Лечение дисбактериоз у взрослого: симптомы, причины, диагностика, лечение и профилактика

Содержание

Дисбактериоз кишечника: симптомы, коррекция и лечение дисбиоза у взрослых и детей, степени, анализы и профилактика

Дисбактериозом (дисбиоз) называют симптоматическое состояние, характеризующееся нарушением микрофлоры кишечника. В кишечнике в этот момент размножаются патологические бактерии, и нарушается естественный микробный баланс.

Причины дисбактериоза

Существуют различные предпосылки и состояния, которые способны привести к развитию дисбактериоза:

  • заболевания органов ЖКТ,
  • прием лекарственных препаратов, нарушающих микрофлору кишечника (антибиотики),
  • неправильное питание,
  • физиологические возрастные изменения,
  • прием гормональных препаратов,
  • курсы лучевой и химиотерапии,
  • стрессы и неправильный режим дня,
  • пищевые отравления,
  • инфекционные процессы в организме.

Банальные респираторные инфекции или аллергические заболевания могут стать причиной нарушения микрофлоры кишечника, так как в этот период пациенту могут назначаться различные лекарственные препараты, негативно влияющие на микробный баланс.

Как понять, что у вас дисбиоз?

На разных стадиях заболевания симптоматика дисбактериоза различна. Специалисты рекомендуют обращать внимание на следующие проявления:

  • отрыжка,
  • тошнота,
  • урчащие звуки в животе,
  • вздутие и метеоризм,
  • ноющие или режущие боли в области живота,
  • запоры либо диарея и жидкий стул,
  • сухость кожных покровов,
  • неприятный привкус и запах изо рта,
  • утомляемость и нарушение сна.

Наличие одного или нескольких перечисленных симптомов – повод обратиться к врачу.

Диагностика дисбактериоза

Самостоятельно диагностировать состояние дисбактериоза невозможно. Поставить точный диагноз способен только опытный специалист, который обследует пациента при помощи лабораторных методов и специальной аппаратуры. Обратившись за медицинской помощью, пациент проходит обследование, которое включает:

  • исследования мочи и кала,
  • ПЦР-диагностику микрофлоры,
  • визуальный осмотр кожных покровов.

Профилактика дисбактериоза

Развитие заболевания можно предотвратить, если внимательно следить за питанием, избегать стрессовых состояний, соблюдать режим сна и отдыха, не употреблять необоснованных лекарственных препаратов, занимаясь самолечением, контролировать состояние органов желудочно-кишечного тракта.

Что будет, если не лечить дисбактериоз?

Если не лечить дисбиоз, заболевание может перейти в более тяжелую форму, и не исключено появление осложнений. В результате этих процессов в кишечнике будут образовываться токсические вещества, которые с кровотоком будут разнесены по всем органам и тканям. Всасывание и усвоение минералов и витаминов будет нарушено, иммунитет организма ослабнет, и защитные свойства значительно снизятся. Пациент будет легко подвержен различным инфекциям, банальное расстройство кишечника может привести к серьезным заболеваниям, лечение которых нередко требует оперативного вмешательства.

Как вылечить дисбактериоз?

При лечении дисбактериоза важнейшим шагом становится лечение основного заболевания, которое вызвало патологию в кишечнике пациента. Затем проводится терапия по восстановлению микрофлоры кишечника, наиболее правильно подбирать препараты на основе лабораторных исследований посева.

Диета при дисбактериозе

В период лечения и для предупреждения рецидивов необходимо исключить употребление жирного, острого, соленого, жареного, не пить алкоголь. Питание должно быть сбалансированным и щадящим, в рационе должны присутствовать кисломолочные продукты.

Проконсультироваться о диагностике и лечении дисбактериоза и записаться к специалисту вы можете, позвонив в нашу клинику или записавшись через форму на сайте.

УЗНАТЬ ЦЕНЫ

Лекарство от дисбактериоза – как выбрать лучший препарат?

Проблемы со стулом, неприятное чувство в животе может быть связано не только с отравлением пищей. У взрослых и детей за этими симптомами часто скрывается дисбактериоз. Врачи не считают его заболеванием, это состояние часто сопровождает другие патологии или является их следствием. Но устранять нарушение микрофлоры нужно как можно раньше.

Что такое дисбактериоз

Ребенок появляется на свет стерильным, в его организме в норме нет бактерий. Кишечник, кожа заселяются постепенно, начиная с первого прикладывания младенца к груди. Чем старше становится ребенок и более разнообразна его пища, тем больше различных бактерий попадают в кишечник и формируют его микрофлору. У взрослых людей состав микроорганизмов стабилизируется, но становится разнообразным. Его можно сравнить с отпечатком пальцев, несмотря на сходство, он не повторяется ни у одного человека.

Среди кишечных бактерий насчитывается сотни видов хороших микроорганизмов, но в норме встречаются и плохие, рост которых организм может сдерживать. Условно выделяют три типа микробов:

  • доминирующие – присутствуют у всех здоровых людей, к ним относятся эубактеры, бактероиды, бифидобактерии, лактобактерии;
  • непостоянные виды – встречаются не у всех или при определенных условиях, это стрептококки, кишечная палочка, протей, цитобактер;
  • транзиторные виды – иногда попадают в кишечник, но долго там не задерживаются, это такие типы, как дрожжевые грибы, клостридии, синегнойная палочка.

Хорошими микроорганизмами являются доминирующие бактерии, их должно быть большинство. Благодаря присутствию нормальной микрофлоры переваривается пища. Бактерии помогают ферментировать некоторые неперевариваемые продукты, участвуют в всасывании витаминов, аминокислот, сахаров. Сами они тоже синтезируют витамины группы В, К, жирные кислоты. Поэтому при дисбактериозе появляются признаки гиповитаминоза.

Хорошие бактерии выполняют роль живого щита. Они формируют защитный слой на кишечной стенке, которые не позволяет прикрепиться патогенным микроорганизмам и ограничивает их в питательных веществах. Иммунная функция заключается в тренировке клеток иммунитета и регуляции его ответа на проникновение чужеродных микроорганизмов или белков.

Но при изменении соотношения бактерий, увеличении количества транзиторных видов, появлении дрожжевых грибков, развивается дисбактериоз. Его нельзя назвать заболеванием, но самочувствие у человека нарушается. При дисбактериозе в кишечнике нет патогенных микроорганизмов (сальмонелл, холерного вибриона, иерсиний, патогенных эшерихий, а также вирусов). Изменения состава происходят за счет дисбаланса нормальной флоры и увеличения концентрации условно-патогенных бактерий, появления грибков.

Причины

Микрофлора кишечника у взрослых находится в состоянии динамического равновесия. В нем присутствуют определенные бактерии, которые составляют большинство, и около 3 % микроорганизмов, которые меняют свой состав. В норме колебания происходят под влиянием продуктов питания и пищевых привычек. На микрофлору влияет преобладание в рационе сладкого и жирного или преимущественно растительная пища.

Исследования показывают, что жирная еда угнетает бифидобактерии и энтерококки, но в этих условиях размножаются бактероиды. Преимущественно углеводная диета стимулирует размножение бифидобактерий и общего количество микроорганизмов. Но таки перемены носят временный характер и не ведут к появлению симптомов дисбактериоза. Они сами исчезают после изменения питания.

Дисбактериоз кишечника у взрослых появляется в результате других заболеваний.

Основными причинами нарушения микрофлоры являются:

  • длительное лечение антибиотиками;
  • патологии вышележащих отделов пищеварительного тракта;
  • продолжительные монодиеты и постоянное неправильное питание;
  • кишечные инфекции.

Антибиотики широкого спектра действия действуют неселективно. Они угнетают рост или вызывают гибель всех микроорганизмов. Чем дольше курс лечения, тем выше вероятность, что после него разовьется дисбактериоз. Особенно опасны тетрациклиновые антибиотики. Они значительно угнетают размножение кишечной микрофлоры, что приводит к гиповитаминозу В, К, увеличению риска кровотечений.

Гастрит, холецистит, панкреатит, гепатит или дискинезия желчных путей могут привести к развитию дисбактериоза. Опасны цирроз печени, опухолевые процессы в желудке или язва. Эти патологии сопровождаются нарушением переваривания пищи, выработки ферментов. Поэтому в кишечник пища поступает недостаточно обработанной и не может служить питательной средой для бактерий.

Часть из них гибнет, а на их место приходит словно-патогенная флора.

Разгрузочный день, когда рацион строится на употреблении одного продукта питания, не наносит вреда организму. Но монодиета, которая длится несколько недель или становится образом жизни, может привести к дисбактериозу. Опасно постоянное употребление еды, содержащей простые углеводы, животные жиры. Это сладкое, мучное, блюда из фаст-фуда. Такой рацион угнетает размножение нормальной флоры, в кишечнике активируются процессы брожения, появляется большое количество дрожжевых грибков.

Двойной вред кишечнику наносят пищевые инфекции. Они повреждают слизистую оболочку, а лечение антибиотиками убивает полезные бактерии. Поэтому восстановление после болезни проходит особенно тяжело.

Негативно на состояние кишечника влияет курение. Оно создает условия для размножения дрожжевых грибков, поэтому курильщики часто мучаются неприятными симптомами.

Симптомы дисбактериоза

Нет строгих симптомов, которые с большой вероятностью указывают на дисбактериоз. Проявления патологии часто не соответствуют степени тяжести нарушений. Самый частый признак – нарушение пищеварения по типу кишечной диспепсии. Она проявляется следующими симптомами:

  • урчание в животе;
  • метеоризм, усиленное газообразование;
  • вздутие живота;
  • нарушения стула;
  • появление в кале патологических примесей.

Усиление газообразования на начальном этапе происходит после нарушения питания. Если в определенный день в рационе присутствовало молоко, бобовые, большое количество мучного и сладкого, симптомы проявляются ярко.

Нарушения стула изменчивы. Чаще всего дисбактериоз проявляется диареей. Она может сопровождаться спазмами и болью в животе. Иногда неоформленный стул появляется всего раз в сутки, поэтому не попадает под критерий диареи.

Понос может сменяться запором. Такой процесс наблюдается у людей, которые ограничивают количество клетчатки и пищевых волокон в рационе. Это лишает бактерии необходимых питательных веществ, не позволяет удерживать в просвете кишечника воду. Слизистые патологические примеси в каловых массах, боль в животе появляются при запущенных формах дисбактериоза.

Нарушение состава микрофлоры приводит к дефициту витаминов. Если он не компенсируется при помощи питания или приема поливитаминных препаратов, появляются симптомы гиповитаминоза:

  • ухудшается состояние волос, ногтей;
  • на коже появляются высыпания;
  • проявляются аллергические реакции или пищевая непереносимость;
  • повышается утомляемость, снижается работоспособность;
  • нарушается сон.

Кишечные микроорганизмы синтезируют витамин К, который участвует в свертывании крови. При гиповитаминозе учащается появление синяков, гематом под кожей от небольшого механического воздействия. При язве желудка, небольших травмах увеличивается риск продолжительного кровотечения.

В тяжелых случаях дисбактериоз, который сопровождается диареей, приводит к обезвоживанию. У многих пациентов снижается масса тела.

Какое нужно обследование

Симптомы дисбактериоза неспецифические. За одинаковыми признаками могут маскироваться патология органов пищеварения или гиповитаминоз. Поэтому дисбактериоз считается клинико-лабораторным синдромом.

Диагностика начинается с копрологического исследования, которое позволяет оценить пищеварительную функцию, состояние ферментных систем, перистальтику и скорость продвижения пищевого комка.

Но изменение состава кала еще не говорит о дисбактериозе. Необходимо подтвердить изменение состава бактерий в просвете кишечника. В Москве во многих клиниках применяют методы газожидкостной и ионной хроматографии. Они позволяют определить состав микрофлоры по полученным метаболитам.

Часто используют бактериологическое исследование. Для этого смывы со слизистой оболочки кишечника, фекалии или соскоб высевают на специальные питательные среды. Этот способ позволяет получить колонии бактерий и с высокой точностью определить их тип. Также используют специальный анализ кала на дисбактериоз. Но обязательное условие – биологический материал должен попасть в лабораторию не позже, чем через час после его получения от пациента. Кал необходимо поддерживать в теплом виде, чтобы не вызвать гибель бактерий. Метод не оправдывает себя тем, что дает представление только о состоянии флоры толстого кишечника.

Золотой стандарт диагностики дисбактериоза – интестиноскопия. Это эндоскопический метод, во время которого в полость тонкой кишки через рот и желудок или прямую и толстую кишку вводят гибкий зонд с видеокамерой. Он необходим для осмотра слизистой кишечника и получения аспирата его содержимого. Полученную жидкость также засевают на питательную среду. Недостаток метода – необходимость общей анестезии, специальных бактериологических сред и долгое ожидание результата. Иногда для диагностики дисбактериоза применяют дыхательный тест с меченным Н2.

Препараты и их действие

Самый эффективный способ восстановить микрофлору и избавиться от дисбактериоза – использовать препараты из группы пробиотиков. Производители предлагают лекарственные средства в разных формах:

  • капсулы;
  • таблетки;
  • порошок;
  • капли;
  • раствор.

Лекарственную форму подбирает врач в зависимости от возраста пациента. Детям и пожилым людям, которым тяжело глотать таблетки, назначают раствор или порошок для его приготовления. В возрасте 0-3 лет ребенку легче дать капли с пробиотиком. Всем остальным рекомендованы средства в виде капсул или таблеток.

Препараты от дисбактериоза – это лекарства, которые можно приобрести без рецепта врача. Но самолечением заниматься не рекомендуется, только специалист может подсказать, какой тип лучше принимать.

В составе пробиотиков обычно 1-2 типа бактерий, которые хорошо восстанавливают слизистую. Обычно это лакто- и бифидобактерии. Они являются нормальными обитателями кишечника, которые помогают улучшить микробный баланс. Механизм действия этой терапевтической группы связан с подавлением роста патогенной флоры. Молочнокислые бактерии конкурируют за рецепторы на эпителии слизистой оболочки, питательные вещества. Они выделяют молочную кислоту, цитокины, которые оказывают угнетающее действие на патогены.

Эффективно вылечить дисбактериоз помогают препараты из группы пребиотиков. Это лекарства, которые относятся к группе пищевых волокон: инулин и лактулоза, а также препараты на их основе.

Они не расщепляются пищеварительными ферментами и попадают в неизменном виде в толстый кишечник, где становятся питательным субстратом для лакто- и бифидобактерий. Поэтому микробы хорошо размножаются, увеличивают объем бактериальной массы, восстанавливают стенку кишечника. Чтобы лечение было максимально эффективное, рекомендуется пить одновременно пребиотики и пробиотики.

Лечение дисбактериоза не противопоказано при сопутствующих патологиях пищеварительного тракта. Пробиотики не наносят вреда пациентам с язвой желудка, заболеваниями печени или желчного пузыря. А в некоторых случаях они ускорят восстановление.

В запущенных случаях дисбактериоза кишечника и когда симптомы диспепсии слишком мучительны, могут помочь лекарства из группы ферментов. Их должен подбирать врач, в зависимости от типа нарушения пищеварения. Эти средства необходимо пить ежедневно до еды

Сколько времени придется лечить дисбактериоз, сказать тяжело. В некоторых случаях это может растянуться на несколько недель, а при запущенном состоянии – несколько месяцев.

Профилактика дисбактериоза

Даже если использовать эффективные препараты и избавиться от дисбактериоза, нельзя точно сказать, не придется ли его лечить еще раз. Поэтому врачи рекомендуют соблюдать меры профилактики.

Самый эффективный – постоянно придерживаться диеты. Она подбирается в зависимости от типа диспепсии. Универсальное средство профилактики – употреблять продукты, которые содержат естественные пробиотики. К ним относятся крупяные каши, кисломолочные продукты с закваской из бифидобактерий, некоторые сорта хлеба. Если постоянно ощущается брожение в кишечнике, на время терапии нужно исключить из рациона углеводы, молоко, горох и сою. Не рекомендуют употреблять продукты, богатые эфирными маслами. У ним относятся лук, чеснок, редька, редис.

