граната обусловлены содержанием эллагитаннинов и антоцианов, которые защищают от множества заболеваний, включая воспалительные. Многие исследователи сообщают, что экстракты отходов граната (кожуры и семян), полученные из отходов промышленной переработки, обладают акцептором свободных радикалов и обладают мощной антиоксидантной способностью. Экстракты граната (ПЭ) также обладают антибактериальной, противовирусной, гиполипидемической и противовоспалительной биоактивностью благодаря содержанию полифенольных соединений, включая пуникалагины, галловую кислоту и производные эллаговой кислоты.В центре внимания данной рукописи было изучение пребиотического потенциала PE, растворимого в воде и охарактеризованного с помощью HPLC – PDA – ESI / MS n на предмет его фенольного содержания. Более того, поскольку сообщалось, что экстракты граната снижали уровень липидов в крови и что было показано, что ряд пробиотических штаммов влияет на адипогенез в культуре клеток, это исследование также было выполнено для проверки in vitro эффектов PE и пробиотик L.rhamnosus GG ATCC 53103 (LGG) на линии клеток 3T3-L1. PE и пробиотики существенно снижали содержание триглицеридов и увеличение внутриклеточных липидов по сравнению с контрольной группой. Однако комбинированная обработка отработанного бульона (SB), фильтрованного через PE и LGG, была наиболее эффективной в снижении содержания триглицеридов и накопления внутриклеточных липидов. Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно ниже в клетках 3T3-L1, обработанных PE и SB, отфильтрованных через LGG.Эти результаты свидетельствуют о том, что синергетический эффект пробиотиков и полифенолов, содержащихся в PE, может повлиять на адипогенез in vitro, и может способствовать разработке новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Ключевые слова: лактобацилл, антимикробная активность, экстракт граната, дифференциация адипоцитов, комбинирование продуктов

Введение

Гранат — это фрукт, положительное влияние на здоровье которого было тщательно изучено.Этот фрукт богат биологически активными соединениями, такими как эллагитаннины и антоцианы, которые защищают от дегенеративных заболеваний. Плод граната из-за его высокой питательной ценности, пользы для здоровья и биоактивных антиоксидантных соединений считается пищевым лекарством. Фактически, гранат широко используется в фитотерапии при нескольких патологиях, включая грипп и инфекции верхних дыхательных путей. Все части плодов граната, то есть кожура и семена, рассматриваемые как отходы, могут быть переработаны для получения продуктов с добавленной стоимостью, имеющих промышленную, медицинскую и косметическую ценность (Dhumal et al., 2014).

Отходы граната образуются на всех этапах жизненного цикла плодов, то есть во время сельскохозяйственного производства, промышленного производства и переработки. Можно использовать побочные продукты граната, поскольку они являются богатым источником биологически активных соединений, таких как флавоноиды, фенольные кислоты и дубильные вещества. Более того, многие исследователи описали, что экстракты граната, изготовленные из побочных продуктов перерабатывающих предприятий, обладают эффективным улавливанием свободных радикалов и антиоксидантной способностью (Lee et al., 2010; Panichayupakaranant et al., 2010; Fischer et al., 2011).

Кроме того, экстракты граната действуют как естественные ингибиторы патогенов, бактерий и грибков (Al-Zoreky, 2009; Tehranifar et al., 2011; Romeo et al., 2015).

Эллагитаннины граната гидролизуются микробиотой кишечника до более мелких фенольных соединений, таких как эллаговая кислота. Затем эллаговая кислота всасывается в кровоток, в то время как эллагитаннины не всасываются и метаболизируются в уролитины.

Сообщалось, что побочные продукты граната и пуникалагины в значительной степени способны подавлять рост патогенных Escherichia coli , Pseudomonas aeruginosa , Clostridia и Staphylococcus aureus (Reddy et al., 2007; Bialonska et al., 2009) и для увеличения роста полезных бактерий, включая Bifidobacterium spp. и Lactobacillus spp. (Reddy et al., 2007; Bialonska et al., 2010).

Экстракты граната также снижают уровень липидов в крови и обладают значительной противоопухолевой, противовирусной и противовоспалительной активностью (Li et al., 2006; Hossin, 2009; Lin et al., 2013; Bassiri- Джахроми, 2018).

Эти потенциальные полезные эффекты приписываются полифенольным соединениям, которые содержатся в экстрактах граната, включая пуникалагины, галловую кислоту и производные эллаговой кислоты (Vanella et al., 2013а, б, в; Romeo et al., 2015).

Поскольку ожирение является одной из основных проблем общественного здравоохранения, необходимы новые превентивные стратегии (Smith and Smith, 2016).

Адипоциты играют важную роль в начале или развитии метаболических осложнений, связанных с ожирением, таких как метаболический синдром и диабетические осложнения (Kim and Plutzky, 2016).

Интерес исследователей к выявлению натуральных продуктов, полученных из диетических растений, обладающих активностью против ожирения, возрос.Сообщалось, что ксантиген и фукоксантин, природные соединения масла косточек граната, значительно подавляли дифференцировку адипоцитов и накопление липидов (Lai et al., 2012).

Настоящая рукопись посвящена прежде всего изучению антиоксидантной и антимикробной активности, а также пребиотического потенциала ПЭ, богатого фенольными соединениями. Более того, обогащенный стандартизованный полиэтилен, содержащий высокий процент природных антиоксидантов граната, был химически охарактеризован с помощью ВЭЖХ – PDA – ESI / MSn.Во-вторых, поскольку гранатовый сок (Les et al., 2018) и различные типы экстрактов граната (PE), включая экстракт, полученный из цельного фрукта (Li et al., 2015), и экстракт, полученный из кожуры граната (Neyrinck et al., 2013), и было показано, что ряд пробиотических штаммов (Moon et al., 2012; Park et al., 2014) влияют на адипогенез, это исследование было проведено для проверки in vitro эффектов PE, пробиотика L rhamnosus GG ATCC 53103 (LGG), предварительно инкубированные с PE, отдельно или в комбинации, при дифференцировке клеток 3T3-L1.

Материалы и методы

Химические вещества

Порошкообразный экстракт граната (Dermogranate ® ), использованный в этом исследовании, был предоставлен Medinutrex (Катания, Италия). Вкратце, экстракт готовили из сушеных и измельченных плодов граната, смешанных с водно-спиртовыми растворами (пищевой), а затем фильтровали. Фильтрат концентрировали и затем сушили распылением для получения стандартизованного экстракта. Экстракт Dermogranate ® имел следующий химический состав: общие полифенолы (16%), пуникалагины (8%), эллаговая кислота и производные (8%).

Реагент Фолина – Чокальтеу (FCR), карбонат натрия (Na 2 CO 3 ), галловая кислота, пуникалин (смесь аномеров), пуникалагин и эллаговая кислота были приобретены у Sigma-Aldrich (Милан, Италия). Гранатин Б был приобретен у LGC Standards (Лондон, Великобритания). Для хроматографии использовали растворители степени чистоты для ВЭЖХ – МС (Merck KgaA, Дармштадт, Германия), а все остальные реагенты были аналитической чистоты.

Определение общего содержания полифенолов

Анализ Folin – Ciocalteu (Singleton et al., 1999) был использован для определения общего содержания полифенолов с небольшими модификациями. 0,1 мг / мл экстракта растворяли в дистиллированной воде. Затем к 500 мкл образца добавляли 5 мл 10% FCR и 4,5 мл раствора Na 2 CO 3 (7,5% мас. / Об.). Конечный раствор перемешивали в течение 2 часов в темноте, а затем измеряли Abs при λ = 765 нм. Анализы проводили в трех экземплярах, и общую концентрацию полифенолов выражали в граммах эквивалентов галловой кислоты (GAE) / 100 г экстракта.

HPLC – PDA – ESI / MS

n Анализ фенольных соединений

Разделение и количественное определение фенольных соединений выполняли, как описано ранее (Romeo et al., 2015). Для идентификации фенольных соединений времена удерживания (RT), спектры и данные МС в режиме отрицательного ESI сравнивали с данными аутентичных стандартов. Количественное определение каждого фенольного соединения проводили с использованием соответствующего стандарта в качестве внешнего стандарта. Количественное определение галловой кислоты проводили при 280 нм.Пуникалины, гранатин В, пуникалагины и эллаговая кислота определялись количественно при 378 нм; та же длина волны использовалась для количественного определения производных эллаговой кислоты с использованием эллаговой кислоты в качестве стандарта сравнения. Анализы проводили в трех экземплярах, и результаты выражали в г соединения / 100 г экстракта.

Тушение DPPH

Способность улавливать свободные радикалы различных концентраций экстракта PE (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) измеряли по 2, Безрадикальный метод 2-дифенил-1-пикрилгидразилгидрата (DPPH), как сообщалось ранее (Salerno et al., 2012). Результаты выражены в процентах от степени ингибирования ± SD .

Влияние поглотителя на супероксид-анион

Способность экстракт ПЭ различных концентраций улавливать супероксид-анион (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) определялась как сообщалось ранее (Салерно и др., 2012). Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Мышиные преадипоциты 3T3-L1 Жизнеспособность клеток

Мышиные преадипоциты 3T3-L1 были приобретены в Американской коллекции типовых культур (Роквилл, Мэриленд, США).Клетки высевали в концентрации 2 × 10 5 клеток на лунку 96-луночного микропланшета и культивировали при 37 ° C в инкубаторе с 5% CO 2 в течение 48 часов в отсутствие и в присутствии различных концентраций ЧП сообщалось выше. Жизнеспособность клеток измеряли с помощью анализа МТТ, как сообщалось ранее (Di Giacomo et al., 2015). МТТ, желтый тетразол, в живых клетках восстанавливается до пурпурного формазана. Результаты выражены в процентах формазана, продуцированного в обработанных мышиных преадипоцитах 3T3-L1 по сравнению с необработанными клетками.

Микробиология

Бактериальное культивирование

Использовали коммерческие штаммы патогенов E. coli ATCC 25922, S. aureus ATCC 29213, Listeria innocua ATCC 33090 и Salmonella enterica ATCC 14028. Штамм E. coli выращивали в бульоне Лурия-Бертани (LB) при 37 ° C в течение ночи; S. aureus , S. enterica и L. innocua обычно выращивали в течение ночи в триптон-соевом бульоне (TSB) при 37 и 30 ° C соответственно.Все материалы и приложения предоставлены Oxoid (Милан, Италия).

Коммерческие пробиотические штаммы LGG, Bifidobacterium animalis BB12, B. longum BB536 и дикий штамм Lactobacillus paracasei N 24, выделенные из кротонского сыра пекорино, культивировали в бульоне Демана – Рогоза – Шарпа (MRS). при 37 ° C в течение ночи.

Ночные бактериальные культуры инкубировали при 37 ° C в течение 24 часов в анаэробных условиях, пока они не достигли плотности клеток приблизительно 1.0 × 10 9 КОЕ / мл.

Определение скорости роста

На основании результатов, полученных по активности PE в качестве акцептора свободных радикалов, и экспериментов по жизнеспособности преадипоцитов мышей 3T3-L1, для обработки штаммов пробиотиков или патогенов, как описано ниже, использовали различные концентрации.

Антимикробная активность PE оценивалась против коммерческих штаммов патогенов, упомянутых выше. Ночные культуры патогенов совместно культивировали при 37 ° C в течение 24 ч с PE в различных концентрациях (1.7–0,34–0,17 мг / мл), а антимикробную активность оценивали подсчетом живых бактерий на чашках и выражали в КОЕ / мл.

Влияние PE на рост пробиотических штаммов, упомянутых выше, оценивали при совместном культивировании пробиотических штаммов с плотностью клеток приблизительно 1,0 × 10 9 КОЕ / мл с PE в различных концентрациях (0,085–0,042– 0,028 мг / мл). Влияние экстракта на рост пробиотических штаммов оценивали после инкубации при 37 ° C в течение 24 часов в анаэробных условиях путем посева живых бактерий и выражали в КОЕ / мл.

Все эксперименты проводились в двух экземплярах, а результаты выражались в виде средних значений и стандартного отклонения. Основываясь на предварительных результатах, для последующего анализа была выбрана LGG.

Свежие бульонные культуры центрифугировали при 5000 об / мин в течение 10 минут при 4 ° C, супернатант декантировали для сбора отработанного бульона (SB), который фильтровали (FSB) с использованием фильтра 0,22 мкм и затем использовали для дальнейшего использования. анализы.

Бактериальный осадок ресуспендировали в 1 мл PBS и пять раз обрабатывали ультразвуком с амплитудой 44% в течение 2 мин с 6 мин отдыха.Затем обработанный ультразвуком центрифугировали при 1100 × g в течение 15 мин при 4 ° C. Супернатант собирали, фильтровали через фильтр 0,22 мкм и меченный экстракт бактериальных клеток (CE). CE использовался для дальнейшего анализа.

Культура клеток и дифференцировка клеток адипоцитов

Преадипоциты мышей 3T3-L1 ресуспендировали в среде Игла, модифицированной Дульбекко (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS, Invitrogen, Карлсбад, Калифорния, США) и 1% антибиотика. / антимикотический раствор (Invitrogen, Карлсбад, Калифорния, США) и высевали в колбу размером 75 см 2 при плотности от 1 до 2 × 10 4 клеток.Дифференцировку клеток адипоцитов получали, как сообщалось ранее (Waldman et al., 2016).

Дифференцирующиеся преадипоциты 3T3-L1 обрабатывали в течение 7 дней PE (0,028 мг / мл), LGG CE (25 мкг / мл) и SB, профильтрованным через LGG (10 мкг / мл) из ночной бактериальной культуры, инкубированной с или без ПЭ (0,028 мг / мл).

Количественное определение содержания липидов

Для количественной оценки накопления липидов проводили масляное красное окрашивание, как сообщалось ранее (Barbagallo et al., 2017). Образование липидных капель измеряли с помощью инвертированного многоканального светодиодного флуоресцентного микроскопа (Evos, Life Technologies, Гранд-Айленд, Нью-Йорк, США).

Экстракция

РНК и qRT-PCR

Экспрессии адипонектина, PPAR-γ, SREBP, FAS, IL-6 и IL-10 оценивали с помощью ПЦР в реальном времени. РНК экстрагировали и количественно оценивали, как сообщалось ранее (Raffaele et al., 2018). Использовали соответствующие последовательности праймеров (). Относительный уровень экспрессии мРНК измеряли по значению порогового цикла (Ct) каждого продукта ПЦР и нормализовали с таковым для GAPDH с использованием сравнительного метода 2 -ΔΔCt .

Таблица 1

Праймеры для ПЦР, использованные в этом исследовании.

Gene Прямой праймер Обратный праймер
Адипонектин GAAGCCGCTTATGTGTATCGC GAATGGGTACATTGGGAACAGT
IL-6 TTCCTCTCTGCAAGAGACTTCC AGGAGAGCATTGGAAATTGGGG
FAS GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
GAPDH AGCTTCGGCACATATTTCATCTG CGTTCACTCCCATGACAAACA
IL-10 GCTGGACAACATACTGCTAACC ATTTCCGATAAGGCTTGGCAA
SREBP-1 GATGTGCGAACTGGACACAG CATAGGGGGCGTCAAACAG
PPAR-γ TCGCTGATGCACTGCCTATG ACCTGATGGCATTGTGAGACAT

Статистический анализ

Статистический анализ множественных сравнений был выполнен e Метод Фишера. P — значения ниже 0,05 были приняты как значимые. Данные были проанализированы с использованием либо однофакторного дисперсионного анализа (ANOVA) для нескольких групп, либо непарного t -теста для двух групп, и результаты представлены в виде среднего значения ± стандартное отклонение.