Хорошо пить не менее 1,5 л чистой воды в сутки. Действенный способ стабилизировать состав микрофлоры – принимать растительные соки. В этом помогают морковный, тыквенный, картофельный. Помогают многие растительные продукты: ягоды черники, земляники, абрикосы, клюква. Врач может назначить отвары лекарственных растений. Лечить дисбактериоз при преобладании грибковой флоры можно растворимым цикорием. В некоторых случаях эффективны эвкалипт, календула, соя, зверобой.

В список полезных веществ при дисбактериозе входит инулин. Он ускоряет рост и размножение бифидобактерий, чем помогает увеличить объем полезных микробов в кишечнике. Инулин помогает восстановить слизистую за счет увеличения выработки слизи, изменения степени рН и создания благоприятной среды для бактерий.

К мерам профилактики дисбактериоза относится использование пробиотиков заранее у пациентов, которым необходимо пройти курс лечения антибиотиками или химиотерапию. Это позволяет поддержать нормальный состав микрофлоры и избежать неприятных симптомов после окончания терапии.


Токарева Людмила Георгиевна, врач-терапевт медицинских кабинетов 36,6

 

ИМЕЮТСЯ ПРОТИВОПОКАЗАНИЯ, ПЕРЕД ПРИМЕНЕНИЕМ НЕОБХОДИМО ПРОКОНСУЛЬТИРОВАТЬСЯ СО СПЕЦИАЛИСТОМ

ABC-медицина

При эубиозе (то есть в норме) микрофлора кишечника представляет собой оптимальное соотношение различных бактерий – кишечной палочки, лактобацилл, энтерококков и др., всего более 500 видов. Дисбактериозом называют дисбаланс микробов, который длится продолжительное время. Это очень распространенное состояние, встречающееся примерно у 90 % взрослых и 95 % детей.

При должной коррекции, которую может назначить только врач, дисбактериоз кишечника проходит, но при отсутствии лечения обычно переходит в более тяжелую, прогрессирующую форму. Данное бактериологическое состояние принято рассматривать в качестве проявления или осложнения какого-либо заболевания, чаще всего – желудочно-кишечного тракта.

Причины развития дисбактериоза

Гибель полезных бактерий, населяющих микрофлору кишечника, может быть связана с такими факторами, как:

  • изменение функций желудка, поджелудочной железы или печени, приводящее к недостатку пищеварительных ферментов и появлению непереваренных остатков пищи, которые способствуют росту болезнетворных микробов;
  • пониженный тонус гладкой мускулатуры кишечника или ее спазмы, возникающие в результате психического или физического стресса, хирургического вмешательства, вегетососудистой дистонии – все это приводит к нарушению передвижения пищевых масс;
  • различные заболевания желудочно-кишечного тракта, такие как холецистит, гастрит, панкреатит и пр. , связанные с повышением кислотности или щелочности среды обитания бактерий, что влечет за собой изменение обмена веществ и клеточных мембран полезных микроорганизмов;
  • неправильное пищевое поведение (диеты, недостаток кисломолочных продуктов и клетчатки, употребление консервантов) препятствует нормальному росту полезных микробов или провоцирует их уничтожение;
  • наличие в кишечнике паразитов или болезнетворных микробов, чьи продукты жизнедеятельности убивают полезные микроорганизмы – обычно это связано с дизентерией, сальмонеллезом, вирусными заболеваниями и пр.;
  • прием антибиотиков, пагубно действующих не только на вредных микробов, но и на полезных.

К факторам, повышающим риск развития дисбактериоза кишечника, относят постоянные стрессы и неблагоприятную экологию, от которых страдают жители современных мегаполисов.

Общая симптоматика

Симптомы дисбактериоза кишечника различаются по локализации дисбиотических изменений и степени их выраженности. На тяжесть клинических проявлений влияют возраст, образ жизни, состояние иммунной системы, стадия развития патологии.

1 стадия

На данном этапе дисбаланс бактерий выражен слабо: пациента могут беспокоить небольшие расстройства кишечника. Обычно такое состояние связано с кратковременным воздействием на микрофлору, например, со сменой привычной пищи, напитков. После окончания воздействия провоцирующих факторов или привыкания к новым условиям баланс микрофлоры восстанавливается.

2 стадия

Прекращается производство кишечником необходимого количества ферментов, обеспечивающих нормальное пищеварение. В результате возникает процесс брожения, который проявляется болью и вздутием живота, горечью во рту, метеоризмом, запорами или, наоборот, диареей. Это могут быть симптомы как прогрессирующего дисбактериоза, так и развития заболеваний желудочно-кишечного тракта.

3 стадия

На этой стадии при воздействии большого количества патогенной флоры на стенки кишечника развивается воспалительный процесс. Такой дисбактериоз уже требует медицинского вмешательства. К выраженным симптомам добавляются тошнота, рвота, непереваренные фрагменты пищи в стуле, сильные боли в животе. В некоторых случаях – повышение температуры тела.

4 стадия

Это состояние кишечника, при котором нормальная микрофлора практически полностью вытеснена болезнетворными микроорганизмами, что приводит к нарушению всасывания полезных веществ, развитию авитаминоза и даже анемии. Образующиеся в результате токсины попадают в кровь и провоцируют тяжелые аллергические реакции. Клинические проявления включают возникновение сыпи, экземы, крапивницы, возможно развитие астмы, бессонницы, хронической усталости. Пациент может жаловаться на проблемы с концентрацией внимания. При отсутствии своевременного лечения возникает угроза развития тяжелых кишечных инфекций.

Крайняя степень дисбактериоза – проникновение бактерий желудочно-кишечного тракта в кровь (бактериемия), в некоторых случаях – развитие сепсиса.

Диагностика дисбактериоза

Основная цель диагностики – определение вида микробов, заселяющих кишечник, и их количества. Как правило, используются следующие основные методы:

  • бактериологическое исследование, на качество результатов которого влияют соблюдение сроков доставки и сохранности материала, а также условий культивирования разных видов бактерий;
  • исследование метаболитов микрофлоры, которое основано на определении летучих жирных кислот, выделяемых микроорганизмами. Отличается точностью результатов, простотой и оперативностью выполнения.

При проведении диагностики и постановке диагноза учитывается также, что микрофлора кишечника индивидуальна для каждого человека. Ее состав может зависеть от возраста, потребляемой пищи и сезона. В связи с этим специалист основывается не только на результатах анализов, но и на дополнительных обследованиях, позволяющих выявить причину развития дисбактериоза.

Лечение дисбактериоза

Лечение дисбактериоза у взрослых зависит от причин и симптомов и назначается комплексно. Стандартная схема обычно включает меры, направленные на:

  • устранение избыточности патогенных микроорганизмов;
  • восстановление нормальной микрофлоры;
  • улучшение процесса пищеварения;
  • нормализацию моторики кишечника;
  • стимулирование реактивности всего организма.

Помните, что назначить грамотное и эффективное лечение может только специалист. Чтобы получить квалифицированную консультацию, запишитесь на прием к врачу клиники «АВС-Медицина» по номеру +7 (495) 223-38-83 или заполните заявку на нашем сайте.

Дисбактериоз кишечника. Как лечить дисбактериоз

Организм человека – очень сложная и слаженная система, для нормальной работы которой важно поддержание внутреннего баланса. Но у организма есть и помощники – полезные бактерии, живущие в кишечнике. Они помогают переваривать пищу, получать питательные вещества, более того, они необходимы для работы иммунной системы и защищают организм от распространения вредных, патогенных бактерий. Однако иногда баланс микроорганизмов нарушается, что приводит к неприятным последствиям – развивается дисбактериоз.

Дисбактериоз кишечника – это нарушение состава нормальной микрофлоры кишечника. Количество полезных бактерий снижается, а патогенные микроорганизмы начинают усиленно размножаться. Это заболевание приводит к расстройству пищеварения, дефициту некоторых микроэлементов, снижению иммунитета и плохому самочувствию.

Дисбактериоз кишечника встречается очень часто: по некоторым данным ему подвержены до 90% всех взрослых людей. Еще чаще возникает дисбактериоз кишечника у детей – 95% грудных малышей страдают от этого заболевания. Причин дисбактериоза множество: плохая экология, хронический стресс, неправильное питание. Кроме того, дисбактериоз кишечника может быть вызван бесконтрольным применением антибиотиков и иммунодепрессантов. У детей он часто возникает в связи с переходом на искусственное вскармливание. В то время как грудное молоко богато полезными микроорганизмами и помогает заселить ими кишечник ребенка, искусственные смеси могут нарушить состав микрофлоры и привести к дисбактериозу.

Как лечить дисбактериоз?

Если по тем или иным причинам баланс нормальной кишечной микрофлоры был нарушен и развился дисбактериоз кишечника, лечение лучше начинать сразу, до перехода состояния в затяжную форму и развития более серьезных симптомов. Лечение дисбактериоза должно быть комплексным, поэтому как лечить дисбактериоз в каждом конкретном случае лучше всего расскажет лечащий врач. Дело в том, что дисбактериоз не является самостоятельным заболеванием и может быть симптомом различных болезней, чтобы избавиться от дисбактериоза, необходимо вылечить в первую очередь заболевание его вызвавшее.

Тем не менее, существуют общие рекомендации по лечению дисбактериоза кишечника. Для нормализации состава микрофлоры кишечника применяют, так называемые, бактериальные препараты, например, Линекс, Бификол, Энтерол и другие. Эти препараты содержат живые культуры, характерные для нормальной микрофлоры и помогут восстановить баланс. Кроме того, при дисбактериозе полезно употребление продуктов, содержащих лактобактерии и бифидобактерии. Для нормализации работы пищеварительной системы стоит исключить из рациона продукты, раздражающие слизистую кишечника, т.е. на время отказаться от острого, соленого и маринованного. Для того, чтобы предотвратить распространение патогенных микроорганизмов при дисбактериозе кишечника иногда применяют антибактериальные препараты. Однако выбор препарата и продолжительность курса должен оценивать врач. Применение антибиотиков без рекомендации врача может привести к усугублению дисбактериоза.

Ещё статьи:

симптомы и лечение, профилактика дисбактериоза

Лекарство от дисбактериоза должно быть направлено не только на снятие симптомов, но и благоприятно устранять патологическую микрофлору, которая вызывает это кишечное заболевание. Что такое дисбактериоз, и какие препараты эффективно справятся с ним?


Дисбактериоз. Симптомы

Когда состав микрофлоры кишечника по каким-либо патогенным причинам меняется, то наступает дисбактериоз – нарушение работы желудка и пищеварительной системы, в связи с появлением патогенной микрофлоры.

Здоровый кишечник богат полезными бактериями – бифидобактериями, лактобактериями, бактероидами. Данные микроорганизмы помогают в работе желудка, и имеет защитную функцию. При попадании нежелательных бактерий – стрептококков, протея, грибков рода кандида или стафилококков, происходит дисбаланс здоровой и патогенной микрофлоры.

В процессе борьбы этих двух групп за выживание, человек и ощущает на себе проявление дисбактериоза. Правильное лекарство от дисбактериоза восстанавливает работу кишечника, и человек вновь чувствует себя здоровым.

Но что это за симптомы? Во-первых, это – вздутие живота, болезненные ощущение в области кишечника, поносы, продолжительные запоры и неустойчивый стул (чередование проноса и запора). Также заболевание может проявляться в виде общей слабости и снижении работоспособности, постоянной усталости, снижении аппетита.

Причинами дисбактериоза могут быть следующие факторы:

  • Нерациональное употребление антибиотиков;
  • Кишечные инфекции;
  • Болезни пищеварительных органов, такие как: гастрит, язвы, панкреатит;
  • Перенесенные операции на органах пищеварения;
  • Неправильное питание, недостаток природных витаминов в пище;
  • Снижение иммунитета.

В случае возникновения заболевания после антибиотиков применяют лекарство от дисбактериоза, которые нормализируют микрофлору, уравновешивают баланс бифидобактерий.

Нарушение работы на фоне неправильного питания устраняется путем составления диеты, анализом образа жизни и его коррекции.

Лечение дисбактериоза

Лечение дисбактериоза проводится препаратами двух групп: пробиотики и пребиотики.

Пробиотики – лекарство от дисбактериоза, наиболее эффективные преператы, так как имеют высокую концентрацию бактерий, которые угнетают рост патогенных микроорганизмов. Эта группа представлена следующими препаратами: Бифидумбактерин форте (для ректального применения), порошок Пробифор, Флорин Форте в виде порошка и другие.

Пребиотики – механизм действия основан на процессе расщепления фруктозно-галактозного дисахарида на органические кислоты, что подавляет активность патогенной микрофлоры кишечника. Представители: Дюфалак, сироп Нормазе, Порталак, Ромфалак и другие.

Профилактика дисбактериоза

Для профилактики заболевания рекомендуется больше времени проводить на воздухе, употреблять свежие продукты, особенно в осенне-зимний период. Лучшее лекарство от дисбактериоза это правильно соблюденная диета и хорошее настроение. Стрессы могут провоцировать кишечные заболевания, и осознание этого факта позволяет эффективно справиться с заболеванием или вовсе его избежать.


Регулярные консультации у гастроэнтеролога — это верный способ всегда быть осведомленным о состоянии своего здоровья. Также, соблюдая правила питания и приема лекарств мы можем избежать появления дисбактериоза в нашей жизни.

Дисбактериоз — причины, симптомы и лечение — Медкомпас

Дисбактериоз – это нарушение свойств и состава микрофлоры кишечника, которое оказывает негативное влияние на организм в целом. Заболевание встречается часто, болеют как дети, так и взрослые.

Симптомы болезни

Для дисбактериоза характерен большой диапазон тяжести симптоматики. У некоторых людей он протекает без жалоб, у других вызывает тяжелые расстройства здоровья. Дисбактериоз проявляется нарушениями в работе желудочно-кишечного тракта, кожными проявлениями и симптомами отравления организма.

Наиболее частыми симптомами дисбактериоза является:

  • Нарушение стула в виде запоров и поносов. Понос кашицеобразный, пенящийся, зловонный
  • Дискомфорт и боль в животе
  • Метеоризм
  • Снижение аппетита
  • Тошнота
  • Изжога и отрыжка
  • Неприятный запах изо рта.

Общие симптомы:

  • Головные боли
  • Слабость, недомогание
  • Повышенная утомляемость
  • Нарушение сна
  • Похудение.

Кожные симптомы:

  • Зуд кожных покровов
  • Аллергические высыпания
  • Сухость кожи.

Причины болезни

Наиболее частой причиной дисбактериоза является длительный и бесконтрольный прием антибиотиков. Антибактериальные препараты подавляют рост как «плохих микробов», так и «хороших». Кроме антибиотиков, дисбактериоз могут вызвать любые препараты, подавляющие иммунную систему: кортикостероиды, химио- и лучевая терапия.

Провоцирующим фактором в развитии дисбактериоза являются воспалительные заболевания органов пищеварения, а именно: хронические гастриты, панкреатит, холецистит, гепатит, цирроз печени, язвенная болезнь, дискинезия желчевыводящих путей.

Еще одной причиной является несбалансированное, однообразное питание, злоупотребление жирным и сладким, монодиеты, авитаминоз.

У детей до года, наиболее распространенными причинами дисбактериоза являются: раннее введение прикорма, инфекционные инфекции (особенно кишечные), глистные инвазии.

Диагностика

Диагностика дисбактериоза начинается с кабинета врача-гастроэнтеролога. Последний подробно расспрашивает пациента, узнает, какие жалобы беспокоят, когда они впервые появились, с чем пациент связывает развитие заболевания.

Далее следует осмотр кожи и слизистых.

Подтверждается (или опровергается) диагноз лабораторными методами исследования.

.

Для определения возможных нарушений функций ЖКТ назначается копрограмма– общий анализ кала. Исследования показывает: нарушения ферментативной и кислотообразующей функции желудка, патологию ферментативной функции кишечника и поджелудочной железы, нарушения функций печени и желчного пузыря, а также воспалительные явления желудочно-кишечного тракта.

Осложнения

При отсутствии лечения дисбактериоза, возможен переход заболевания в более тяжелую форму. Не исключен риск развития осложнений, а именно:

  • Развитие патогенной флоры
  • Нарушение всасывания витаминов, минералов и микроэлементов
  • Образование токсических веществ в кишечнике, которые, проникая в кровь, отравляют весь организм
  • Нарушения местного иммунитета, снижение защитных свойств организма.

Кроме того, при отсутствии лечения, дисбактериоз может провоцировать развитие различных заболеваний – сахарного диабета, панкреатита, дискинезии желчного пузыря, желчекаменной болезни, иммунодефицита, псориаза, экземы и атопического дерматита.