Результаты

HPLC – PDA – ESI / MS

n Анализ PE

Фенольный профиль PE () включал определение 1 гидроксибензойной кислоты и 19 эллагитаннинов. Основные пики соответствовали пуникалину (пик 4), гранатину B (пик 6), пуникалагину A и B (пики 10 и 14) и эллаговой кислоте (пик 19) ().Выявлено также присутствие галловой кислоты (пик 1) и производных эллаговой кислоты (пики 2, 3, 5, 7–9, 11–13, 15–18, 20). Как показано на хроматограмме, эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожуры), поскольку они составляют более 99% от общего содержания фенольных соединений граната. Пуникалагины, основные эллагитаннины побочных продуктов граната, составляли 47,6% от общего содержания фенольных соединений в ПЭ (). Производные эллаговой кислоты, эллаговая кислота и другие второстепенные фенольные соединения (пуникалин, гранатин B и галловая кислота) составили 38.4, 10,2 и 3,8% от общего содержания фенолов в ПЭ соответственно ().

ВЭЖХ-хроматограмма фенольных соединений ПЭ, обнаруженных при 378 нм. Об идентификации пиков см.

Таблица 2

Список пиков и количественное определение фенольных соединений в ПЭ.

0,07 0,07 966 9,5 9 9278 9027 301 9027 0,027 603 603 Ead d 8 9278 9027 0278 9027 9027 0278 9 9027 35,4 Ead d 902 7.82 фенол
Номер пика a RT (мин) λ (нм) [M – H] ( м / z ) MS n ( m / z ) Фенольные соединения г / 100 г b
1 3.9 269,310 169 125 Кислота галловая 0,07 ± 0,02
2 4,1 255,364 301 301 3 7,0 255,363 301 Ead ​​ d 0,41 ± 0,04
4 7,3 263,364403 9027 601 9027 9027 9027 P 263,36440727 ± 0,04
5 8,4 264,366 301 Ead ​​ d 0,19 ± 0,09
6
Гранатин В 0,28 ± 0,03
7 10,4 259,361 301 Ead ​​ d 0,02 ± 0,01 257,360 301 Ead ​​ d 0,05 ± 0,01
9 13,5 256,362
10 14,0 258,378 1083 781/601 Пуникалагин А 3,05 ± 0,05
11 15,1
15,1
0.13 ± 0,09
12 15,9 257,361 301 Ead ​​ d 0,95 ± 0,03
13
2,69 ± 0,11
14 17,7 257,378 1083 781/601 Пуникалагин B 4,77 ± 0,21 4,77 ± 0,21 257,362 301 Ead ​​ d 0,12 ± 0,01
16 25,2 256,363
17 29,3 254,361 301 Ead ​​ d 0,17 ± 0,01
18 32,2 32,2
0.08 ± 0,03
19 33,6 256,367 301 229/185 Эллаговая кислота 1,68 ± 0,01
20 9027
0,08 ± 0,02
Всего полифенолов c 16,48 ± 2,49
Производные эллаговой кислоты 6,31
Эллаговая кислота 0,62
Всего 16.43

Масс-спектрометрические свойства 20 идентифицированных фенольных соединений (пики 1–20) показаны на рис. Как сообщалось ранее (Romeo et al., 2015), наблюдались две изомерные формы (A и B) пуникалагинов (пики 10 и 14), а также было подчеркнуто присутствие гранатина B (пик 6). Кроме того, эти соединения также были охарактеризованы прямым анализом отрицательных ионов для инфузии ESI / MS n стандартных соединений.Пик 4 был идентифицирован как пуникалин ( m / z 781), тогда как пики 2, 3, 5, 7–9, 11–13, 15–18 и 20 были идентифицированы как производные эллаговой кислоты в соответствии с их УФ – видимой областью и массой. характеристики (λ max около 370 нм и фрагмент MS 1 на мкм / z 301, соответствующий эллаговой кислоте).

Активность PE по улавливанию свободных радикалов

Антиоксидантная активность PE проверялась по их способности восстанавливать стабильный радикал DPPH.

В частности, процент ингибирования DPPH достигал 75% при концентрациях ниже 0.21 мг / мл (76,78, 79 и 80% соответственно при концентрации ПЭ 0,17-0,11-0,085 и 0,028 мг / мл). При концентрациях выше 0,21 мг / мл процент ингибирования DPPH был ниже ().

Активность ПЭ по улавливанию радикалов DPPH в различных концентрациях. Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Экстракт граната ингибировал образование супероксид-аниона дозозависимым образом (). Как правило, в этом тесте PE оказался более эффективным, чем в предыдущем.Это может быть связано с меньшим размером супероксид-аниона по сравнению с радикалом DPPH.

Таблица 3

Активность по улавливанию супероксидных ионов при различных концентрациях ПЭ.

78 ± 2
концентрации PE % ингибирования концентрации PE % ингибирования
PE (3,4 мг / мл) 65 ± 2 PE (0,21 мг / мл)
PE (1,7 мг / мл) 73 ± 3 PE (0.17 мг / мл) 80 ± 1
PE (0,85 мг / мл) 75 ± 1 PE (0,11 мг / мл) 85 ± 3
PE (0,56 мг / мл ) 70 ± 2 PE (0,085 мг / мл 88 ± 4
PE (0,42 мг / мл) 68 ± 1 PE (0,028 мг / мл) 95 ± 1
PE (0,34 мг / мл) 75 ± 4

Влияние PE на жизнеспособность клеток 3T3-L1

3- (4,5-диметилтиазол ил) -2,5-дифенилтетразолийбромид (МТТ) проводили для оценки жизнеспособности клеток 3T3-L1.Результаты показывают значительное снижение жизнеспособности клеток при высоких концентрациях PE (3,4, 1,7, 0,85, 0,56 и 0,42 мг / мл), тогда как при более низких (0,34, 0,21, 0,17, 0,11 и 0,085 мг / мл) концентрациях наблюдается умеренная ингибирующий эффект и концентрация 0,028 мг / мл не оказали значительного влияния на жизнеспособность клеток преадипоцитов мышей 3T3-L1 ().

Процент выживаемости преадипоцитов мышей 3T3-L1 в присутствии PE в различных концентрациях. Результаты выражены как среднее значение ± стандартное отклонение четырех экспериментов, проведенных в трех повторностях.Значимые по сравнению с необработанными контролями: p <0,005; ∗∗ p <0,05.

Microbiology

Антимикробная активность PE в отношении штаммов патогенов

Данные анализа совместного культивирования показали, что патогены были по-разному чувствительны к PE. В деталях, как показано в, экстракт в концентрации 1,7 мг / мл показал наивысшую антимикробную активность против всех патогенов со значительным снижением на L. innocua (проксимально 4 log единицы).При концентрации 0,34 мг / мл экстракт был эффективен против E. coli , L. innocua и S. aureus , демонстрируя снижение плотности клеток на 1 и 2 log единицы соответственно. Когда PE тестировали при концентрации 0,17 мг / мл, штаммы S. aureus , S. enterica и L. innocua все еще подавлялись, в то время как рост E. coli не подвергался значительному влиянию.

Противомикробная активность PE различной концентрации в отношении патогенов, обнаруженных в T24 (24 ч инокулята).Плотность клеток выражается как Δlog КОЕ / мл.

Эффект PE на рост пробиотических штаммов

Результаты, показанные в, подчеркнули, что PE, при всех испытанных концентрациях, не обладал какой-либо ингибирующей активностью в отношении роста испытанных пробиотических штаммов. Небольшое увеличение роста наблюдалось для LGG, совместно культивируемых с PE в концентрации 0,028 мг / мл ().