Лечение болезни

 Важнейшей частью терапии является лечение основного заболевания, послужившего провоцирующим фактором для развития дисбактериоза. Только в этом случае положительный эффект лечения не заставит ждать.

Следующим этапом в лечении является прием препаратов, восстанавливающих нормальную микрофлору – пробиотиков и пребиотиков. Наиболее правильно подбирать препарат, чувствительный к высеянной флоре.

При наличии патогенной микрофлоры назначаются антибиотики и бактериофаги.

Во время лечения следует избегать приема препаратов, отрицательно действующих на желудочно-кишечный тракт.

Дисбактериоз кишечника: причины, симптомы, лечение

Дисбактериоз (дисбиоз) кишечника — это не самостоятельное заболевание, а скорее совокупность симптомов, связанных с изменением нормальной микрофлоры кишечника. Чаще всего дисбиоз является следствием различных заболеваний ЖКТ или иных негативных воздействий на организм.

 

В здоровом организме человека присутствует множество бактерий, которые активно участвуют в пищеварительных процессах. Среди них можно выделить полезные бактерии (например, лактобактерии, бифидобактерии) и условно-патогенные бактерии, которые не причиняют вреда организму, пока находятся в равновесии с мирными “соседями”. При нарушении баланса микрофлоры количество болезнетворных бактерий начинает превышать количество полезных микроорганизмов. В связи с нехваткой полезных бактерий защитные механизмы организма ослабевают, возникают проблемы с пищеварением и общее ухудшение самочувствия.

 

Развитие дисбактериоза может привести к возникновению других заболеваний желудочно-кишечного тракта, поэтому при появлении подозрительных симптомов важно не заниматься самолечением, а незамедлительно обратиться к врачу-гастроэнтерологу.

 

Причины возникновения дисбактериоза


Основные причины дисбактериоза связаны с различными нарушениями работы систем и органов. Зачастую дисбиоз развивается после длительного приема лекарственных средств, в частности, антибиотиков или гормональных препаратов.

 

В последнее время при лечении коронавируса пациентам с Covid-19 назначают сильнодействующие антибиотики, которые призваны уничтожать вредные бактерии в организме. Но наряду с патогенными микробами уничтожаются и полезные бактерии. На фоне антибактериальной терапии у большинства пациентов появляется дисбактериоз после Ковида. В данном случае принято говорить про дисбактериоз после антибиотиков.

 

Существуют и другие причины возникновения дисбактериоза, а именно:

 

  • последствия оперативного вмешательства;
  • хронические и острые инфекции;
  • вирусные заболевания;
  • частое употребление алкоголя и табакокурение;
  • стрессы, психические расстройства;
  • заболевания пищеварительной системы;
  • неправильное питание;
  • химиотерапия;
  • сахарный диабет;
  • болезни печени и поджелудочной железы;
  • онкологические заболевания;
  • ферментная и лактозная недостаточность;
  • нарушение обмена веществ.

 

Симптомы дисбактериоза у взрослых

 

При изменении микрофлоры кишечника человек сразу ощущает на себе неприятные реакции организма. Симптомы дисбактериоза иногда напоминают проявления других болезней ЖКТ, и в этом нет ничего удивительного, ведь часто само наличие дисбиоза кишечника свидетельствует о сбоях в работе внутренних органов и является следствием иных заболеваний.

 

К наиболее явным симптомам дисбактериоза относятся:

 

  • изжога
  • запоры
  • диарея
  • отрыжка
  • метеоризм
  • вздутие живота
  • боли в животе
  • снижение аппетита
  • металлический привкус во рту
  • аллергические реакции
  • бронхоспазм
  • слабость и быстрая утомляемость
  • головная боль
  • понижение артериального давления
  • субфебрильная температура
  • снижение иммунитета
  • интоксикация организма

 

Диагностика и лечение дисбактериоза в Клинике “Наедине”.

 

Для выявления дисбактериоза, а также сопутствующих нарушений в системе ЖКТ, рекомендуется пройти обследование у врача-гастроэнтеролога.

 

Клиника “Наедине” в городе Кирове располагает всем необходимым оборудованием для точной диагностики различных заболеваний желудочно-кишечного тракта. Кроме того, здесь работают пятеро лучших врачей-гастроэнтерологов с высокой квалификацией и большим опытом практической деятельности.

 

Диагностика дисбиоза после общения доктора с пациентом включает в себя взятие анализа кала на дисбактериоз, бактериологические и биохимические исследования биологического материала. На основе полученных результатов анализов могут быть выявлены нарушения микрофлоры кишечника и поставлен диагноз “дисбактериоз” (дисбиоз).

 

Лечение дисбактериоза направлено, в первую очередь, на восстановление естественной микрофлоры кишечника. Особую роль играет комплексный подход к лечению данного недуга, который заключается в сочетании лекарственной терапии наряду со специальной диетой. Правильное питание при дисбактериозе — важная составляющая на пути к здоровому кишечнику.

 

Для лечения дисбактериоза у взрослых врач-гастроэнтеролог назначает препараты, восстанавливающие баланс микроорганизмов в кишечнике. Это могут быть различные пробиотики, пребиотики, антисептики, иммуномодуляторы, сорбенты и бактериофаги.

 

Точная методика лечения и подбор лекарств для конкретного пациента будет зависеть от текущей клинической картины после детальной консультации с врачом-гастроэнтерологом и всех проведенных исследований.

 

Запись на прием к гастроэнтерологу клиники “Наедине” ведется ежедневно по телефону: (8332) 32-77-77.

Диагностика дисбактериоза

Дисбактериоз — это состояние, при котором кишечные бактерии становятся несбалансированными, что приводит к широкому спектру нарушений пищеварения, включая вздутие живота, диарею, запоры и спазмы желудка, среди прочего. Это состояние было связано с различными заболеваниями, включая синдром раздраженного кишечника (СРК), воспалительное заболевание кишечника и гастрит, и это лишь некоторые из них.

Что такое дисбактериоз?

Дисбактериоз — это нарушение баланса кишечных бактерий.В результате возникает широкий спектр симптомов нарушения пищеварения, включая диарею, спазмы, запор, вздутие живота и несварение желудка. Когда наблюдается несоответствие нормальной микрофлоры кишечника из-за недостатка полезных бактерий и чрезмерного роста вредных бактерий, это может вызвать дисбактериоз.

В микробиоме кишечника обнаружено не менее 400 видов бактерий. Они необходимы для общего здоровья, поскольку помогают пищеварению, борются с патогенными микроорганизмами и синтезируют витамины.Нормальную флору тела можно найти в различных областях, и они необходимы для общего здоровья и хорошего самочувствия. Когда эти бактерии становятся несбалансированными, а вредные подавляют полезные бактерии или бесконтрольно разрастаются, это может вызвать болезнь.

Что вызывает дисбактериоз?

Существует множество факторов, которые могут привести к состоянию, включая чрезмерное или неправильное использование антибиотиков, чрезмерное употребление алкоголя, повышенное потребление сахара или белка, частое использование антацидов, воздействие пестицидов и хронический стресс, и это лишь некоторые из них.Кроме того, плохая гигиена полости рта и беспокойство также могут привести к дисбактериозу.

В некоторых случаях исследования связывают дисбактериоз с рождением через кесарево сечение и кормлением молочной смесью среди новорожденных.

Признаки и симптомы дисбактериоза

Основными признаками и симптомами дисбактериоза являются нарушения пищеварения. Люди с этим заболеванием могут испытывать частые газы или вздутие живота. Это означает, что они ощущают вздутие живота почти все дни недели. Кроме того, они страдают от спазмов в животе, диареи и запоров со слизью в стуле.У них может быть сочетание диареи и запора, пищевой чувствительности, пищевой непереносимости и хронического неприятного запаха изо рта.

В некоторых случаях люди могут испытывать затруднение при мочеиспускании, вагинальный или ректальный зуд, боль в груди, сыпь, утомляемость, проблемы с концентрацией внимания, депрессию, беспокойство и туман в мозгу.

Диагностика дисбактериоза

Врач может диагностировать дисбактериоз на основании признаков и симптомов, истории болезни, физического осмотра и диагностических тестов. У человека может быть дисбактериоз, если у него или у нее есть диагноз синдрома раздраженного кишечника (СРК), длительное употребление антибиотиков в анамнезе, аутоиммунное заболевание или гастроэнтерит в анамнезе.Однако для подтверждения диагноза врач может порекомендовать следующие диагностические тесты:

Тесты на органическую кислоту

Врач порекомендует тест на органическую кислоту. Это делается путем сбора пробы мочи и ее исследования в лаборатории. Они будут искать и проверять определенные кислоты, которые выделяют бактерии в кишечнике. Аномальные уровни означают, что некоторые бактерии выходят из-под контроля.

Комплексный анализ пищеварительного стула (CDSA)

Комплексный анализ стула может дать наиболее глубокий анализ бактерий, как хороших, так и патогенных, которые обитают в кишечнике.Кроме того, исследование стула может определить наличие других оппортунистических инфекций, таких как паразитарные организмы.

Врач разрешит пациенту забрать домой специальное оборудование для сбора пробы стула. Затем образец будет отправлен в лабораторию. Стул будет исследован на наличие бактерий, дрожжей или грибков.

Водородный дыхательный тест

Водородный тест груди определяет наличие газов, производимых бактериями в кишечнике. В водородном дыхательном тесте врач разрешает пациенту выпить раствор глюкозы или сахара.После этого пациент дышит в специальный баллон, где воздух исследуется на наличие газов, производимых бактериями. Когда газов слишком много или слишком много, это может указывать на дисбаланс кишечных бактерий.

Биопсия

Врач может взять образец бактериальной ткани из кишечника, где есть активная инфекция, чтобы увидеть, какие бактерии присутствуют.

Лечение дисбактериоза — это больше, чем просто прием пробиотиков для поддержания баланса в кишечнике.Это как-то связано с правильным выбором пищи, отказом от определенных продуктов и занятий, ограничением потребления алкоголя или его полным искоренением. Соблюдение здоровой диеты и сокращение количества потребляемого сахара и пищевых добавок — многообещающий способ обуздать дисбактериоз и сохранить здоровье кишечника.

Дополнительная информация

Дисбиоз — обзор | Темы ScienceDirect

36.5.2 Дисбиоз

Дисбиоз часто определяют как «дисбаланс» микробного сообщества кишечника, связанный с заболеванием.Этот дисбаланс может быть вызван приростом или потерей членов сообщества или изменениями в относительной численности микробов. Эта теория в первую очередь фокусируется на изменениях в таксономическом составе микробного сообщества и функциях, связанных с отдельными членами или подмножествами членов сообщества. 126 Характеристика дисбиоза традиционно основывалась на таксономических каталогах кишечных микробов, созданных у разных людей в единичные моменты времени с использованием секвенирования 16S или 18S рРНК. 127 Более недавние попытки были попытаться каталогизировать не виды микробов, а скорее микробные гены в кишечнике с использованием метагеномики дробовика. 128,129 Таксономическая характеристика или генетический состав сообщества затем используется для вывода его функций на основе литературных данных исследований с использованием эталонных штаммов микробов. Обычно эти модельные микробы изучаются как отдельные организмы и часто in vitro, чтобы получить эти функциональные данные.

Огромное количество исследований выявило значительные различия в таксономическом составе кишечных микробных сообществ между пациентами с ВЗК и здоровыми людьми из контрольной группы. 130 Эти различия были выявлены в бактериальном, грибковом и вирусном компонентах сообщества. 131 132 Однако конкретные таксономические различия микробов широко варьируются в зависимости от исследований, и окончательная структура сообщества, связанного с заболеванием, не установлена. Это может быть связано с большими различиями в составе микробного сообщества кишечника среди людей и / или с техническими различиями между исследованиями. Таким образом, как определить дисбактериоз и диагностировать «дисбиотическое сообщество», все еще неясно.Также неясно, является ли дисбактериоз причиной, следствием или одновременно причиной и следствием заболевания, поскольку воспаление само по себе может приводить к изменениям в составе микробного сообщества в кишечнике. 133

Дисбактериоз может вызывать или способствовать развитию ВЗК несколькими способами. Это может привести к появлению одного или нескольких микробов с функциями, вредными для хозяина, или потере одного или нескольких микробов с функциями, полезными для хозяина. Поскольку многие микробы в кишечном сообществе имеют важные функциональные отношения друг с другом, изменения в небольшом количестве микробов и / или их функциях могут иметь широкое влияние на сообщество.Конкретные функции, которые могут представлять интерес, включают изменения доступности ниш или характеристик, которые влияют на принятие или устойчивость к колонизации, изменения микробных продуктов или физических характеристик, которые изменяют взаимодействия между бактериями или с хозяином, и изменения в сообществе, которые активируют механизмы вирулентности в в противном случае комменсальные микробы. Наиболее устойчивой характеристикой микробных сообществ больных пациентов является потеря таксономического разнообразия. 134 Однако снова неясно, является ли потеря биоразнообразия в кишечнике причиной или следствием заболевания.Также в настоящее время неясно, как такая потеря разнообразия сама по себе может привести к заболеванию, тем более что животные-гнотобиоты, колонизированные одним или небольшим количеством микробов, не проявляют болезни, связанной с колонизацией только ограниченным сообществом. Это говорит о том, что конкретные микробы в сообществе и их функции имеют первостепенное значение.

Состав и поведение микробного сообщества чрезвычайно чувствительны к окружающей среде. 9 Среда кишечного микробного сообщества состоит как из компонентов, полученных из организма хозяина, так и из проглоченных веществ.Каждый из этих факторов может иметь огромное влияние на состав и поведение кишечного микробного сообщества. Компоненты, производные от хозяина, определяются генетикой хозяина и, возможно, воздействием диеты или других проглоченных веществ непосредственно на хозяина. Наиболее хорошо охарактеризованными детерминантами состава и поведения микробного сообщества-хозяина являются системы противомикробной защиты хозяина. Когда эти системы нарушаются из-за генетического нокаута отдельных компонентов у модельных животных, возникает дисбиоз. 135 Проглоченное содержимое просвета кишечника в основном происходит с пищей. Вклад диеты в микробный дисбиоз представляет особый интерес для многих исследователей, поскольку ВЗК распространяется вместе с распространением западного образа жизни по всему миру, а западная диета сильно отличается от традиционных диет в незападнических обществах. 136 Пищевые компоненты состоят из макроэлементов, таких как жиры и сахар, микроэлементов, таких как витамины и минералы, и непитательных компонентов, таких как диетические эмульгаторы.Западная диета, как правило, сильно переработана и содержит большое количество насыщенных жиров и простых сахаров. Было показано, что этот тип диеты способствует выработке метаболитов, вредных для тканей хозяина. 137 И наоборот, диета с низким содержанием субстратов, необходимых микробам для выработки метаболитов, способствующих здоровью тканей хозяина, также может способствовать развитию болезней. Например, неперевариваемые пищевые волокна используются микробами для производства короткоцепочечных жирных кислот, а пищевой триптофан используется для производства лигандов арилуглеводородных рецепторов, которые способствуют здоровью кишечника. 95,138 Наконец, диетические эмульгаторы часто добавляют в обработанные пищевые продукты для улучшения их текстуры или стабильности. In vitro эти соединения активируют образование фибр в E. coli , что приводит к прилипанию и повреждению тканей этими обычно комменсальными бактериями. 139 Было показано, что потребление диетических эмульгаторов in vivo вызывает дисбактериоз и обострение колита у мышей IL-10 — / — . 140 Другие типы экологического стресса, такие как введение антибиотиков, также могут привести к изменениям в микробном сообществе посредством прямого уничтожения микробов или горизонтального переноса генов. 141,142 Экологический стресс также может определять, ведут ли бактериофаги лизогенный или литический образ жизни. 143 Фаг-индуцированный лизис не только убивает бактерии, но и потенциально приводит к инфицированию новых бактериальных мишеней с изменением поведения этих бактерий.