Таблица 4

Количество бактерий, выраженное в логарифме 10 КОЕ / мл в трех повторностях ± стандартное отклонение L. rhamnosus GG ATCC 53103, Bifidobacterium animalis BB12, B.longum BB536 и дикий штамм Lactobacillus paracasei N 24 после инкубации с PE в различных концентрациях.

90CC3 ) 9027 a 9027 9027 9040 мг 9,57 ± 0,12 a
Журнал 10
L. rhamnosus GG Исходный уровень 8,83 ± 0,09 a

3

9,20 ± 0,10 b
PE (0.042 мг / мл) 9,24 ± 0,07 b
PE (0,028 мг / мл) 9,26 ± 0,04 b
Lactobacillus paracase8
Lactobacillus paracasei
N24 PE (0,085 мг / мл) 8,70 ± 0,08 a
PE (0,042 мг / мл) 8,79 ± 0,10
PE (0.028 мг / мл) 8,74 ± 0,09 a
Bifidobacterium animalis Исходный уровень 9,15 ± 0,05 a
BB40 0,12 a
PE (0,042 мг / мл) 9,44 ± 0,10 b
PE (0,028 мг / мл) 9,55 ± 0,07 9027 b Б.longum Исходный уровень 9,77 ± 0,03 a
BB536 PE (0,085 мг / мл) 9,54 ± 0,10 a
PE (0,028 мг / мл) 9,44 ± 0,16 a

Влияние полиэтилена и экстракта LGomenate на содержание липидов 9000Ggranate 9000Ggrana 9 фильтрованный SB значительно снизил содержание триглицеридов по сравнению с контрольной группой ().Однако эффект отфильтрованного SB, полученного из клеток, инкубированных с PE (LGG-T1) или без него (LGG-T0), был аналогичным. Одновременная обработка преадипоцитов мышей 3T3-L1 SB, отфильтрованным через PE и LGG, значительно снизила содержание триглицеридов по сравнению с обработкой только SB, отфильтрованного через LGG. Более того, эти данные свидетельствуют о том, что комбинированное лечение PE и LGG-T1 было наиболее эффективным для снижения содержания триглицеридов и накопления внутриклеточных липидов.

(A) Типичное масляное красное окрашивание O клеток 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE. (B) Содержание липидов определяли количественно с помощью окрашивания Oil Red O (среднее ± SD , p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с LGG T0 + PE).

Обработка преадипоцитов мышей 3T3-L1 клеточным экстрактом LGG (CE), полученным из клеток, инкубированных с PE (CE + PE) или без него (CE), не оказала влияния на накопление внутриклеточных липидов по сравнению с контрольной группой ( Контроль: ABS 490 нм = 0.200 ± 0,07; CE: ABS 490 нм = 0,187 ± 0,09; CE + PE = ABS 490 нм = 0,190 ± 0,05).

Влияние PE на адипогенные маркеры

Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно менее выражены в клетках 3T3-L1, обработанных SB, отфильтрованным через PE и LGG. В частности, PE, LGG-T0 и LGG-T1 были способны снижать уровни гена адипонектина, PPAR-γ, SREBP, FAS и IL-6 и повышать уровни гена IL-10 ().

(A – F) Анализ экспрессии генов с помощью qRT-PCR липогенного пути в клетках 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE.Результаты выражены в виде среднего значения ± стандартное отклонение четырех экспериментов, выполненных в трех повторностях ( * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с контролем. LGG T0 + PE).

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно снизила уровни экспрессии мРНК основных транскрипционных факторов, участвующих в адипогенезе, по сравнению с обработкой SB, отфильтрованных через LGG ( LGGT0 и LGGT1) отдельно ().

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно повысила уровни экспрессии мРНК IL10 по сравнению с обработкой только SB (LGGT0 и LGGT1), профильтрованных через LGG ( ). Более того, эти данные свидетельствуют о том, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10 (2).

Обсуждение

Благоприятные эффекты употребления плодов граната и / или сока вызвали значительный научный интерес (Basu and Penugonda, 2009).Многие исследователи сообщают, что полиэтилены, полученные из отходов перерабатывающих предприятий, обладают способностью улавливать свободные радикалы и обладают мощной антиоксидантной способностью (Panichayupakaranant et al., 2010; Fischer et al., 2011). ПЭ, использованный в настоящем исследовании, был растворим в воде и охарактеризован с помощью ВЭЖХ – PDA – ESI / MS n по содержанию фенолов и антоцианов. В соответствии с предыдущими сообщениями (Fischer et al., 2011; Qu et al., 2012; Romeo et al., 2015) эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожура), поскольку они составляют более 99% от общего содержания фенольных соединений граната.Основными эллагитаннинами побочных продуктов граната, а также продуктов из граната (фруктов и соков) являются пуникалагины (Gil et al., 2000; Fischer et al., 2011; Qu et al., 2012).

Экстракт граната содержит высокий процент фенольных соединений и проявляет антиоксидантную активность в зависимости от концентрации, как показано для анализа как DPPH, так и анализа поглощения супероксид-анионов.

Сообщалось, что диетические полифенолы растений способны избирательно модулировать рост чувствительных микроорганизмов (Tabasco et al., 2011). Экстракты растений обычно подавляют рост бактерий, но степень эффекта зависит от состава экстракта и типа бактериального штамма.

Результаты, полученные в условиях наших экспериментов, продемонстрировали, что высокие концентрации полифенолов граната оказывают противомикробное действие на некоторые штаммы патогенов, такие как L. innocua и S. aureus. Эти результаты согласуются с исследованиями Panichayupakaranant et al. (2010), Fawole et al.(2012) и Su et al. (2012).

Однако при концентрациях PE ниже 0,34 мг / мл, хотя не было обнаружено концентраций ингибирующей активности в отношении штаммов пробиотиков, оценивалось только небольшое увеличение роста LGG. Эти результаты не согласуются с исследованиями Li et al. (2015) и Neyrinck et al. (2013), которые продемонстрировали, что полифенолы граната потенциально могут работать как пребиотики.

Ожирение — это состояние, при котором накопление липидов приводит к расширению жировой ткани, которая действует как метаболический и эндокринный орган.Молекулярные механизмы, которые модулируют рост, дифференцировку и липогенез преадипоцитов жировых клеток, были предметом обширных исследований (Vanella et al., 2012; Stechschulte et al., 2014; Moseti et al., 2016; Palmeri et al., 2016; Waldman et al., 2016; Carpene et al., 2018).

Во время дифференцировки адипоцитов преадипоциты дифференцируются в зрелые адипоциты (Lefterova, Lazar, 2009). Повышенное накопление жира сильно коррелирует с количеством клеток и / или размером адипоцитов (Jiang et al., 2008).

Сообщалось, что степень ожирения связана с дифференцировкой преадипоцитов в адипоцитах и ​​с увеличением адипоцитов в жировой ткани (Wang and Jones, 2004).

Другие авторы сообщили, что PEs способны подавлять дифференцировку преадипоцитов и адипогенез и уменьшать жировую дистрофию печени у крыс с ожирением и диабетом 2 типа (Xu et al., 2009).

В соответствии с данными Moon et al. (2012) и Park et al. (2014) в наших экспериментальных условиях PE, LGG-T0 и LGG-T1 приводили к значительному снижению накопления липидов в клетках 3T3-L1 во время дифференцировки в адипоциты, предполагая, что PE, LGG-T0 и LGG-T1 способны подавлять дифференцировка адипоцитов.Однако обработка LGG-фильтрованным SB, полученным из клеток, инкубированных с PE (LGG-T1) или без (LGG-T1), была аналогичной. В наших экспериментальных условиях фактически не наблюдалось пребиотического эффекта, продемонстрированного другими авторами. Более того, комбинированное лечение PE и LGG-T1 было наиболее эффективным в снижении внутриклеточного накопления липидов. Эти данные демонстрируют, что, даже если в наших экспериментальных условиях не наблюдалось пребиотического эффекта, фильтрованный SB, полученный из LGG, инкубированного с PE (LGG-T1), мог бы содержать, помимо полезных бактериальных секретируемых биоактивных соединений, также небольшие количества PE- производные биоактивные соединения.Последний, присутствующий в небольших количествах в LGG-T1, не будет иметь более сильных положительных эффектов, чем LGG-T0, но в сочетании с PE может иметь потенциальные синергетические преимущества для здоровья.