Открытым вопросом в области дисбактериоза является важность того, когда происходят дисбиотические изменения в микробном сообществе. Кесарево сечение приводит к изменениям в ранних стадиях колонизации, а раннее введение антибиотиков может значительно нарушить развивающиеся сообщества. 144 Оба эти фактора были связаны с рядом иммуноопосредованных заболеваний в более позднем возрасте, но окончательных доказательств причинно-следственной связи или понимания механизмов все еще нет. 145 Кроме того, у многих пациентов развивается ВЗК без событий в раннем возрасте, которые могли бы вызвать дисбактериоз. Таким образом, дополнительные неизвестные события могут способствовать раннему, давнему дисбактериозу на момент постановки диагноза ВЗК, или более острые дисбиотические события также могут способствовать развитию ВЗК. Также ожидается, что тип дисбиотического события будет ключевым фактором в том, как дисбактериоз способствует развитию ВЗК.Остается определить, являются ли это широкими изменениями в сообществе или небольшими кардинальными изменениями в конкретных микробах. Эта неопределенность, по крайней мере частично, связана с техническими проблемами, которые могут переоценить значимость очень распространенных микробов и недооценить функциональную важность менее многочисленных членов сообщества. Технические ограничения доступных в настоящее время методов и данных также могут переоценить важность известных микробов с установленными функциональными данными по сравнению с неизвестными микробами, которые могут быть столь же важны для болезни.Наконец, до сих пор неизвестно, как дисбактериоз вызывает или способствует развитию ВЗК. Есть некоторые свидетельства того, что определенные дисбиотические микробные сообщества могут вызывать заболевание у нормальных хозяев. 146 Однако есть гораздо более убедительные доказательства того, что дисбактериоз работает в сочетании с дополнительными факторами, такими как лежащая в основе генетическая предрасположенность или повреждение кишечника, вызывающее заболевание. Например, перенос микробных сообществ от пациентов с ВЗК стерильным мышам не вызывает спонтанного колита. 69,70,146 Однако он, по-видимому, способствует развитию заболевания на моделях мышей, предрасположенных к заболеванию, таких как мыши IL-10 — / — или с химической индукцией колита. 69,70,146 Кроме того, дисбактериоз, связанный с диетами западного типа, по-видимому, допускает колонизацию организмами, ассоциированными с ВЗК. Свободные от зародышей мыши, колонизированные микробами от мышей, получавших диету с высоким содержанием жиров и сахара, имеют повышенную восприимчивость к колонизации AIEC. 147 Следовательно, дисбактериоз может по-разному влиять на разных хозяев в зависимости от природы дисбиотического сообщества и лежащих в основе генетической предрасположенности к заболеванию у хозяина.Независимо от того, возникает ли дисбактериоз первым и вызывает заболевание, или он является результатом болезни, однажды возникнув, он почти наверняка способствует сохранению болезни.

Микробный дисбактериоз тонкого кишечника лежит в основе симптомов, связанных с функциональными желудочно-кишечными расстройствами

Этическое одобрение исследований на людях

Все исследования на людях были одобрены IRB клиники Мэйо [тестовые образцы (16–006388 и 15–003235), контрольная группа здоровых людей (14– 002382 и 15–003603)], и мы соблюдаем все соответствующие этические нормы.Исследование диетического вмешательства было зарегистрировано на сайте ClinicalTrials.gov (NCT03266536). Все субъекты исследования питания дали информированное согласие, тогда как аспираты тонкой кишки были получены из лаборатории клинической микробиологии в соответствии с отказом от согласия IRB для протокола 15–003235. Биологические материалы, полученные от пациентов, не могут быть переданы на основании протокола, одобренного институциональным IRB.

Отбор аспиратов тонкой кишки

Последовательные пробы аспиратов тонкой кишки от пациентов с симптомами после диагностической ФГДС были получены непосредственно из микробиологической лаборатории с мая по декабрь 2016 года.Образцы дуоденального аспирата собирали во время EGD после прямого прохождения в двенадцатиперстную кишку с минимальным раздувом в желудке с использованием стандартного однопросветного аспирационного катетера, пропущенного через всасывающий порт эндоскопа. Были включены образцы, связанные с пациентами, которые ранее давали согласие на просмотр электронных медицинских карт. Всего за этот промежуток времени было получено 143 аспирата от пациентов с симптомами. После исключения образцов из-за отсутствия согласия или низкой глубины считывания при секвенировании (<1000) было включено в общей сложности 126 пациентов с симптомами.Дуоденальные аспираты, полученные от 38 здоровых добровольцев, участвовавших в других исследованиях и собранные аналогичным образом, также были получены и обработаны аналогичным образом. Клинические метаданные были получены ретроспективным обзором электронной медицинской карты, включая демографическую информацию, ИМТ, клинические показания для тестирования SIBO, количественные результаты посева на аэробные и анаэробные аспираты, курс антибиотиков для лечения SIBO, клинический ответ на антибиотики, необходимость повторного приема антибиотиков, недавние лекарства включая использование антибиотиков и ИПП, операции на желудочно-кишечном тракте, сопутствующие заболевания и т. д.

Критерии диагностики SIBO на основе количественных культур

Аспираты тонкой кишки (10 мкл) наносили штрихами на RBAP (кровяной агар), REMB (грамотрицательная селекционная среда), RBAPA (предварительно восстановленный кровяной агар) и инкубировали в аэробных условиях при 35 ° C, 5% CO 2 , RIMA (дрожжевая селективная среда) и инкубировали при комнатной температуре и на RCDC (анаэробный кровяной агар), RLKC (замороженная кровь, канамицин, ванкомицин — Prevotella , селекция), RPEA (фенол-спиртовой агар — грамположительный селективный) и инкубировали анаэробно либо в клинической лаборатории, либо в исследовательской лаборатории.Общее количество бактерий (анаэробное плюс аэробное количество) было меньше или больше 10 5 КОЕ / мл, а диагноз SIBO был основан на культуре дуоденального аспирата, демонстрирующей рост бактерий ≥ 10 5 КОЕ / мл (аэробный, анаэробный или оба) более 48 часов 15,16,17 .

Сравнение культур и секвенирование 16S рРНК

Бактериальная ДНК была извлечена из аспиратов и биопсий двенадцатиперстной кишки с использованием фенол-хлороформа и из стула с использованием набора для экстракции фекальной ДНК MoBio с последующей амплификацией 16 S рРНК с использованием совместимых с библиотекой Nextera праймеров, фланкирующих V4 гипервариабельная область ([прямое выступание] + 515 F: [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG] GTGCCAGCMGCCGCGGTAA; и [обратное выступание] + 806 R: [GTCTCGTGGGCTCGGAGATGTGTATA протокол секвенирования с использованием с использованием двойного протокола секвенирования 900 и 900 с использованием протокола секвенирования 900 и 900 GGACT).Все образцы секвенировали вместе в режиме парных концов 2 × 300 на приборе Illumina MiSeq с использованием реагентов v3, разработанных Центром геномики Университета Миннесоты.

Сырые последовательности с парными концами были отфильтрованы по качеству, обрезаны адаптером и сшиты с использованием конвейера контроля качества SHI7 35 , с порогом обрезки> 32 и средним показателем качества> 35. Предварительно обработанные считывания анализировались закрытым подбором ссылок с ускоренным механизмом оптимального выравнивания с зазором BURST 36,37 в режиме CAPITALIST против баз данных NCBI RefSeq Targeted Loci Project, посвященных бактериальным и архейным 16 S (https: // www.ncbi.nlm.nih.gov/refseq/targetedloci/) с 97-процентной идентичностью. После фильтрации образцов с низкой глубиной считывания мы приступили к анализу 126 пациентов с симптомами и 38 здоровых людей из контрольной группы. Анализ разнообразия проводился с использованием QIIME v1.9.1 38 , а другие анализы данных, статистические тесты и визуализации были выполнены в R. Для сравнения разнообразия различных типов образцов желудочно-кишечного тракта в исследовании диетических вмешательств последовательности были разрежены до средней глубины. сайта с наименьшим количеством чтений, CLR (центрированное логарифмическое соотношение) — преобразовано после мультипликативной замены и проанализировано с помощью пользовательских сценариев R и пакета «vegan ».

Дифференциальный анализ численности между здоровыми и имеющими симптомы субъектами был выполнен на нормализованных данных обилия 39 для каждого таксономического ранга с использованием теста перестановки (1000 перестановок) с t-статистикой в ​​качестве статистики критерия. Перед тестированием к нормированным данным о численности применялось преобразование квадратного корня. Таксоны с распространенностью <10% или максимальной долей <0,2% были исключены из тестирования. Контроль FDR (процедура Бенджамини – Хохберга) выполнялся для каждого таксономического ранга для корректировки множественного тестирования.SI был сгенерирован с использованием классификации случайных лесов на основе нормализованных данных уровня OTU (пакет randomForest в R). Шкала индекса была определена как вероятность отсутствия симптомов классификации пациентов на основе сгенерированной модели. Этот метод предотвращает перетренированность, удерживая выборку для классификации и прогнозируя на основе оставшегося набора данных n -1. Функция Boruta 40 Выбор (пакет Boruta в R) использовалась для определения OTU, которые вносят значительный вклад в классификацию.Связи с семью демографическими или клиническими переменными были протестированы с использованием моделей линейной регрессии и скорректированы для множественного тестирования с использованием контроля FDR.

Мы сгенерировали DI с помощью метода CLOUD 24 . Вкратце, матрица расстояний Эйчисона здоровых образцов использовалась в качестве эталонного облака, и расстояние от каждого здорового образца до здорового облака было рассчитано для каждого образца в наборе данных. Затем этот расчет расстояния был повторен для каждой выборки пациентов с симптомами относительно здорового облака; расстояния, превышающие два стандартных отклонения (SD) от среднего значения расстояния до здорового человека, считаются «дисбиотическими»; те, кто находится в пределах 2 SD от среднего значения расстояния до здорового человека, считаются «подобными здоровью».Затем эта оценка дисбиоза в облаке была подтверждена с использованием ортогонального подхода, основанного на показателях SI: мы подгоняли показатели SI здоровых к распределению шкалы логитов (значения SI здоровых контрольных людей приблизительно нормальны по шкале logit; p = 0,41, нормальность Шапиро-Уилка контрольная работа). Мы снова применили правило 2 SD, классифицируя образцы с более чем 2 SD от среднего значения распределения здоровых людей как «дисбиотические», а образцы в пределах 2 SD как «аналогичные здоровым». Чтобы сгенерировать DI здесь, мы затем повторно классифицировали выборки по случайному лесу с использованием новых групповых классификаций и использовали OOB вероятность «дисбиотической» классификации в качестве показателя индекса.Эти два независимых метода находятся в тесном согласии, что оценивается по высокой степени корреляции между показателями ОБЛАЧНОГО дисбиоза в выборках и их индексом, основанным на вероятности ( r = 0,7, p = 2 × 10 −16 , Корреляции Пирсона). Оценка расстояния в облаке использовалась во всех последующих анализах. Для сравнения мы также сгруппировали данные с использованием спектральной кластеризации, реализованной в пакете R «kernlab» v0.9.27, с использованием двух центров кластеров и настроек по умолчанию 41 .

Вмененные функции из состава микробиоты

Чтобы предсказать микробные функции, предварительно обработанные считывания ДНК были сопоставлены с версией 13_8 базы данных GreenGenes 16 S рРНК с использованием BURST с идентичностью 97%. Полученные таблицы OTU использовались для создания прогнозируемых аннотаций KEGG с помощью PICRUSt v1.1.3 42 . Размер эффекта линейного дискриминантного анализа (LDA) (LEfSe; Galaxy Version 1.0) 43 затем использовался для выявления предполагаемых функций, которые значительно различались (оценка LDA> 2.0) между группами.

Исследование диетических вмешательств на здоровых добровольцах

Это было пилотное проспективное одноцентровое исследование диетических вмешательств на здоровых добровольцах, изначально потреблявших диету с высоким содержанием клетчатки. Исследование было зарегистрировано на сайте clinictrials.gov под номером NCT03266536. Подходящими участниками были здоровые взрослые (≥ 18 лет) с исходным потреблением клетчатки ≥ 11 г / 1000 калорий / день; <10% дневных калорий из добавленного сахара; ≥ 5 порций фруктов и овощей в день; и ≤ 13% дневных калорий из насыщенных жиров на основе заполненного опросника по частоте приема пищи.Пациенты были исключены из исследования, если они не соответствовали вышеуказанным диетическим требованиям, имели известный диагноз воспалительного заболевания кишечника, микроскопический колит, целиакию или другие воспалительные состояния, наличие абдоминальных симптомов на основании исходного анкетного опроса, использование пероральных антибиотиков или пробиотиков в течение последние 4 недели, беременность или планы забеременеть в рамках периода исследования, или любые другие заболевания, состояния или привычки, которые могут помешать завершению исследования. Диетические инструкции и выбор продуктов питания обсуждались на предварительном визите лицензированного диетолога.

Все субъекты прошли скрининг лично или по телефону и заполнили анкету по частоте приема пищи, чтобы убедиться, что они соответствуют критериям включения и исключения. При первичном и последующем посещении им была проведена ФГДС с седацией в сознании. Дуоденальный аспират получали через стандартный отсасывающий катетер, пропускаемый через отсасывающий порт с минимальным надуванием в желудке; аликвота была отправлена ​​в клиническую лабораторию для тестирования на SIBO, а оставшаяся часть хранилась для анализа микробиома при -80 ° C.Было получено восемь биопсий двенадцатиперстной кишки для исследований камеры Уссинга, анализа микробиома и последовательности РНК хозяина. При первоначальном и последующем посещении участники заполнили анкету по симптомам и демографию и предоставили образец стула. Симптомы, оцениваемые с помощью анкет, включали: частоту стула, натуживание, неполное опорожнение, твердый / комковатый стул, боль в животе, связанную с дефекацией, диарею / жидкий водянистый стул, вздутие живота, трудности с глотанием, тошноту / рвоту, изжогу, усталость и аппетит.Ответы записывались в двоичном формате (да / нет). В рамках вмешательства все участники придерживались 7-дневной стандартизированной диеты с типичным для США распределением калорий макронутриентов: 50% из углеводов, 35% из жиров и 15% из белка. Диета была с низким содержанием клетчатки (<10 г / 1000 калорий в день) и высоким содержанием простого сахара (≥ 50% дневных углеводов).

Статистический анализ мощности

Мы выполнили апостериорный расчет мощности для сравнения микробиома между здоровыми и симптомными субъектами, сосредоточив внимание на силе дифференциального анализа численности, где у нас была гораздо более низкая статистическая мощность по сравнению с анализами альфа- и бета-разнообразия. , из-за исправления множественного тестирования.Мы использовали сетевой калькулятор мощности микробиома для проведения анализа мощности (http://fedematt.shinyapps.io/shinyMB/), который был основан на моделировании Монте-Карло и тесте Уилкоксона – Манна – Уитни 44 . Мы использовали коэффициент ложного обнаружения 5%, чтобы исправить множественное тестирование. Предполагая, что мы тестируем 65 родов, при этом численность 10 родов с умеренной численностью (6–15 ранги) снижается на 50% у пациентов с симптомами (по сравнению с 26 дифференциальными родами со средним снижением на 59% в наблюдаемых данных), мы имели средняя мощность 75% для обнаружения этих 10 дифференциальных родов и мощность 100% для обнаружения хотя бы одного значимого рода при текущем размере выборки.Таким образом, исследование было достаточно мощным, чтобы обнаружить умеренную разницу таксонов при сравнении здоровых субъектов и субъектов с симптомами.

Ex vivo функция эпителиального барьера

Исследования камеры Уссинга были выполнены для измерения барьерной функции слизистой оболочки двенадцатиперстной кишки и секреторных ответов, как было описано ранее 45 . Вкратце, биопсии двенадцатиперстной кишки помещали в камеры Уссинга объемом 4 мл (Physiologic Instruments, Сан-Диего, Калифорния), экспонируя 0,031 см области 2 в течение 45 минут после сбора.Камеры были заполнены Кребсом с 10 мм маннитом (сторона слизистой оболочки) и Кребсом с 10 мм глюкозы (подслизистая сторона). Базовое трансэпителиальное сопротивление и ток короткого замыкания каждой ткани измеряли с использованием пары электродов Ag / AgCl с агар-солевыми мостиками и пары токоподводящих платиновых электродов для поддержания условий фиксации напряжения. Парацеллюлярный поток через биопсии измеряли с использованием 4 кДа FITC-декстрана, вводимого на слизистую (концентрация в камере 1 мг / мл). Отбор образцов производился со стороны подслизистой оболочки каждые 30 минут в течение всего 3 часов, и кумулятивная флуоресценция измерялась с помощью Multi-Mode Microplate Reader (BioTek, VT) и преобразовывалась в концентрацию с использованием стандартных кривых.Кумулятивный поток в конце 3 ч был рассчитан для FITC – декстрана. Корреляции Спирмена (непараметрические) использовались для проверки связи между разнообразием микробиома и потоком FITC – декстрана.

RNA seq

Образцы биопсии размораживали на льду, гомогенизировали и центрифугировали при 13000 об / мин, а супернатант переносили в новую пробирку. РНК получали с использованием набора RNeasy Mini Kit (QIAGEN, Hilden, Германия) и секвенировали на Illumina HiSeq 2500. Анализ данных выполняли с использованием Mayo Analysis Pipeline для секвенирования РНК (MAP-RSeq) с выравниванием по строению генома человека (GRCh48.78) 46 . Вкратце, конвейер MAP-RSeq выполняет оценку качества чтения последовательностей из файла FASTQ, выравнивает оставшиеся чтения с TopHat 47 , а количество генов агрегируется с библиотекой Python HTSeq 48 . Средняя общая глубина считывания составила 57 052 ​​595 (стандартное отклонение 8,5 × 10 6 ) и в среднем 87,0% (стандартное отклонение 2,0%) от общего числа считываний, сопоставленных с моделями генов. Условная квантильная нормализация была выполнена для учета длины гена и смещений содержания GC 49 .

1 Подготовка образцов метаболомики H-ЯМР

Образцы аспирата центрифугировали при 4 ° C при 12000 × g в течение 5 минут. 162 мкл супернатанта смешивали с 18 мкл буфера ЯМР (1,5 мкл KH 2 PO 4 , 1 г / л TSP и 0,13 г / л NaN 3 , Sigma-Aldrich) и переносили в Трубка для ЯМР 3 мм. Образцы фекалий предварительно взвешивали (~ 100 мг), рандомизировали и помещали в пробирку с завинчивающейся крышкой, содержащую 50 мг 1.Циркониевые шарики диаметром 0 мм, к которым было добавлено 400 мкл ACN: H 2 O (1: 3). Пробирку помещали в миксер Biospec на 30 с. Затем гомогенизированный образец центрифугировали в течение 20 мин при 16000 × g . Супернатант осторожно переносили в пробирки с центрифугированием и центрифугировали в течение 30 мин при 16000 × g . 80 мкл отфильтрованной фекальной воды вносили аликвотами в 96-луночный планшет и 10 мкл использовали для контроля качества. Отфильтрованную фекальную воду в 96-луночном планшете сушили в токе азота перед восстановлением 540 мкл D 2 O (Sigma-Aldrich) и 60 мкл буфера ЯМР.Восстановленную фекальную воду и буферную смесь переносили в 5-миллиметровые экспериментальные пробирки для ЯМР.

1 H-ЯМР эксперимент

Метаболические профили измеряли на спектрометре Bruker 600 МГц (Bruker Biospin, Райнштеттен, Германия), установленном на постоянную температуру 300 К для образцов мочи, аспирата и фекалий и 310 К для образцов плазмы. Стандартный одномерный эксперимент NOSY был выполнен для каждого образца мочи, аспирата и фекальной воды, а эксперимент CPMG — для образцов плазмы.Всего было выполнено 64 сканирования для каждого образца в 64 тыс. Точек данных для мочи, аспиратов и плазмы; Было собрано 128 сканирований на образец в 64 тыс. Точек данных для фекальной воды.

1 Предварительная обработка данных H-ЯМР

Данные спектров были импортированы в MATLAB (версия 8.3.0.532 R2014a, Mathworks Inc, Натик, Массачусетс, США). Для следующих исполнений использовалась серия сценариев собственной разработки. Фазирование, корректировка базовой линии и спектральная калибровка до TSP (0 ppm).Спектры выравнивались вручную. Чтобы учесть разницу в концентрации образцов, к образцам была применена нормализация вероятностного коэффициента. Собственные скрипты использовались для построения моделей PCA и OPLS-DA и интеграции интересующих пиков. Корреляции характеристик и тенденции были проанализированы в R.

Сводка отчетов

Дополнительная информация о дизайне исследования доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Что такое дисбактериоз: как бактерии в вашем теле разрушают ваше здоровье

Дисбактериоз — это заболевание, от которого страдают многие люди, независимо от того, осознают они это или нет.Дисбактериоз связан с такими заболеваниями, как СРК, болезнь Крона, язвенный колит, аутизм и ожирение. И хотя это обычное заболевание, его влияние на организм все еще в значительной степени неправильно понимается.

В этой статье будет рассказано, что такое дисбактериоз, каковы его причины и как его лечить.

Во-первых, разберемся, что такое дисбактериоз.

Что такое дисбактериоз?

Дисбактериоз или дисбактериоз — это нарушение баланса микробных сообществ в организме.Это может проявляться в более высокой распространенности определенных бактерий, отсутствии бактерий и недостаточном разнообразии бактерий. Дисбаланс может возникнуть на любом из участков тела с микробами, включая кожу, кишечник, влагалище и нос.

Дисбиоз обычно ассоциируется с заболеваниями, связанными с ЖКТ, такими как СИБР, болезнь Крона, язвенный колит и другие. Хотя дисбактериоз связан не только с микробиомом кишечника, он также может влиять на другие микробиомы тела, включая кожу, рот и нос.

Что вызывает дисбактериоз?

Есть некоторые известные факторы, вызывающие дисбактериоз, но не все факторы известны или полностью изучены. Среди известных факторов, которые могут привести к дисбактериозу, — изменение диеты, прием антибиотиков и стресс. Часто дисбактериоз возникает из-за комбинации этих факторов, и предрасположенности также могут играть роль.

Исследования показали, что воздействие дезинфицирующих средств, бытовых чистящих средств и других химикатов, особенно в молодом возрасте, может привести к увеличению риска дисбактериоза.Метод родов также считается предрасполагающим фактором риска развития дисбактериоза. Те, кто родился в результате кесарева сечения, а не родились естественным путем, представляют более высокий риск дисбактериоза и состояний, связанных с дисбактериозом.

Кто подвержен риску дисбактериоза?

Предрасположенность, образ жизни и окружающая среда могут подвергнуть человека более высокому риску развития дисбактериоза. Дети, рожденные в результате кесарева сечения, представляют собой более высокий риск, как и дети, которые в раннем возрасте подвергаются высокому воздействию дезинфицирующих средств и антибиотиков.Это связано с высокой пластичностью микробиома на этапах развития детства.

Для пожилых людей окружающая среда и состояние здоровья могут способствовать риску. Опять же, употребление антибиотиков увеличивает риск, а также увеличивает стресс и ослабляет иммунную систему. Те, кто находится в больнице или в учреждениях долгосрочного медицинского обслуживания, подвержены повышенному риску дисбактериоза, чем те, кто живет самостоятельно, с меньшим количеством бактериальных и вирусных воздействий.

Симптомы и состояния дисбактериоза

Симптомы дисбактериоза зависят от типа и расположения бактериального дисбаланса в организме.Дисбиоз может произойти в любой нише микробиома, включая микробиом кишечника, микробиом кожи, микробиом полости рта и многое другое. Симптомы могут быть от легких до тяжелых и могут быть связаны с другими состояниями, помимо дисбактериоза.

Общие симптомы дисбактериоза включают:

  • Тошнота
  • Расстройство желудка
  • Диарея
  • Запор
  • Вздутие живота
  • Усталость
  • Затрудненное мочеиспускание
  • Галитоз (неприятный запах изо рта)
  • Боль в груди
  • Сыпь
  • Проблемы с концентрацией
  • Беспокойство
  • Депрессия

Если вы испытываете какие-либо из этих симптомов в течение длительных периодов времени или хронически, вам следует проконсультироваться с врачом.

Состояния, связанные с дисбактериозом

Когда мы говорим о дисбактериозе и связанных с ним состояниях, мы имеем дело с цыпленком и яйцом. Является ли микробиом при дисбактериозе причиной воспаления, или воспаление является причиной дисбактериоза, или, возможно, это сочетание причины и следствия. В любом случае, исследователи установили связь между следующими заболеваниями / состояниями и дисбактериозом:

Связь между дисбактериозом и этими состояниями привела к появлению новых видов лечения, включая трансплантацию фекальной микробиоты (FMT) и другие курсы лечения, ориентированные на бактерии.

Исцеление от дисбактериоза кишечника

Дисбактериоз может быть сложно поддающимся лечению состоянием, но есть определенные диеты и методы лечения, которые, как было доказано, уменьшают симптомы дисбактериоза. Некоторые люди придерживаются диеты FODMAP, в то время как другие используют конкретную углеводную диету, какой бы она ни была, диета может быть эффективным способом уменьшить бактериальный дисбаланс.

Еда:

  • Темная листовая зелень, например, шпинат и капуста
  • Рыба
  • Свежее мясо (без мясной обработки)

Продукты, которых следует избегать:

  • Молочная
  • Продукты с высоким содержанием сахара Мясные полуфабрикаты
  • Простые углеводы, такие как кукуруза, овес или хлеб
  • Некоторые фрукты, например бананы, яблоки и виноград

Существуют также методы лечения дисбактериоза, а именно FMT.

Трансплантаты фекальной микробиоты все чаще используются для лечения дисбактериоза. Лечение включает пересадку стула от здорового донора в кишечник человека с дисбактериозом. При трансплантации стул, который является богатым источником микробиоты (то есть бактерий, грибков, простейших и вирусов), способен помочь ослабленному микробиому пациента и вернуть его в более сбалансированное и здоровое состояние.

Использование пробиотиков для коррекции дисбактериоза нормальной микробиоты после заболевания или разрушительных событий: систематический обзор

Введение

Популярность пробиотиков в последнее время выросла в геометрической прогрессии, но наряду с увеличением их использования ведутся споры о том, как следует регулировать пробиотики и следует ли рассматривать пробиотики в качестве лечебного питания, лекарства или пищевой добавки.В США пробиотики обычно доступны в виде пищевых добавок и, таким образом, ограничиваются заявлением о «структуре или функции» для здоровья и, в отличие от рецептурных препаратов, не имеют права заявлять, что «лечат» или «излечивают» болезнь. В Европе и Великобритании пробиотики имеют право заявлять о своей полезности или функциональности. Эти утверждения должны быть подтверждены хорошо проведенными испытаниями на людях в целевой популяции или на здоровых добровольцах, но Европейское управление по безопасности пищевых продуктов (EFSA) отклонило> 80% поданных им заявлений.1–3 Во многих случаях научное обоснование конкретного заявления о пользе для здоровья было сочтено недостаточным или основанным на косвенном эффекте4. Одно из таких функциональных заявлений, сделанных в отношении пробиотических продуктов, заключается в том, что они устраняют дисбактериоз (или нарушение жизнедеятельности бактерий и грибов после применения антибиотиков или других препаратов). разрушительное воздействие) и, таким образом, может быть полезным для поддержания здоровья. Пробиотики активны в течение этого чувствительного окна с момента разрушительного события до момента восстановления нормальной микробиоты. Для пробиотиков задокументировано множество механизмов действия (от блокирования участков прикрепления патогенов, разрушения патогена бактериоцинами или протеазами, разлагающими токсины до регуляции иммунной системы) 5, 6, и хотя клинические данные подтверждают Эффективность некоторых пробиотических штаммов, доказательства, связывающие эти механизмы действия с определенными заявлениями о здоровье или функции, не так однозначны.

Классическим примером последствий дисбактериоза является диарея, связанная с антибиотиками (AAD) .7, 8 Хотя антибиотики могут быть эффективными в уничтожении патогенных организмов, общим непреднамеренным эффектом является уничтожение или подавление полезных микробов из-за общей восприимчивости к антибиотику. Одна из многих функций нормальной микробиоты — это способность противостоять заражению патогенными организмами, называемая «резистентностью к колонизации» 9, 10. Например, потеря субпопуляции нормальной микробиоты может привести к потере способности к разрушению. пуховые волокна и крахмалы превращаются в абсорбируемые короткоцепочечные жирные кислоты, что приводит к высокому уровню непереваренных углеводов, которые могут вызвать диарею.11 Было показано, что нарушение нормальной микробиоты приводит к более высокому уровню инфекций в других системах организма, кроме кишечного тракта, включая кожу, 12, 13 влагалище, 14, 15 дыхательные пути, 16, 17 и ротовую полость18. –20

Основной проблемой при установлении причины и следствия улучшения дисбактериоза пробиотиками является отсутствие стандартного определения «нормальной» микробиоты. Виды микробов, присутствующих в разных нишах тела, существенно различаются между индивидуумами, которые также зависят от возраста, географического района и состояния здоровья хозяина.Кроме того, полный учет микробиоты в настоящее время невозможен, поскольку отсутствуют анализы для обнаружения всех> 10 13 –10 14 организмов в кишечнике, а стандартные методы культивирования микробов пропускают 75–95% этих организмов. 21, 22 Развитие метагеномики (каталогизация профилей индивидуальных и специфических для болезней бактериальных генов) и создание международного проекта «Микробиом человека» открыли новую эру в нашем понимании сложности этих взаимодействий в организме.23, 24 Этот сдвиг парадигмы от культивирования к метагеномному анализу расширил наши возможности документировать изменения микробных популяций до беспрецедентной степени, но интерпретация этих сдвигов продолжает оставаться предметом дискуссий.25-28 С появлением этих новых метагеномных инструментов, пересматривается роль пробиотиков в восстановлении нормальной микробиоты.29

В свете новых руководящих документов и рекомендаций цель этого систематического обзора состоит в том, чтобы определить, как требования по восстановлению нормальной микробиоты и коррекции дисбактериоза изучались с помощью хорошо спланированных испытаний и какие штаммы пробиотиков имеют доказательные данные. чтобы поддержать эти утверждения.

Методы

Цель исследования

Систематический обзор литературы для анализа доказательств того, что пробиотики могут исправить дисбактериоз нормальной микробиоты по результатам рандомизированных контролируемых испытаний.

Стратегия поиска

Поисковые запросы включали: пробиотики + заявления о здоровье, восстановление нормальной микробиоты, дисбактериоз, нормальная микробиота, фармакокинетика, метагеномика, пробиотики, пищевые добавки, рандомизированные контролируемые исследования, AAD, Clostridium difficile, инфекция (CDI), воспалительное заболевание кишечника (IBD), синдром раздраженного кишечника (СРК), диарея путешественника (TD), ликвидация Heliobacter pylori, бактериального вагиноза (BV) или вагинита, лечение острой детской диареи и использование определенных пробиотических штаммов или продуктов.Первоначально стратегии поиска были широкими, а затем сузились до клинических испытаний пробиотиков.

Источники данных

PubMed (1985–2013), EMBASE (1985–2013), Кокрановская база данных систематических обзоров (1990–2013), CINAHL (1985–2013), AMED (1985–2013) и ISI Web of Science (2000–2013). Был проведен поиск по трем онлайновым регистрам клинических испытаний: Кокрановскому центральному регистру контролируемых испытаний (http://www.cochrane.org), метарегистру контролируемых испытаний (http://www.controlled-trials.com/mrct) и Национальным институтам здравоохранения. (http: // www.Clinicaltrials.gov).

Критерии отбора исследований и извлечения данных

Отрывки из всех цитат были рассмотрены одним автором и оценены для включения в рандомизированные контролируемые испытания пробиотических препаратов. Полные статьи были извлечены, если были упомянуты нормальные анализы микробиоты. Испытания на неанглийском языке переводились и включались, когда это было возможно. Критерии исключения включали доклинические исследования (модели на животных или анализы in vitro), исследования безопасности или фазы 2, обзоры, испытания эффективности без анализов для нормальных видов микробиоты, только метагеномные методы, механизм действия нормальной микробиоты или пробиотика, перекрестные исследования, отчеты о случаях или серии случаев, повторяющиеся отчеты или исследования неуказанных типов пробиотиков.Были рассмотрены все фармакокинетические исследования на людях, поскольку в их рефератах часто не указывались данные нормального анализа микробиоты. Процесс извлечения данных и обзора соответствовал руководящим принципам заявления о предпочтительных элементах отчетности для систематических обзоров и метаанализов (PRISMA) с использованием контрольного списка из 27 пунктов и блок-схемы.30 Для сбора данных о пробиотике (тип штамма) использовалась стандартизированная форма извлечения данных. , суточная доза, продолжительность), тип контроля (плацебо, активное лечение или отсутствие лечения), дизайн исследования (состояние микробиоты на исходном уровне и время последующего наблюдения), тип анализа микробиоты (микробное культивирование, молекулярные биомаркеры и т. д.), включенное исследование популяция (взрослые и дети, здоровые добровольцы, болезненное состояние), тип и время действия деструктивного агента (антибиотики, химиотерапия и т. д.), размер и отсев исследования, оценка результатов (эффективность и / или статус микробиоты в конце исследования, нежелательные явления) и тип заявления о состоянии здоровья.