Адипоцит-специфический рецептор, активируемый пролифератором пероксисом-γ (PPARγ), участвует в ранней стадии дифференцировки адипоцитов (Rosen et al., 2000), регулируя экспрессию адипогенных генов, таких как синтаза жирных кислот (FAS) и регуляторный элемент стерола. -связывающие белки (SREBP), а затем запускают накопление жира в клетках (Kawada et al., 2001; Бергер и Моллер, 2002).

Жировая ткань — это не только первичный резервуар жира, но и эндокринный орган, контролирующий гомеостаз липидов. Измененные уровни адипокинов жировой ткани могут способствовать развитию воспаления, что приводит к нарушению липидного обмена (Armani et al., 2010). При хроническом воспалении провоспалительные цитокины, такие как IL-6, активируются, тогда как противовоспалительные цитокины, такие как IL-10, подавляются (Kershaw and Flier, 2004; Bradley et al., 2008; Лира и др., 2012; Лю и др., 2018).

Наши результаты демонстрируют, что комбинированное лечение PE + LGG-T1 значительно снижает уровень мРНК адипонектина, FAS и IL-6 и повышает уровень IL-10.

Можно сделать вывод, что комбинированное лечение PE + LGG-T1 обладает противовоспалительными свойствами и способно ингибировать дифференцировку адипоцитов, модулируя уровни экспрессии ключевых факторов адипогенной транскрипции, участвующих в адипогенезе.

Заключение

SB, профильтрованный экстрактом граната и LGG, значительно снизил накопление внутриклеточных липидов.Наблюдали синергетический эффект пробиотиков и полифенолов, содержащихся в PE. Более того, наши результаты показали, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10.

Эти результаты свидетельствуют о том, что пробиотики и полифенолы, содержащиеся в ПЭ, могут влиять на адипогенез in vitro. Более того, наши результаты демонстрируют, что синергетические свойства сочетания таких продуктов, как гранат и пробиотики, могут оказывать комбинированное воздействие на здоровье.

Тогда гранат и пробиотики, такие как штамм LGG, могут внести свой вклад в разработку новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Вклад авторов

VS, LV, CR, CC, FR и GB собрали исследовательские статьи, разработали эксперименты, проанализировали результаты и написали рукопись. CR, MR, SF и NT проводили эксперименты.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Ссылки