Результаты и определения

Первичный результат — это степень коррекции или улучшения микробиоты с помощью определенного (ых) пробиотического штамма (ов). Вторичный результат — это связь между степенью коррекции дисбиоза и чистой эффективностью, обнаруженной в рандомизированных контролируемых испытаниях пробиотических вмешательств. Дисбиоз определяется как изменение или нарушение нормальной микробиоты (бактериальные или грибковые виды) из-за воздействия разрушающего фактора (например, антибиотиков, хронических заболеваний, стресса, медицинских процедур или лекарств и т. Д.).Поскольку в настоящее время не существует стандартного определения «нормальной» микробиоты, для этого обзора восстановление нормальной микробиоты определяется как возвращение к анализируемым видам или профилю микробов, взятым у здорового человека (до того, как произойдет разрушительное событие). Включенные исследования должны иметь по крайней мере анализ лечения препробиотиками и анализ лечения постпробиотиками. В течение периода поиска (1985–2013) было доступно множество микробных анализов, включая документирование микробиоты либо с помощью микробных культур, либо с помощью метагеномных методов (нацеленные на 16s рРНК зонды с использованием флуоресцентной гибридизации in situ (FISH) или другого метода ПЦР) 8, 21, 28, 31 или косвенными методами (по шкале Ньюджента).15 баллов по шкале Ньюджента (от 0 до 10) используются для диагностики бактериального вагиноза (баллы ≥7) или нормальной микробиоты влагалища (баллы 0–3) на основе количественных морфотипов малых грамотрицательных палочек ( Gardnerella vaginalis / bacteroides spp) и изогнутые грамотрицательные палочки ( Mobiluncus spp), полученные при окраске по Граму мазков из влагалищных выделений. Микробиологические анализы только штаммов, содержащихся в пробиотическом продукте, считаются фармакокинетическими исследованиями и не включаются в профили нормальной микробиоты.

Модели дисбактериоза

Для определения воздействия на нормальную микробиоту были включены только прямые свидетельства изменения микробиоты (виды, профили, индексы разнообразия или диагностические критерии), а косвенные эффекты были исключены (изменения кишечных ферментов, параметров иммунной системы или симптомов заболевания). Степень улучшения дисбактериоза подразделяется на три уровня: (1) восстановление нормальной микробиоты до исходного уровня; (2) изменение или улучшение нормальной микробиоты; и (3) отсутствие изменений нормальной микробиоты.

Литература содержала три модели дисбиоза: модель A (восстановление нормальной микробиоты), в которой анализировали пациентов, зарегистрированных со здоровой, ненарушенной микробиотой, а затем снова анализировали после разрушительного события (такого как воздействие антибиотиков) и терапии пробиотиками; модель B (изменение микробиоты) оценивала пациентов с уже существующей нарушенной микробиотой (например, уже существующее хроническое заболевание или активное заболевание), а затем после пробиотической терапии; Модель C (без дисбактериоза) тестировала добровольцев без разрушительного события (до или во время клинического испытания) как в препробиотический, так и в постпробиотический периоды, как показано на рисунке 1.«Восстановление» нормальной микробиоты определяется как восстановление микробиоты до нормального здорового исходного уровня. Восстановление может быть полным (все проанализированные уровни микробов вернулись к исходному уровню) или неполным восстановлением (частичное восстановление некоторых штаммов микробов, но не все вернулись к исходным уровням). В исследованиях, в которых участвовали участники с дисбактериозом на исходном уровне (обычно из-за хронических заболеваний), невозможно показать восстановление нормального уровня микробиоты, потому что нормальная, ненарушенная микробиота не присутствовала у этих типов участников исследования на момент включения в исследование.Таким образом, наиболее веские аргументы в пользу конструкции модели B — это «изменение или улучшение» микробиоты. В этой статье были проанализированы только данные участников, подвергшихся воздействию пробиотиков. Данные контрольных групп использовались для подтверждения дисбактериоза у участников с хроническими заболеваниями или после разрушительного воздействия, такого как антибиотики или химиотерапия, не затронутых воздействием пробиотиков.32–34

Рис. 1

Временная последовательность событий и три модели дизайна исследования, определяющие три различные степени коррекции дисбактериоза пробиотиками.

Оценка методической прочности и качества

Система GRADE (классификация рекомендаций, оценка, разработка и оценка) для оценки общего качества исследования будет использоваться для каждого пробиотического штамма или типа (отдельные штаммы и смеси штаммов) .35 Рекомендация в поддержку заявления о каждом пробиотическом штамме. или смесь могут быть оценены по общей силе доказательств («сильные», многие рандомизированные контролируемые испытания показывают значительное восстановление микробиоты, или «умеренные» — только одно рандомизированное контролируемое испытание; или «слабые», только серии случаев или отчеты, ограниченное количество малых испытаний и т. д.).

Качество доказательств основано на дизайне исследования и оценивается как «высокое качество» (четко определенный дизайн исследования для определения восстановления при нормальной микробиоте, модель A) или «среднее качество» (нарушение микробиоты на исходном уровне, модель B) или «низкое качество» (нарушение работы не произошло, модель C). Измерение систематической ошибки публикации в этом обзоре не оценивалось, поскольку объединенные оценки эффективности результатов не проводились, что типично для метаанализа, но все исследования с анализами микробиоты были включены для ограничения систематической ошибки.

Рейтинг чистой эффективности

Чтобы определить, связана ли способность корректировать дисбактериоз с клинической эффективностью, используйте опубликованную литературу для рандомизированных контролируемых исследований (РКИ) или мета-анализы пробиотиков для различных показаний заболевания, включая AAD, 5, 36, 37 CDI, 5, 38 IBD , 39 IBS, 40 TD, 41 эрадикация H. pylori , 36, 37 BV42 и лечение острой детской диареи были рассмотрены.43–45 Чистый рейтинг был рассчитан путем вычитания количества РКИ, показавших незначительную или эквивалентную эффективность из числа РКИ, показавших значительную эффективность.Ранги были разделены на следующие категории: ++, ≥2 чистых РКИ, показывающих значительную эффективность; +, чистые РКИ, показывающие значительную эффективность; 0, равное количество РКИ, показывающих значимые и незначимые результаты эффективности, и -, ≥1 чистое отрицательное или незначимое РКИ. Пробиотики, не прошедшие РКИ, не оценивались.

Результаты

Обзор литературы за 1985–2013 гг. Обнаружил 353 статьи, посвященные лечению пробиотиками и их потенциальному влиянию на нормальную микробиоту.

Исключенные исследования

Как показано на рисунке 2, в общей сложности 272 статьи были исключены по следующим причинам: обзоры (n = 116), исследования эффективности пробиотиков без данных о нормальных анализах микробиоты (n = 54), модели пробиотиков на животных и изменения микробиоты. (n = 38), только метагеномные методы или методы микробиоты (n = 17), исследования нормальной микробиоты, но без использования пробиотиков (n = 14), анализы микробиоты in vitro (n = 10), дублирующие отчеты (n = 2 ) или разные (n = 21), которые включали исследования механизма действия пробиотиков, исследования безопасности, дублирующие отчеты, перекрестные исследования и два с плохо описанными пробиотическими вмешательствами.46, 47 В общей сложности была рассмотрена 81 полная статья, в которой упоминались изменения в нормальной микробиоте или указывались на полезность пробиотиков и их влияние на нормальную микробиоту.

Рис. 2

Блок-схема результатов обзора литературы (1985–2013) включенных и исключенных исследований по восстановлению или улучшению нормальной микробиоты с помощью пробиотиков. РКИ — рандомизированные контролируемые испытания; МОА, механизм действия; НМ, нормальная микробиота.

Фармакокинетические исследования пробиотиков (n = 18), в которых сообщалось о концентрациях пробиотических штаммов до и после лечения, но не анализировались на другие виды нормальной микробиоты, были исключены.Хотя в нескольких исследованиях, использующих этот дизайн исследования, утверждается, что пробиотики оказали влияние на нормальную микробиоту, тип полученных данных — это фармакокинетическое поведение самих пробиотиков, а не нормальная микробиота. Несколько исследований заявили, что нормальная микробиота была изменена, потому что после введения пробиотиков наблюдалось увеличение количества различных видов бактерий, но проанализированные виды были теми, которые содержались в пробиотическом продукте, поэтому это увеличение не является неожиданным. Фармакокинетические исследования документально подтвердили, что пробиотические штаммы, принимаемые перорально, могут выжить при прохождении через кишечный тракт с уровнем выделения с фекалиями от <1% до 22%.48, 49 Эти фармакокинетические исследования были исключены из этого анализа, поскольку они не тестировали другие типы нормальной микробиоты, не обнаруженные в пробиотическом продукте.

Включены исследования

Из 63 включенных клинических испытаний пять испытаний включали несколько групп лечения, в результате чего в общей сложности было проанализировано 69 групп лечения. Engelbrektson и др. 50 тестировали смесь из пяти штаммов пробиотиков на добровольцах, подвергавшихся воздействию антибиотиков, а также тестировали смесь из четырех штаммов пробиотиков на здоровых добровольцах, не подвергавшихся воздействию антибиотиков.Zoppi и др. 51 в своем исследовании использовали восемь различных групп лечения, и в наш анализ были включены группы пробиотиков (только Saccharomyces boulardii и только Lactobacillus rhamnosus GG ), смесь двух пробиотиков ( L. acidophilus и Bifido bifidum ) и смесь трех пробиотических штаммов ( L. acidophilus, L. rhamnosus и B. bifidum ). Orrhage et al., 52 использовали две группы лечения (только Bifido longum и смесь B.longum и L. acidophilus ). Ларсен и др. 53 тестировали два отдельных пробиотика ( B. lactis и L. acidophilus ) в разных группах лечения. Lidbeck и др. 54 давали либо эноксацин, либо клиндамицин и рандомизировали пациентов либо в группу L. acidophilus , либо в группу плацебо.

Нормальные методы анализа микробиоты

Из 69 лечебных групп, в которых проводились нормальные анализы микробиоты, были использованы различные методы для определения профиля микробиоты.Во многих исследованиях использовались только стандартные микробиологические анализы культур (37, 54%), в то время как в других (28, 40%) использовались методы обнаружения некультивируемых бактериальных штаммов, которые включали метагеномные анализы (FISH, TRFLP, секвенирование 16 s рРНК) или другие ПЦР. техники. В некоторых исследованиях (4,6%) использовалась косвенная оценка нормальной микробиоты с использованием шкалы Ньюджента для диагностики бактериального вагиноза, которая основывается на окрашивании по Граму вагинальных выделений, pH влагалища и симптомах для определения наличия или отсутствия нормальной микробиоты.15

Штаммы пробиотиков

В 69 группах лечения большинство (36, 52%) использовали один штамм пробиотика, в то время как 14 (20%) тестировали смесь двух пробиотических штаммов и 19 (28%) тестировали смесь трех или более пробиотических штаммов. Распределение пробиотиков с одним штаммом по сравнению с множественными пробиотиками незначительно варьировалось в зависимости от модели исследования (= 2,3, p = 0,32). Из 15 групп реставрационного исследования (модель A) 47% использовали один штамм пробиотика и 53% использовали несколько штаммов. Из 25 групп лечения с нарушенной микробиотой на исходном уровне (модель B) 44% использовали один штамм и 56% использовали несколько штаммов.Из 29 групп исследования с неповрежденной микробиотой (модель C) 62% использовали один штамм и 38% использовали несколько штаммов.

Модель восстановления нормальной микробиоты (модель A)

Было найдено только 10 исследований (с 15 группами лечения) с использованием модели А для определения восстановления микробиоты (таблица 1) .32, 34, 50–52, 54–58 Тип включенных участников варьировался от здоровых добровольцев до детей с нелеченными респираторные инфекции, педиатрическим больным раком. Для участников с острыми инфекциями или раком базовые анализы проводились перед разрушающим агентом (антибиотиками или химиотерапией).Число участников, получавших пробиотики, составляло в среднем 20 на исследование и варьировалось от 5 до 83. В 93% разрушающим фактором было воздействие антибиотиков, а в одном исследовании химиотерапия вызвала нарушение микробиоты. Только 8 (53%) групп исследования выполнили анализ в течение периода наблюдения 1–8 недель после прекращения приема пробиотика.

Таблица 1

Доказательные данные о восстановлении нормальной микробиоты (НМ) для 12 пробиотиков из 10 исследований (15 групп лечения; модель A)

Анализ пробиотических штаммов по отдельности выявил только два пробиотических продукта в более чем одном рандомизированном контролируемом исследовании.Пробиотическая смесь L. acidophilus и B. bifidum показала полное восстановление в одном исследовании и только частичное восстановление в другом (сила: сильная, качество: высокое). Пробиотическая смесь L. acidophilus (2 штамма) с B. bifidum и B. animalis показала полное восстановление в одном исследовании, но только частичное восстановление в другом (сила: сильная, качество: высокое). Пять других пробиотических продуктов только в одном подтверждающем клиническом исследовании показали восстановление микробиоты ( B.longum , Clost. butyricum , L. acidophilus , смесь L. acidophilus с L. paracasei и B. lactis и смесь L. acidophilus с L. paracasei и B. bifidum и два штамма B. lactis ; Прочность: умеренная, Качество: высокое). Три пробиотических продукта с одним подтверждающим клиническим испытанием показали частичное восстановление ( S. boulardii , L. rhamnosus GG, смесь L.rhamnosus с L. bifidus и L. acidophilus ; Прочность: умеренная, Качество: высокое). Только два пробиотических продукта с использованием модели A не показали изменений в микробиоте ( B. breve и смесь L. acidophilus и B. longum ; сила: умеренная, качество: высокое). Таким образом, 10 из 12 (83%) пробиотических продуктов показали полное или частичное восстановление нормальной микробиоты.

Из 11 пробиотических продуктов с заявлением о «восстановлении или улучшении нормальной микробиоты» 10 (91%) были поддержаны этим обзором, но только семь показали полное восстановление, а пять — частичное восстановление микробиоты (таблица 1).Смесь L. acidophilus и B. longum не показала никаких изменений в микробиоте. Wada et al., 32 заявили, что B. breve «усилены кишечными анаэробами», но это сравнивалось только с группой плацебо. Их данные показали, что химиотерапия является разрушительным событием, приводящим к увеличению количества энтеробактерий в кишечнике в группе плацебо, но к концу 8-недельного периода наблюдения в группе пробиотиков или плацебо не наблюдалось значительных различий по сравнению с исходной микробиотой уровни.

Нарушение нормальной микробиоты при исходных исследованиях (модель B)

Двадцать четыре исследования (с 25 группами лечения) использовали модель B, в которую были включены участники с ранее существовавшей нарушенной микробиотой, связанной с текущим заболеванием или состояниями (таблица 2) .33, 53, 59–80 Среднее количество участников, получавших пробиотики, составляло 23 ± 16 / исследование и варьировались от 7 до 83 участников. Типы ранее существовавших факторов, нарушающих микробиоту, включали пациентов с атопическим дерматитом, аллергии, цирроз, бактериальный вагиноз, синдром раздраженного кишечника, воспалительные заболевания кишечника (язвенный колит и поучит), идиопатическую диарею, энтеральное питание, синдром короткой кишки и рак толстой кишки. .Только 10 (40%) групп исследования проводили анализ в течение периода последующего наблюдения после введения пробиотиков.