  • Аль-Зореки Н.С. (2009). Антимикробная активность кожуры плодов граната ( Punica granatum L.). Внутр. J. Food Microbiol. 134 244–248. 10.1016 / j.ijfoodmicro.2009.07.002 [PubMed] [CrossRef] [Google Scholar]
  • Армани А., Мамми К., Марцолла В., Каланчини М., Антелми А., Розано Г. М. и др. (2010). Клеточные модели для понимания адипогенеза, дисфункции жировой ткани и ожирения. J. Cell Biochem. 110 564–572.10.1002 / jcb.22598 [PubMed] [CrossRef] [Google Scholar]
  • Барбагалло И., Ли Вольти Г., Сорренти В., Ди Джакомо К., Аквавива Р., Раффаэле М. и др. (2017). Фенетиловый эфир кофейной кислоты восстанавливает экспрессию гена адипоцитов после обработки липополисахаридом. Lett. Drug Des. Discov. 14 481–487. 10.2174 / 15701808136661604707 [CrossRef] [Google Scholar]
  • Бассири-Джахроми С. (2018). Активность Punica granatum (граната) в укреплении здоровья и профилактике рака. Онкол. Сборка 12: 345. 10.4081 / онкол.2018.345 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Басу А., Пенугонда К. (2009). Гранатовый сок: фруктовый сок, полезный для сердца. Nutr. Сборка 67 49–56. 10.1111 / j.1753-4887.2008.00133.x [PubMed] [CrossRef] [Google Scholar]
  • Бергер Дж., Моллер Д. Э. (2002). Механизмы действия PPAR. Annu. Rev. Med. 53 409–435. 10.1146 / annurev.med.53.082901.104018 [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Касимсетти С. Г., Шредер К. К., Феррейра Д. (2009). Влияние побочных продуктов граната ( Punica granatum L.) и эллагитаннинов на рост кишечных бактерий человека. J. Agric. Food Chem. 57 год 8344–8349. 10.1021 / jf1b [PubMed] [CrossRef] [Google Scholar]
  • Бялонска Д., Рамнани П., Касимсетти С. Г., Мунта К. Р., Гибсон Г. Р., Феррейра Д. (2010). Влияние побочного продукта граната и пуникалагинов на отдельные группы кишечной микробиоты человека. Внутр.J. Food Microbiol. 140 175–182. 10.1016 / j.ijfoodmicro.2010.03.038 [PubMed] [CrossRef] [Google Scholar]
  • Брэдли Р. Л., Фишер Ф. Ф., Маратос-Флиер Э. (2008). Пищевые жирные кислоты по-разному регулируют продукцию TNF-альфа и IL-10 адипоцитами 3T3-L1 мышей. Ожирение 16 938–944. 10.1038 / обы.2008.39 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Карпен К., Пеженауте Х., Дель Мораль Р., Буле Н., Хихона Э., Андраде Ф. и др. (2018). Диетический антиоксидант пицеатаннол ингибирует адипогенез мезенхимальных стволовых клеток жировой ткани человека и ограничивает транспорт глюкозы и липогенную активность в адипоцитах. Внутр. J. Mol. Sci. 19: E2081. 10.3390 / ijms181 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Дхумал С., Карале А. Р., Джадхав С. Б., Кад В. П. (2014). Последние достижения и разработки в области обработки и использования граната: обзор. J. Agric. Crop Sci. 1 1–17. [Google Scholar]
  • Ди Джакомо К., Ванелла Л., Сорренти В., Сантанджело Р., Барбагалло И., Калабрезе Г. и др. (2015). Эффекты tithonia diversifolia (Hemsl.) A.Серый экстракт о дифференцировке адипоцитов мезенхимальных стволовых клеток человека. PLoS One 10: e0122320. 10.1371 / journal.pone.0122320 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Фаволе О. А., Макунга Н. П., Опара Ю. Л. (2012). Метанольный экстракт кожуры плодов граната обладает антибактериальной, антиоксидантной и ингибирующей тирозиназой активностью. BMC Дополнение. Альтерн. Med. 12: 200. 10.1186 / 1472-6882-12-200 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Fischer U.А., Карл Р., Каммерер Д. Р. (2011). Идентификация и количественное определение фенольных соединений из кожуры граната ( Punica granatum L.), мезокарпа, арил и других соков с помощью HPLC-DAD-ESI / MS (n). Food Chem. 127 807–821. 10.1016 / j.foodchem.2010.12.156 [PubMed] [CrossRef] [Google Scholar]
  • Гил М. И., Томас-Барберан Ф. А., Хесс-Пирс Б., Холкрофт Д. М., Кадер А. А. (2000). Антиоксидантная активность гранатового сока и ее связь с фенольным составом и обработкой. J. Agric. Food Chem. 48 4581–4589. [PubMed] [Google Scholar]
  • Хоссин Ф. Л. А. (2009). Воздействие кожуры граната (Punica granatum) и его экстракта на крыс с ожирением и гиперхолестеринемией. Пак. J. Nutr. 8 1251–1257. 10.3923 / pjn.2009.1251.1257 [CrossRef] [Google Scholar]
  • Цзян Л., Чжан Н. X., Мо В., Ван Р., Ма К. Г., Ли X. и др. (2008). Ремания подавляет дифференцировку адипоцитов и адипогенез. Biochem. Биофиз. Res. Commun. 371 185–190.10.1016 / j.bbrc.2008.03.129 [PubMed] [CrossRef] [Google Scholar]
  • Кавада Т., Такахаши Н., Фушики Т. (2001). Биохимические и физиологические характеристики жировой клетки. J. Nutr. Sci. Витаминол. 47 1–12. [PubMed] [Google Scholar]
  • Кершоу Э. Э., Флиер Дж. С. (2004). Жировая ткань как эндокринный орган. J. Clin. Эндокринол. Метаб. 89 2548–2556. 10.1210 / jc.2004-0395 [PubMed] [CrossRef] [Google Scholar]
  • Ким С. Х., Плутцки Дж. (2016). Бурый жир и потемнение для лечения ожирения и связанных с ним нарушений обмена веществ. Diabetes Metab. J. 40 12–21. 10.4093 / dmj.2016.40.1.12 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лай С., Цай М. Л., Бадмаев В., Хименес М., Хо К. Т., Пан М. Х. (2012). Ксантиген подавляет дифференцировку преадипоцитов и адипогенез за счет подавления PPARgamma и C / EBP и модуляции путей SIRT-1, AMPK и FoxO. J. Agric. Food Chem. 60 1094–1101. 10.1021 / jf204862d [PubMed] [CrossRef] [Google Scholar]
  • Ли К.Дж., Чен Л. Г., Лян В. Л., Ван К. С. (2010). Противовоспалительное действие punica granatum Linne in vitro и in vivo. Food Chem. 118 315–322. [Google Scholar]
  • Лефтерова М. И., Лазарь М. А. (2009). Новые разработки в адипогенезе. Trends Endocrinol. Метаб. 20 107–114. 10.1016 / j.tem.2008.11.005 [PubMed] [CrossRef] [Google Scholar]
  • Лес Ф., Арбонес-Майнар Дж. М., Валеро М. С., Лопес В. (2018). Полифенолы граната и уролитин А ингибируют альфа-глюкозидазу, дипептидилпептидазу-4, липазу, накопление триглицеридов и гены, связанные с адипогенезом, в адипоцитоподобных клетках 3T3-L1. J. Ethnopharmacol. 220 67–74. 10.1016 / j.jep.2018.03.029 [PubMed] [CrossRef] [Google Scholar]
  • Ли Ю. Ф., Го К. Дж., Ян Дж. Дж., Вэй Дж. Ю., Сюй Дж., Ченг С. (2006). Оценка антиоксидантных свойств экстракта кожуры граната по сравнению с экстрактом мякоти граната. Food Chem. 96 254–260. [Google Scholar]
  • Ли З., Сумманен П. Х., Комория Т., Хеннинг С. М., Ли Р. П., Карлсон Э. и др. (2015). Эллагитаннины граната стимулируют рост кишечных бактерий in vitro: влияние на пребиотические и метаболические эффекты. Анаэроб 34 164–168. 10.1016 / j.anaerobe.2015.05.012 [PubMed] [CrossRef] [Google Scholar]
  • Лин Л. Т., Чен Т. Ю., Лин С. С., Чунг С. Ю., Лин Т. К., Ван Г. Х. и др. (2013). Противовирусная активность широкого спектра хебулаговой кислоты и пуникалагина против вирусов, которые используют гликозаминогликаны для проникновения. BMC Microbiol. 13: 187. 10.1186 / 1471-2180-13-187 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Lira F. S., Rosa J. C., Pimentel G. D., Seelaender M., Дамасо А. Р., Ояма Л. М. и др. (2012). И адипонектин, и интерлейкин-10 ингибируют LPS-индуцированную активацию пути NF-kappaB в адипоцитах 3T3-L1. Цитокин 57 год 98–106. 10.1016 / j.cyto.2011.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Лю Ю., Сюй Д., Инь С., Ван С., Ван М., Сяо Ю. (2018). Уровень IL-10 / STAT3 снижается при детском ожирении с гипертриглицеридемией и связан с уровнем триглицеридов у крыс с ожирением, вызванным диетой. BMC Endocr. Disord. 18:39.10.1186 / s12902-018-0265-z [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Moon Y. J., Soh J. R., Yu J. J., Sohn H. S., Cha Y. S., Oh S. H. (2012). Эффект ингибирования внутриклеточного накопления липидов Weissella koreensis OK1-6, выделенного из Kimchi, на дифференцирующиеся адипоциты. J. Appl. Microbiol. 113 652–658. 10.1111 / j.1365-2672.2012.05348.x [PubMed] [CrossRef] [Google Scholar]
  • Мосети Д., Регасса А., Ким В. К. (2016). Молекулярная регуляция адипогенеза и потенциальные антиадипогенные биоактивные молекулы. Внутр. J. Mol. Sci. 17: E124. 10.3390 / ijms17010124 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Нейринк А. М., Ван Хи В. Ф., Биндельс Л. Б., Де Бакер Ф., Кани П. Д., Делзен Н. М. (2013). Богатый полифенолами экстракт кожуры граната снимает воспаление тканей и гиперхолестеринемию у мышей с ожирением, вызванных диетой с высоким содержанием жиров: потенциальное влияние на микробиоту кишечника. Br. J. Nutr. 109 802–809. 10.1017 / S0007114512002206 [PubMed] [CrossRef] [Google Scholar]
  • Палмери Р., Монтелеоне Дж. И., Спанья Г., Рестучча К., Раффаэле М., Ванелла Л. и др. (2016). Экстракт оливковых листьев сицилийского сорта уменьшал накопление липидов, вызывая термогенный путь во время адипогенеза. Фронт. Pharmacol. 7: 143. 10.3389 / fphar.2016.00143 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Panichayupakaranant P., Tewtrakul S., Yuenyongsawad S. (2010). Антибактериальное, противовоспалительное и противоаллергическое действие стандартизированного экстракта кожуры граната. Food Chem. 123 400–403. 10.1055 / s-0030-1264706 [CrossRef] [Google Scholar]
  • Парк Дж. Э., О С. Х., Ча Ю. С. (2014). Lactobacillus brevis OPK-3, выделенный из кимчи, подавляет адипогенез и оказывает противовоспалительное действие в адипоцитах 3T3-L1. J. Sci. Продовольственное сельское хозяйство. 94 2514–2520. 10.1002 / jsfa.6588 [PubMed] [CrossRef] [Google Scholar]
  • Ку В., Брекса III А. П., Пан З., Ма Х. (2012). Количественное определение основных составляющих полифенолов в продуктах из граната. Food Chem. 132 1585–1591. 10.1016 / j.foodchem.2011.11.106 [PubMed] [CrossRef] [Google Scholar]
  • Раффаэле М., Барбагалло И., Ликари М., Карота Г., Сферраццо Г., Спампинато М. и др. (2018). N-ацетилцистеин (NAC) улучшает липидную метаболическую дисфункцию в адипоцитах, происходящих из стромальных клеток костного мозга. Evid. На основе дополнения. Альтерн. Med. 2018: 9. 10.1155 / 2018/5310961 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Редди М. К., Гупта С.К., Джейкоб М. Р., Хан С. И., Феррейра Д. (2007). Антиоксидантное, противомалярийное и противомикробное действие богатых танинами фракций, эллагитаннинов и фенольных кислот из Punica granatum L. Planta Med. 73 461–467. 10.1055 / с-2007-7 [PubMed] [CrossRef] [Google Scholar]
  • Ромео Ф. В., Баллистрери Г., Фаброни С., Пангалло С., Никосия М. Г., Шена Л. и др. (2015). Химическая характеристика различных экстрактов сумаха и граната, эффективных против гнили Botrytis cinerea. Молекулы 20 11941–11958. 10,3390 / молекул 200711941 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Розен Э. Д., Уолки К. Дж., Пуигсервер П., Шпигельман Б. М. (2000). Транскрипционная регуляция адипогенеза. Genes Dev. 14 1293–1307. [PubMed] [Google Scholar]
  • Салерно Л., Модика М. Н., Ромео Г., Питтала В., Сиракуза М. А., Амато М. Э. и др. (2012). Новые ингибиторы синтазы оксида азота с антиоксидантными свойствами. Eur.J. Med. Chem. 49 118–126. 10.1016 / j.ejmech.2012.01.002 [PubMed] [CrossRef] [Google Scholar]
  • Синглтон В. Л., Ортофер Р., Ламуэла-Равентос Р. М. (1999). Анализ общих фенолов и других субстратов окисления и антиоксидантов с помощью реактива Фолина – Чокальто. Methods Enzymol. 299 152–178. 10.1016 / S0076-6879 (99) 99017-1 [CrossRef] [Google Scholar]
  • Смит К. Б., Смит М. С. (2016). Статистика ожирения. Prim Care 43 год 121–135. 10.1016 / j.поп.2015.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Стечшульте Л. А., Хайндс Т. Д., мл., Худер С. С., Шоу В., Наджар С. М., Санчес Э. Р. (2014). FKBP51 контролирует клеточный адипогенез посредством опосредованного p38 киназой фосфорилирования GRalpha и PPARgamma. Мол. Эндокринол. 28 год 1265–1275. 10.1210 / мне.2014-1022 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Su X., Howell A. B., D’Souza D. H. (2012). Антибактериальные эффекты растительных экстрактов на устойчивый к метициллину Staphylococcus aureus. Патогенные микроорганизмы пищевого происхождения. Дис. 9 573–578. 10.1089 / fpd.2011.1046 [PubMed] [CrossRef] [Google Scholar]
  • Табаско Р., Санчес-Патан Ф., Монагас М., Бартоломе Б., Виктория Морено-Аррибас М., Пелаез К. и др. (2011). Влияние полифенолов винограда на рост молочнокислых бактерий и бифидобактерий: устойчивость и метаболизм. Food Microbiol. 28 год 1345–1352. 10.1016 / j.fm.2011.06.005 [PubMed] [CrossRef] [Google Scholar]
  • Тегеранифар А., Селахварзи Ю., Харрази М., Бахш В.J. (2011). Высокий потенциал побочных продуктов агропромышленного производства граната ( Punica granatum L.) как мощных противогрибковых и антиоксидантных веществ. Ind. Сельскохозяйственная продукция 34 1523–1527. 10.1016 / j.indcrop.2011.05.007 [CrossRef] [Google Scholar]
  • Ванелла Л., Барбагалло И., Аквавива Р., Ди Джакомо К., Кардил В., Абрахам Н. Г. и др. (2013a). Эллаговая кислота: цитодифференцирующие и антипролиферативные эффекты в клеточных линиях рака предстательной железы человека. Curr. Pharm.Des. 19 2728–2736. [PubMed] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Кардил В., Ким Д. Х. и др. (2013b). Маркеры апоптоза в клеточной линии рака простаты: эффект эллаговой кислоты. Онкол. Реп. 30 2804–2810. 10.3892 / или 2013.2757 [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Ли Вольти Г., Кардил В. и др. (2013c). Влияние эллаговой кислоты на ангиогенные факторы в клетках рака простаты. Раки 5 726–738. 10.3390 / раки5020726 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Сэнфорд К., мл., Ким Д. Х., Абрахам Н. Г., Эбрахейм Н. (2012). Окислительный стресс и гемоксигеназа-1 регулируют дифференцировку мезенхимальных стволовых клеток человека. Внутр. J. Hypertens. 2012: 8. 10.1155 / 2012/8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Waldman M., Bellner L., Vanella L., Schragenheim J., Sodhi K., Singh S.P., et al. (2016). Эпоксиэйкозатриеновые кислоты регулируют дифференцировку адипоцитов клеток 3T3 мыши посредством активации PGC-1alpha, которая необходима для экспрессии HO-1 и увеличения функции митохондрий. Stem Cells Dev. 25 1084–1094. 10.1089 / scd.2016.0072 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ван Ю. В., Джонс П. Дж. (2004). Конъюгированная линолевая кислота и контроль ожирения: эффективность и механизмы. Внутр. J. Obes. Relat. Метаб. Disord. 28 год 941–955.10.1038 / sj.ijo.0802641 [PubMed] [CrossRef] [Google Scholar]
  • Сюй К. З., Чжу К., Ким М. С., Ямахара Дж., Ли Ю. (2009). Цветок граната уменьшает ожирение печени у животных с диабетом 2 типа и ожирением. J. Ethnopharmacol. 123 280–287. 10.1016 / j.jep.2009.03.035 [PubMed] [CrossRef] [Google Scholar]