Таблица 2

Доказательные данные по улучшению или изменению нормальной микробиоты (NM) в 18 пробиотиках из 24 исследований (25 групп лечения) с нарушенной микробиотой на исходном уровне (модель B)

Три пробиотика прошли несколько клинических испытаний, подтверждающих улучшение микробиоты за счет пробиотика. S. boulardii использовался в двух испытаниях либо с пациентами с энтеральным питанием, либо с пациентами с активной диареей и обнаружил улучшение привычной микробиоты у пациентов с активной диареей, 66 но продемонстрировал только косвенные доказательства изменений короткоцепочечных жирных кислот в другое исследование65 (Сила: сильная, Качество: умеренное).Смесь из четырех пробиотических штаммов (2 штамма L. rhamnosus , P. freudenreichii + B. breve ) показала улучшение микробиоты в двух клинических испытаниях74, 75 (сила: сильная, качество: умеренное). Из четырех клинических испытаний смеси семи пробиотических штаммов, два не показали значительных изменений в микробиоте, 77, 78 одно показало, что постпробиотическая обработка больше анаэробами79, а одно обнаружило уменьшение количества видов бактероидов80 (сила: сильная, качество: умеренная). Три клинических испытания показали, что не было значительных изменений, связанных с Lactobacillus plantarum 299v62–64 (сила: сильная, качество: умеренное).Из этих пробиотиков только одно подтверждающее клиническое испытание (сила: умеренная, качество: умеренное), два отдельных пробиотических штамма ( E. coli Nissle и L. casei rhamnosus ) и пять различных смесей пробиотических штаммов подтверждают утверждение о том, что пробиотик изменяет микробиоту (таблица 2). Таким образом, 10 из 18 (56%) пробиотических продуктов изменили или улучшили микробиоту у людей с ранее существовавшим заболеванием.

Из 25 лечебных групп утверждение статьи было подтверждено в 14 (56%) исследованиях.Не было значительных изменений микробиоты из-за пробиотика в девяти группах лечения и только изменение микробиоты в пяти других (таблица 2). Наш обзор не согласился с заявленными результатами в 11 (46%) других группах лечения. В семи группах лечения было заявлено, что тестируемый пробиотик «восстановил нормальную микробиоту», но неясно, как был сделан этот вывод, поскольку не было времени, когда нормальная неповрежденная микробиота присутствовала. Из семи исследований, в которых утверждалось, что их пробиотики «восстановили» нормальную микробиоту, наш анализ показал, что ни одно из них не способно документально подтвердить восстановление, но подтверждено, что пробиотики улучшили или изменили микробиоту в этих исследованиях.В четырех исследованиях утверждалось, что пробиотик «изменил или улучшил» нормальную микробиоту, но в этом обзоре не было обнаружено значительных различий при сравнении постпробиотических и исходных анализов для групп пробиотиков. Girard-Pipau и др. 65 пришли к выводу, что S. boulardii «изменил нормальную флору», потому что в группе пробиотиков было обнаружено больше грамположительных анаэробов по сравнению с контрольной группой, и увеличение трех короткоцепочечных жирных кислот наблюдалось в группе пробиотиков. S. boulardii группа.Однако, когда анализ ограничивается тенденциями, наблюдаемыми только в группе пробиотиков, не наблюдалось значительных различий в профилях микробиоты препробиотиков и постпробиотиков. Вентури и др. 77 пришли к выводу, что смесь из семи пробиотических штаммов увеличивает концентрацию некоторых полезных штаммов в кишечнике. Однако единственными штаммами, имеющими значительное увеличение, были штаммы, содержащиеся в смеси пробиотиков, а не конкретно нормальная микробиота хозяина. Поскольку это исследование не имело исходного уровня микробиоты, увеличенное количество лактобацилл и бифидобактерий могло не отражать их нормальные уровни.Van der Aa и др. 59 утверждали, что B. breve «успешно модулирует кишечную флору», но при сравнении исходного уровня с уровнем постпробиотика не наблюдалось значительных изменений в группе пробиотиков. Odamaki и др. 33 действительно показали увеличение Faecalibacterium spp и Bacteroides fragilis spp в конце лечения B. longum BB536, но такое же увеличение наблюдалось и в группе плацебо.

Непрерывные исследования нормальной микробиоты (модель C)

В 29 испытаний были включены здоровые взрослые люди, у которых во время исследования не присутствовал деструктивный фактор (отсутствие антибиотиков, отсутствие лекарств или наличие острого или хронического заболевания), которые могли бы повлиять на нормальную микробиоту, как показано в таблице 3.14, 49, 50, 81–106. Среднее количество участников, получавших пробиотики, составляло 23 человека в исследовании и варьировалось от 7 до 160 человек в исследовании. Из 29 групп исследования анализы проводились в течение периода наблюдения только в 52%. Fujiwara и др. 84 культивировали семь здоровых добровольцев и обнаружили энтеробактерии и клостридиальных видов после B. longum было снижено на 10 1 / г по сравнению с исходным уровнем (p <0,03), но никаких других изменений в микробиоте не произошло. были обнаружены. Karlsson и др. 94 обнаружили значительное увеличение кишечного разнообразия у девяти добровольцев мужского пола с атеросклерозом, получавших L.plantarum 299v, но поскольку тесты полиморфизма длин концевых рестрикционных фрагментов использовались вместо культур для видов бактерий, специфические изменения в видах микробиоты не могли быть определены. Ян и Шеу культивировали 63 ребенка (55% с Helicobacter pylori ), получавших йогурт с L. acidophilus и B. lactis , но обнаружили только снижение количества E. coli в H.pylori отрицательных. в подгруппе детей, существенных изменений нормальной микробиоты у H.pylori — положительные дети. 100 Кубота и др. 103 проанализировали 29 участников с аллергией на пыльцу японского кедра и обнаружили, что молоко, ферментированное с использованием L. rhamnosus GG и L. gasseri TMC0356, подавляло изменения микробиоты (меньше изменений кишечного профиля), но не удалось определить изменения конкретных видов бактерий из-за типа используемого анализа (FISH и TRFLP) .103 Таким образом, только 4 из 19 (21%) пробиотических продуктов изменили микробиоту у здоровых людей, у которых не было разрушительного события.

Таблица 3

Модель C: Доказательные данные по улучшению или изменению нормальной микробиоты (NM) в 19 пробиотиках у здоровых добровольцев, включенных в 29 исследований (29 лечебных групп) в исследованиях без разрушительного воздействия

Из семи исследований, в которых утверждалось, что их пробиотики «восстанавливают или изменяют» нормальную микробиоту, только четыре утверждения были подтверждены. Сьерра и др. 96 заявили, что Lactobacillus salivarius дали 20 здоровым взрослым «улучшенная микробиота кишечника», но были обнаружены только повышенные уровни лактобацилл и никаких других изменений у нормальных видов микробиоты обнаружено не было.Единственное другое свидетельство было косвенным из наблюдаемых изменений иммунных параметров. He и др. 99 заявили о смеси B. longum и B. animalis «модифицированной» микробиоты, но изменения наблюдались только во время приема йогурта, а не после периода наблюдения в течение 1 недели. Витали и др. 14 утверждали, что смесь из четырех штаммов лактобактерий и трех штаммов бифидобактерий «модулировала вагинальную микробиоту», но единственные значительные изменения были связаны с увеличением количества видов бактерий, содержащихся в смеси пробиотиков.

Из пробиотиков, подтвержденных многочисленными клиническими испытаниями ( B. animalis , B. longum , L. casei , L. plantarum 299v, смесь B. animalis и B. lactis ), 13 испытаний (87%) подтверждают отсутствие значительных изменений нормальной микробиоты, если микробиота не нарушена (сила: сильная, качество: низкое).

Ассоциация клинической эффективности и восстановления нормальной микробиоты

В нескольких исследованиях одновременно сравнивалась клиническая эффективность и способность восстанавливать или улучшать нормальную микробиоту после дисбактериоза.Был проведен синтез литературы по РКИ по восьми распространенным показаниям болезни, и была оценена общая сила сети. Эффективность пробиотиков, способных восстанавливать нормальную микробиоту, часто подтверждалась РКИ, как показано в таблице 4. Из 10 пробиотиков с доказательствами восстановления 7 (70%) также прошли по крайней мере одно РКИ по крайней мере для одного из восьми. болезней, в то время как 30% не имели поддерживающих РКИ по эффективности. Из семи пробиотиков, включенных в ассоциированные РКИ, только два пробиотика ( S.boulardii и L. acidophilus ) имеют убедительные доказательства эффективности при большинстве показаний к болезни, в то время как пять пробиотиков, способных восстанавливать микробиоту, имели слабые доказательства эффективности или отсутствовали. Например, S. boulardii , у которого есть исследования, поддерживающие восстановление, имеет убедительные доказательства клинической эффективности для AAD (рейтинг ++: 11 РКИ имели значимые результаты, а 6 имели незначительные результаты), CDI (рейтинг ++: было два РКИ со значительными результатами. ), IBD (с рейтингом ++: было два РКИ со значительными результатами), IBS (с рейтингом 0: было одно РКИ со значительной эффективностью и одно РКИ с незначительными результатами), TD (рейтинг +: 3 РКИ со значительной эффективностью и 2 с незначительными результатами. эффективность), H.pylori (ранжирование -: 2 РКИ со значительными результатами и 4 с незначительными результатами) и отсутствие исследований на BV. L. acidophilus , который частично восстановил микробиоту в исследовании, связан с клинической эффективностью в отношении AAD, IBS и BV, но не в отношении TD или ликвидации H. pylori и лечения острой детской диареи (рейтинг ++: имел 19 РКИ со значительной защитой и пять с незначительными результатами). Напротив, L. rhamnosus GG, еще один пробиотик, способный восстанавливать микробиоту, часто упоминается в метаанализе как обладающий значительной эффективностью при ААД.Наши результаты обновленного обзора литературы указывают на чистую слабую оценку клинической эффективности по всем показаниям болезни: AAD (оценено -: 3 РКИ имели значимые результаты, а 6 — незначительные результаты), CDI (ранжировано -: два РКИ с несущественные результаты), IBD (ранг -: одно РКИ с незначительными результатами), IBS (оценка 0: 2 РКИ со значительной эффективностью и два РКИ с незначительными результатами), TD (оценка 0: одно РКИ со значительной эффективностью и один с незначительной эффективностью), H.pylori (рейтинг -: 3 РКИ с незначительными результатами), отсутствие РКИ по БВ и лечению острой детской диареи (рейтинг ++: 10 РКИ со значительной эффективностью и одно с незначительными результатами).

Таблица 4

Сравнение способности пробиотика восстанавливать или улучшать дисбактериоз с ранжированной клинической эффективностью при различных показаниях

Испытания эффективности не проводились так часто для пробиотиков, которые, как было показано, способны только изменять или улучшать, но не восстанавливать микробиоту после дисбактериоза.Из девяти пробиотиков, которые могут изменять микробиоту, 6 (67%) имели поддерживающие РКИ по крайней мере для одного заболевания, но разнообразие исследованных заболеваний было более ограниченным. L. casei имел умеренную сетчатую силу для AAD и бактериального вагиноза, но был нейтральным для способности уничтожить H. pylori , а другие показания к болезни не тестировались в РКИ с L. casei . Пробиотическая смесь L. reuteri и L. fermentum имеет убедительные доказательства бактериального вагиноза, но не других показаний, перечисленных в таблице 4.

Из восьми пробиотиков, не способных изменять или восстанавливать нормальную микробиоту, только L. plantarum 299v имели РКИ на ААД и СРК, оба с чистой отрицательной или слабой клинической эффективностью. B. lactis и смесь L. rhamnosus и L. reuteri имели чистую нейтральную оценку эффективности для лечения острой детской диареи. Для других четырех пробиотических продуктов, не влияющих на нормальную микробиоту, не было РКИ клинической эффективности.Исследования с Bacillus clausii не оценивали нормальную микробиоту и не дали значимых результатов испытаний для искоренения H. pylori и лечения детской диареи.

Из шести пробиотиков с данными только о фармакокинетике самого пробиотика и без других исследований других нормальных штаммов микробиоты, пять имели РКИ, показывающие различную чистую эффективность при различных показаниях к болезни, как показано в таблице 4.

Шесть популярных пробиотиков ( B.clausii , B. infantis , L. reuteri , L. acidophilus + L. helveticus , L. acidophilus + L. casei и L. acidophilus + B. animalis ) имеют только РКИ клинической эффективности, но не опубликовали исследования, посвященные их роли в восстановлении или улучшении нормальной микробиоты.

Обсуждение

Разработка и оценка заявлений о здоровье или функциональности пробиотиков — важный вопрос, который в настоящее время определен в качестве приоритетного для исследований несколькими международными организациями, включая Всемирную гастроэнтерологическую организацию107 и Американское общество питания.2 Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США борется с обоснованными утверждениями о пользе для здоровья пробиотических продуктов и в настоящее время рекомендует использовать утверждения о структуре / функции, такие как «поддерживает регулярность кишечника», но утверждение о восстановлении нормальной микробиоты все еще обсуждается. 108 Европейское управление по безопасности пищевых продуктов (EFSA) предоставляет руководящие материалы, которые рекомендуют, чтобы заявления о здоровье или функциональности пробиотиков имели положительный физиологический эффект и имели соответствующие научные испытания для подтверждения заявлений о пользе для здоровья.3 Приемлемые утверждения о здоровье кишечника могут включать функциональные утверждения (улучшенное время прохождения, более мягкая консистенция стула, уменьшение желудочно-кишечного дискомфорта, защита от патогенов). Поскольку в настоящее время невозможно определить стандартный профиль нормальной микробиоты, EFSA рекомендует, чтобы функциональные заявления о восстановлении нормальной микробиоты документировали восстановление здоровой микробиоты и сопровождались благоприятным физиологическим или клиническим результатом. и механизмы зависят от штамма и могут варьироваться в зависимости от штамма пробиотика, данные должны анализироваться для каждого пробиотического продукта индивидуально.5, 6, 9, 109 112

Недооцененным открытием было влияние дизайна исследования и исследуемых групп на интерпретацию результатов исследования. В литературе обычно встречаются пять различных типов дизайна исследований, связанных с пробиотиками. Наиболее распространенным типом исследований является рандомизированное контролируемое испытание, в котором проверяются результаты эффективности и безопасности у пациентов, но эти испытания обычно не документируют влияние пробиотика на нормальную микробиоту. Вторым наиболее распространенным типом дизайна исследования являются фармакокинетические исследования (документирование восстановления пероральной дозы пробиотика или увеличения пробиотических штаммов после лечения по сравнению с предварительной обработкой или клиренсом пробиотика).Несмотря на то, что в этих кинетических исследованиях не проводился анализ на штаммы, не являющиеся пробиотиками, некоторые экстраполировали их результаты и пришли к выводу, что их пробиотики наблюдали некоторый эффект или улучшение нормальной микробиоты.19, 111 Эти два первых типа исследований не поддерживают доказательную базу. выводы о восстановлении или изменении нормальной микробиоты и были исключены из этого обзора.

Для изучения дисбактериоза подходят три типа исследований. В первом типе исследования нормальная микробиота анализировалась как минимум дважды (на исходном уровне, то есть до воздействия разрушительного события или пробиотиков, а затем еще раз во время или после лечения пробиотиками), чтобы показать фактическое восстановление исследуемой нормальной микробиоты до здоровых исходных уровней.Второй тип дизайна исследования начался с неподходящих исходных условий (исходные образцы, взятые после того, как нормальная микробиота была нарушена хроническим заболеванием). Для пациентов с установленными хроническими заболеваниями не существует исходного уровня «нормальной микробиоты» ни в группе пробиотиков, ни в контрольной группе. Даже если исходные данные взяты во время ремиссии, на микробиоту все еще могут влиять хронические заболевания или острая диарея. Исследования пробиотиков при хронических заболеваниях или острых заболеваниях обычно сообщают о «пре-пробиотическом лечении» и «пост-пробиотическом лечении» и могут показывать значительные изменения в микробных видах, но неясно, отражает ли это истинное восстановление нормальных профилей микробиоты .В исследование третьего типа были включены здоровые добровольцы, которым не вводили антибиотики (так что нормального нарушения микробиоты не происходило), и они демонстрировали только влияние пробиотиков на здоровую микробиоту (как правило, легкие или нулевые эффекты). Контрольные группы не требовались для нашей оценки воздействия пробиотиков на микробиоту, но контрольные группы могут задокументировать степень нарушения нормальной микробиоты провоцирующими агентами (антибиотик, начало болезни и т. Д.).