12 многообещающих преимуществ кожуры граната для кожи, волос и здоровья

Кожура граната обладает множеством лечебных свойств и используется для лечения нескольких заболеваний.Говорят, что он обладает антибактериальными, противогрибковыми, противовирусными и противовоспалительными свойствами, а также многими преимуществами для здоровья. Кожура граната богата антиоксидантами и может бороться с прыщами, выводить токсины из организма, предотвращать появление морщин и признаков старения, а также лечить боль в горле и кашель. Вместо того, чтобы выбрасывать их, храните их, чтобы получить их чудесные преимущества. В этой статье мы обсудили потенциальные преимущества кожуры граната, процесс изготовления порошка кожуры и некоторые рецепты.

Польза кожуры граната для здоровья

1.Может бороться с прыщами, прыщами и высыпаниями

Считается, что кожура граната обладает антибактериальными, противовирусными и противовоспалительными свойствами (1). Она может эффективно бороться с такими кожными проблемами, как прыщи, прыщи и сыпь. Кожура богата антиоксидантами и помогает сдерживать бактерии и другие инфекции (2). Неофициальные данные свидетельствуют о том, что кожура граната также может помочь в удалении омертвевших клеток кожи с лица, если его использовать в виде маски для лица или скраба для лица. Однако необходимы дополнительные исследования, чтобы понять преимущества кожуры граната.

2. Может помочь в детоксикации организма

Антиоксиданты активно борются с токсичными веществами в организме. Следовательно, высокое содержание антиоксидантов в кожуре граната является эффективным средством при использовании для детоксикации организма. Исследование, проведенное на мышах, показало, что водный экстракт кожуры граната может способствовать детоксикации (3). Считается, что он очень полезен для борьбы с токсинами, присутствующими в организме. Однако в этом контексте доступны ограниченные данные.

3. Может предотвратить появление морщин и других признаков старения

Чрезмерное пребывание на солнце и загрязнение окружающей среды — две основные причины преждевременного старения.Исследования показывают, что экстракт кожуры граната при использовании с маслом семян способствует синтезу проколлагена, борется с ферментами, расщепляющими коллаген, и эффективно способствует росту клеток кожи. Таким образом, он естественным образом и эффективно замедляет старение кожи и появление морщин (4).

Исследование, проведенное Университетом Халлим (Корея) на клетках кожи человека и лысых мышах, показало, что эллаговая кислота, содержащаяся в экстрактах кожуры граната, может уменьшать морщины (5) . Таким образом, это может помочь вашей коже выглядеть моложе.

4. Может вылечить боль в горле и кашель

Согласно традиционной лечебной практике, кожура граната помогает облегчить кашель и используется в порошкообразной форме с водой в качестве полоскания для облегчения боли в горле (6). Многочисленные исследования показывают, что водно-спиртовой экстракт кожуры граната обладает антибактериальными свойствами, которые могут помочь при лечении боли в горле и кашля (7), (8).

5. Может действовать как естественный увлажняющий и солнцезащитный крем

По этому поводу имеются ограниченные данные.Тем не менее, неофициальные данные свидетельствуют о том, что эллаговая кислота, содержащаяся в кожуре граната, может предотвратить высыхание влаги в клетках кожи, тем самым сохраняя вашу кожу увлажненной. Кроме того, считается, что кожура граната увлажняет и защищает кожу от токсинов окружающей среды и восстанавливает ее баланс pH. Они также используются в средствах по уходу за кожей из-за их увлажняющих свойств.

Кожура граната содержит эффективные средства для защиты от загара и действует как естественный солнцезащитный крем, предотвращая и восстанавливая повреждения, нанесенные коже лучами UVA и UVB (9).

6. Может бороться с раком кожи

Новое удивительное исследование показало, что экстракты граната содержат профилактическое средство, которое борется с возникновением рака кожи (10). Предполагается, что противовоспалительные и противораковые свойства кожуры граната эффективны в профилактике и лечении рака кожи. Кожура граната предотвращает процесс разрастания раковых клеток, тем самым снижая риск рака кожи. Однако в этом отношении доступно очень мало исследований, и необходимы более долгосрочные исследования, чтобы понять преимущества кожуры граната для человека.

7. Богатый источник витамина C

Витамин C, еще одно необходимое питательное вещество, для которого мы часто покупаем дорогие добавки, в изобилии содержится в кожуре граната (11), (12). Витамин С — это средство экстенсивного роста, которое помогает заживлять раны и формировать рубцовую ткань. Он образует белки для наращивания массы тела и играет важную роль в восстановлении и поддержании хрящей, костей и зубов (13).

8. Может защитить от болезней сердца

Кожура граната богата антиоксидантами, которые обладают высокой способностью защищать холестерин ЛПНП от окисления.Также считается, что он обладает васкулопротекторным действием, предотвращающим проблемы с сердцем (14). Это полезно, потому что окисление холестерина ЛПНП в организме может привести к окислительному стрессу, который является основным фактором, способствующим сердечным заболеваниям и другим недугам (15).

9. Может улучшить гигиену зубов

Гранатовая корка часто используется в зубных порошках и пастах. Считается, что эти пилинги обладают антибактериальным и противокариесным действием, которые могут помочь справиться с множеством стоматологических проблем, таких как гингивит, зубной налет, кариес и язвы во рту (16).Однако необходимы более долгосрочные исследования, чтобы понять преимущества кожуры граната.

10. Может повысить здоровье костей

Гранатовая кожура эффективна в снижении потери плотности костей. Исследования показывают, что употребление смесей из кожуры граната может помочь улучшить здоровье костей и предотвратить возникновение остеопороза после менопаузы. В исследовании говорится, что кожура граната богата дубильными веществами, полифенолами и флавоноидами, а потребление его экстракта в качестве пищевой добавки благотворно влияет на здоровье костей (17).

11. Может улучшить здоровье кишечника

Кожура граната содержит дубильные вещества, которые помогают уменьшить воспаление кишечника благодаря своим противовоспалительным свойствам (18). Кроме того, кожура фруктов помогает уменьшить отек геморроя (19). Некоторые неофициальные данные свидетельствуют о том, что кожура граната также помогает остановить кровотечение во время диареи и улучшает здоровье пищеварительной системы.

12. Может остановить выпадение волос и предотвратить перхоть

Экстракты кожуры граната эффективно используются для борьбы с выпадением волос и профилактического контроля перхоти.Противогрибковая активность кожуры граната помогает уменьшить выпадение волос, вызванное грибковой активностью, и предотвращает появление перхоти (20), (21). Однако в этом отношении доступны ограниченные исследования.

Теперь, когда вы знаете все о пользе кожуры граната для здоровья, давайте посмотрим, как чистить гранат.

Как очистить гранат

  1. Используя острый нож, срежьте верх и низ граната.
  2. Надрежьте кожицу граната сверху вниз.Сделайте 4 надреза, чтобы получилось 4 равных разреза. Только прорежьте кожу, останавливаясь при ударе по белой части.
  3. Поместите гранат в воду и начните ломать его вдоль надрезов, которые вы сделали ранее, чтобы разделить 4 части.
  4. Вытяните семена от кожицы. Семена опустятся на дно чаши, а кожица / косточка всплывет наверх.
  5. Перед тем, как процедить, снимите верхнюю часть воды и удалите лишнюю кожицу и мякоть.

Вот как можно приготовить порошок кожуры граната в домашних условиях.

Как сделать гранатовый порошок

Чтобы приготовить гранатовый порошок в домашних условиях, выполните следующие действия.

  • Возьмите четыре-пять плодов граната и разрежьте каждый плод на четыре части в продольном направлении.
  • Удалите все семена и отделите кожуру.
  • Далее каждую кожуру разрезать на две половинки.
  • Срежьте ножом желтую часть под красной кожей, если вы хотите использовать пилинг в терапевтических целях. Это связано с тем, что желтая часть, когда она высушена и измельчена, может придать вашим смесям горький привкус.Однако, если вы используете кожуру для наружного применения, желтую часть можно оставить нетронутой.
  • Поместите кожуру на тарелку или сухую ткань и поместите под прямые солнечные лучи. Дайте им высохнуть.
  • Оставьте кожуру на солнце, пока она не затвердеет и не потеряет всю влагу.
  • Положите все высушенные на солнце кожуры в чистый сухой кухонный комбайн и измельчите в течение двух минут, пока не получите мелкий порошок.
  • Храните порошок в чистой герметичной стеклянной банке.

Рецепты

1.Цедра граната Тамбли

Ингредиенты

  • Цедра граната — кусок 3 дюйма
  • Свежий тертый кокос — 1/2 стакана
  • Разбавленный йогурт — 1/2 стакана
  • Перец — 1/2 чайной ложки
  • Кумин — 1/2 чайной ложки
  • Соль — 3/4 чайной ложки
  • Растительное масло — 1 чайная ложка
  • Семена горчицы — 1/2 чайной ложки
  • Несколько листьев карри

Указания

  1. В сковороду добавить немного масла и цедры граната, перец и семена тмина.Жарьте их, пока кожура граната не станет слегка хрустящей или не изменит цвет.
  2. В миксере-мясорубке добавьте тертый кокос и обжаренные ингредиенты из шага 1. Добавьте немного соли и измельчите смесь до тонкой пасты.
  3. Смешайте пасту с разбавленным йогуртом. Это тамбли.
  4. В сковороду добавьте немного масла, семена горчицы и листья карри. Когда семена горчицы лопнут, вылейте содержимое сковороды поверх тамбли.

Воспользуйтесь преимуществами тамбли из кожуры граната при лечении диареи в домашних условиях.

2. Гранатовый травяной чай

Ингредиенты

  • Гранатовый порошок — 1 чайная ложка
  • Листья мяты
  • Имбирь
  • Семена тмина
  • Органические листья зеленого чая
  • Мед
  • Направления

    1. Положите все травы в кофемолку и измельчите их до мелкого порошка.
    2. Добавьте 1 чайную ложку смеси в 1 1 / 4 стакана воды и доведите до кипения в течение 1 минуты.
    3. Снимите смесь с плиты и дайте настояться 5 минут. Процедите чай и добавьте мед.

    Вы можете использовать этот гранатовый порошок практически в любой травяной смеси.

    Заключение

    Гранаты известны своим вкусом и пользой для здоровья. Однако кожура этого фрукта также обладает невероятными свойствами, которые могут лечить многие недуги. Считается, что эти пилинги обладают антимикробными и противовоспалительными свойствами и могут бороться со многими проблемами кожи и здоровья.Так что в следующий раз не теряйте кожуру этого фрукта. Храните его в виде порошка и используйте его, чтобы пожинать плоды.