Пять пробиотиков с одним штаммом ( B.longum , Clost. butyricum , L. acidophilus, L. rhamnosus и S. boulardii ) и пять пробиотических смесей (( L. acidophilus + B. bifidum) , ( L. rhamnosus + L. bifidus + L. acidophilus) , ( L. acidophilus + L. paracasei + B. lactis), (L. acidophilus , 2 штамма, B. bifidum, B. animalis) и (L . acidophilus + L. paracasei + B. bifidum + 2 штамма B.lactis )) задокументировано полное или частичное восстановление нормальной микробиоты (модель A). Только две смеси пробиотиков ((смесь двух штаммов: L. acidophilus + B. bifidum ) и (смесь четырех штаммов: L. acidophilus , 2 штамма, B. bifidum, B. animalis )) были поддержаны подтверждающее исследование. Доказательства того, что пробиотики могут изменять или улучшать нормальную микробиоту (модель B), были обнаружены для трех пробиотиков одного штамма ( E. coli Nissle, S. boulardii и L.casei rhamnosus ) и семь смесей из 2-7 пробиотических штаммов. Из этих 10 пробиотиков, обнаруживших изменение микробиоты, только три прошли несколько испытаний: S. boulardii , смесь из четырех штаммов (2 штамма L. rhamnosus + P. Freudenreichii + B. breve ) и смесь из семи штаммов. (4 лактобациллы и 3 штамма бифидобактерий), но только у одного были стабильные результаты, показывающие улучшение микробиоты.74, 75 Очевидно, что для подтверждения воздействия пробиотика на нормальную микробиоту необходимо более одного исследования.Из 19 пробиотических штаммов (или смесей), изученных на здоровых добровольцах, которые не подвергались воздействию разрушающих факторов (модель C), никаких изменений нормальной микробиоты не наблюдалось для 79%, что указывает на устойчивость микробиоты.

Улучшение нормальной микробиоты за счет определенных штаммов пробиотиков, по-видимому, было связано с лучшими клиническими конечными точками. В рамках восьми распространенных заболеваний, обычно лечатся пробиотиками, большее количество испытаний со значительной эффективностью было связано с пробиотическими штаммами, восстанавливающими нормальную микробиоту, и только одно испытание со значительной эффективностью было обнаружено для пробиотиков, которые не влияли на микробиоту.Однако немногие пробиотики прошли испытания на эффективность при всех восьми заболеваниях, а многие не имели испытаний на эффективность.

Некоторые пробиотики, эффективность которых при различных заболеваниях опубликована, не имели исследований, изучающих влияние пробиотика на нормальную микробиоту: B. clausii , B. infantis , L. brevis , L. reuteri , смесь двух штаммов ( L. acidophilus + L. helveticus ), смесь двух штаммов ( L. acidophilus + L.casei ) или ( L. acidophilus + B. animalis ), смесь четырех штаммов ( L. rhamnosus (два штамма), P. freudenreichii + B. animalis )) и смесь семи штаммы ( L. sporogens, L. bifidum, L. bulgaricus, L. thermophilus, L. acidophilus, L. casei, L. rhamnosus) .

Сравнение результатов с другими исследованиями

Другие обзоры в литературе заявлений о пробиотиках, связанных с изменениями в нормальной микробиоте, были сосредоточены на широких вопросах нормативной стандартизации заявлений о здоровье или функциях, использовании надлежащего дизайна исследований и проблеме определения биомаркеров для «здоровой микробиоты». .3, 29, 112 Донован и др. 2 рекомендует, чтобы заявления о пользе пробиотиков для здоровья подтверждались хорошо проведенными испытаниями на людях в целевой группе населения. Эти обзоры также рекомендуют коррелировать кишечные биомаркеры с клиническими конечными точками, однако ни в одном из этих обзоров не предпринималось попыток сделать это.29, 112 В предыдущих обзорах не предпринимались попытки проанализировать связь между пробиотическими штаммами и их влиянием на нормальную микробиоту путем стратификации на качество дизайна исследования111. В данном обзоре эти проблемы были устранены путем анализа штаммов пробиотиков по качеству дизайна исследования и включения только испытаний, в которых оценивалась нормальная микробиота (либо с помощью микробного культивирования, либо с помощью биомаркеров молекулярных штаммов) и оценивалась степень улучшения дисбактериоза с помощью клинических данных. результаты для каждого пробиотического штамма.

Возможности для будущих исследований

В большинстве исследований (80%) с использованием модели A для документирования восстановления нормальной микробиоты использовались только методы микробиологического культивирования, которые позволяют обнаруживать только те организмы, которые растут в культуре. Использование более совершенных молекулярных метагеномных методов показало, что одно культивирование пропускает до 95% этих организмов.21, 22 Использование метагеномных методов было более распространено в исследованиях с использованием модели B (48%) и модели C (45%). ) дизайн исследования, который касается только потенциального изменения микробиоты.Характеристика микробиоты — сложный вопрос, и всесторонний учет всех бактериальных и грибковых штаммов в организме выходит за рамки наших текущих возможностей. Следовательно, любые исследования изменений микробиоты в лучшем случае неполны, но общие тенденции в бактериальных филотипах могут быть задокументированы с помощью ДНК-зондов и метагеномных методов. Ошибка дифференциального обнаружения может присутствовать из-за разнообразия анализов, используемых в этих исследованиях, и ее следует учитывать в будущих исследованиях.

Еще одно предложение для будущих исследований состоит в том, чтобы включить постпробиотический период в соответствующий период наблюдения.Менее половины рассмотренных исследований проводили анализы на нормальную микробиоту в течение соответствующего периода наблюдения. Как было показано, восстановление от разрушающего фактора может быть продлено (обычно 8 недель) 7, 8, и исследования, в которых не удалось обнаружить восстановление микробиоты, могли выявить возврат к нормальным исходным уровням, если для восстановления было уделено достаточно долгое время. произошло. В будущих исследованиях необходимо дать время для восстановления нормальной микробиоты.

Поскольку действие пробиотиков зависит от штамма, и во многих исследованиях обычно указывается только род и вид тестируемого пробиотика, будущие отчеты должны включать полное описание пробиотика до уровня окрашивания.5, 112

Сильные и слабые стороны

Сильные стороны этого обзора включали полноту стратегии поиска, которая проверяла несколько баз данных цитирования, реестры испытаний и поиск авторов, использование установленных протоколов PRISMA для обзоров и использование схемы классификации результатов для различных степеней оценки микробного восстановления. Этот анализ контролировал смешанные эффекты различных исследуемых популяций и дизайнов исследований, представленных в литературе.Фармакокинетические исследования только самого пробиотического штамма (ов) были исключены, и были включены только испытания, в которых анализировались другие виды, обнаруженные в микробиоте. Применяя стандартное определение для «восстановления» и «улучшения» нормальной микробиоты, можно различать существенные различия по типу используемых дизайнов исследований и различным эффектам различных штаммов пробиотиков. Ограничения этого обзора включают: один автор проанализировал и извлек литературу, объединил испытания, проведенные в разных популяциях (взрослые и дети), а также использовались разные дозы и схемы пробиотиков.Неполный поиск всех исследований, оценивающих влияние пробиотиков на микробиоту человека, также является потенциальным ограничением любого поиска в литературе. Еще одним ограничением является то, что улучшение дисбактериоза и клиническая эффективность пробиотических штаммов также косвенно связаны, прямая причинно-следственная связь не была возможна с типами проведенных исследований. Еще одним ограничением является отсутствие в настоящее время стандартного определения того, что составляет «нормальную микробиоту». Состав микробиоты зависит от человека, возраста, географического положения и состояния здоровья хозяина.Современные микробиологические методы улучшаются, но не могут обнаружить все виды, присутствующие в организме хозяина.

Дисбактериоз кишечника, связанный с симптомами СРК-D

Ссылки: 1. Rezaie A, Heimanson Z, McCallum R, Pimentel M. Дыхательный тест на лактулозу как прогностический фактор ответа на рифаксимин у пациентов с синдромом раздраженного кишечника с диареей. Am J Gastroenterol. 2019; 114 (12): 1886-1893. 2. Кэрролл И.М., Рингель-Кулька Т., Сиддл Дж. П., Рингель Ю. Изменения в составе и разнообразии кишечной микробиоты у пациентов с синдромом раздраженного кишечника с преобладанием диареи. Neurogastroenterol Motil. 2012; 24 (6): 521-530. 3. Чжун В., Лу Х, Ши Х и др. Определенные микробные популяции существуют в микробиоте слизистой оболочки, связанной с преобладанием диареи, синдрома раздраженного кишечника и язвенного колита. J Clin Gastroenterol. 2019; 53 (9): 660-672. 4. Кассинен А., Крогиус-Курикка Л., Мякивуокко Х. и др. Микробиота кала пациентов с синдромом раздраженного кишечника значительно отличается от таковой здоровых людей. Гастроэнтерология. 2007; 133 (1): 24-33. 5. Casén C, Vebø HC, Sekelja M, et al. Отклонения в микробиоте кишечника человека: новый диагностический тест для определения дисбактериоза у пациентов с СРК или ВЗК. Aliment Pharmacol Ther. 2015; 42 (1): 71-83. 6. Пиментел М., Лембо А., Чей В.Д. и др. Терапия рифаксимином у пациентов с синдромом раздраженного кишечника без запоров. N Engl J Med. 2011; 364 (1): 22-32. 7. Рингель Ю. Микробиом кишечника при синдроме раздраженного кишечника и других функциональных расстройствах кишечника. Gastroenterol Clin North Am. 2017; 46 (1): 91-101. 8. Рингель-Кулька Т., Чой Ч., Темас Д. и др. Измененная бактериальная ферментация толстой кишки как потенциальный патофизиологический фактор синдрома раздраженного кишечника. Am J Gastroenterol. 2015; 110 (9): 1339-1346. 9. Король Т.С., Элия М., Хантер Дж. Аномальное брожение толстой кишки при синдроме раздраженного кишечника. Ланцет. 1998; 352 (9135): 1187-1189. 10. Онг Д.К., Митчелл С.Б., Барретт Дж. С. и др. Манипуляции с пищей с короткоцепочечными углеводами изменяют характер газообразования и генезис симптомов синдрома раздраженного кишечника. J Gastroenterol Hepatol. 2010; 25 (8): 1366-1373. 11. Серра Дж., Аспироз Ф., Малагелада Дж. Р. Нарушение транзита и толерантности кишечных газов при синдроме раздраженного кишечника. Gut. 2001; 48 (1): 14-19. 12. Houghton LA, Lea R, Agrawal A, Reilly B, Whorwell PJ. Связь вздутия живота с вздутием живота при синдроме раздраженного кишечника и влияние привычки кишечника. Гастроэнтерология. , 2006; 131 (4): 1003-1010. 13. Данлоп С.П., Хебден Дж., Кэмпбелл Е. и др.Аномальная кишечная проницаемость в подгруппах синдромов раздраженного кишечника с преобладанием диареи. Am J Gastroenterol. , 2006; 101 (6): 1288-1294. 14. Аткинсон В., Локхарт С., Уорвелл П.Дж., Кивил Б., Хоутон Л.А. Нарушение передачи сигналов 5-гидрокситриптамина у пациентов с синдромом раздраженного кишечника с преобладанием запора и диареи. Гастроэнтерология. 2006; 130 (1): 34-43. 15. Gargari G, Taverniti V, Gardana C, et al. Распределение фекальных Clostridiales и короткоцепочечных жирных кислот отражает привычки кишечника при синдроме раздраженного кишечника. Environ Microbiol. 2018; 20 (9): 3201-3213. 16. Tack J, Broekaert D, Corsetti M, Fischler B, Janssens J. Влияние острого ингибирования обратного захвата серотонина на сенсомоторную функцию толстой кишки у человека. Aliment Pharmacol Ther. , 2006; 23 (2): 265-274. 17. Chey WY, Jin HO, Lee MH, Sun SW, Lee KY. Нарушение моторики толстой кишки у пациентов с синдромом раздраженного кишечника с болью в животе и диареей. Am J Gastroenterol. 2001; 96 (5): 1499-1506. 18. Хаутон Л.А., Аткинсон В., Локхарт С., Уорвелл П.Дж., Кивил Б. Сигмовидно-толстая кишка в здоровье и синдром раздраженного кишечника: роль 5-гидрокситриптамина. Neurogastroenterol Motil. 2007; 19 (9): 724-731. 19. Торнблом Х., Ван Ауденхове Л., Садик Р., Абрахамссон Х., Тэк Дж., Симрен М. Время прохождения через толстую кишку и симптомы СРК: какая связь? Am J Gastroenterol. 2012; 107 (5): 754-760. 20. Cremon C, Gargano L, Morselli-Labate AM, et al.Иммунная активация слизистой оболочки при синдроме раздраженного кишечника: гендерная зависимость и связь с пищеварительными симптомами. Am J Gastroenterol. 2009; 104 (2): 392-400. 21. Либрегтс Т., Адам Б., Бредак С. и др. Иммунная активация у пациентов с синдромом раздраженного кишечника. Гастроэнтерология. 2007; 132 (3): 913-920. 22. Гиларте М., Сантос Дж., Де Торрес И. и др. У пациентов с СРК с преобладанием диареи наблюдается активация тучных клеток и гиперплазия тощей кишки. Gut. 2007; 56 (2): 203-209. 23. Чжоу К., Чжан Б., Верн Г.Н. Проницаемость кишечных мембран и гиперчувствительность при синдроме раздраженного кишечника. Боль. 2009; 146 (1-2): 41-46. 24. Piche T., Barbara G, Aubert P, et al. Нарушение целостности кишечного барьера в толстой кишке у пациентов с синдромом раздраженного кишечника: участие растворимых медиаторов. Gut. 2009; 58 (2): 196-201. 25. Shulman RJ, Jarrett ME, Cain KC, Broussard EK, Heitkemper MM.Связь между проницаемостью кишечника, маркерами воспаления и симптомами у пациентов с синдромом раздраженного кишечника. J Гастроэнтерол. 2014; 49 (11): 1467-1476. 26. Mearin F, Lacy BE, Chang L, et al. Расстройства кишечника. Гастроэнтерология. 2016; 150 (6): 1393-1407.

Вакцинотерапия от болезней, связанных с дисбактериозом

Авторские права © Автор (ы) 2020. Опубликовано Baishideng Publishing Group Inc. Все права защищены.

Вакцинотерапия при заболеваниях, связанных с дисбактериозом

Косуке Фудзимото, Сатоши Уэмацу

Косуке Фудзимото, Сатоши Уэмацу, Департамент иммунологии и геномики, Высшая школа медицины Городского университета Осаки, Осака 545-8585, Япония

Косуке Фудзимото, Сатоши Уэмацу, Подразделение центра регулирования врожденного иммунитета, Международные исследования и разработки по вакцинам для слизистых оболочек, Институт медицинских наук, Токийский университет, Токио, 113-8654, Япония

Косуке Фудзимото, Сатоши Уэмацу, Отдел метагеномной медицины, Центр генома человека, Институт медицинских наук, Токийский университет , Токио 113-8654, Япония

Сатоши Уэмацу, Институт совместных исследований инновационной микробиологии, Токийский университет, Токио 113-8654, Япония

Вклад авторов : статью написали Fujimoto K и Uematsu S.

При поддержке Министерства образования, культуры, спорта, науки и технологий Японии (субсидия для начинающих ученых), № 19K17932 (Фудзимото К.).

Заявление о конфликте интересов : Авторы заявляют об отсутствии конфликта интересов.

Открытый доступ : Эта статья представляет собой статью с открытым доступом, которая была выбрана штатным редактором и полностью рецензирована внешними рецензентами. Он распространяется в соответствии с лицензией Creative Commons Attribution NonCommercial (CC BY-NC 4.0) лицензия, которая позволяет другим распространять, ремикшировать, адаптировать, развивать эту работу в некоммерческих целях и лицензировать свои производные работы на других условиях, при условии, что оригинальная работа правильно процитирована и использование не является коммерческим. См .: http://creativecommons.org/licenses/by-nc/4.0/

Автор, ответственный за переписку : Сатоши Уэмацу, доктор медицинских наук, профессор кафедры иммунологии и геномики Высшей школы медицины Городского университета Осаки, 1- 4-3 Asahi-machi, Abeno-ku, Osaka 545-8585, Япония[email protected]

Поступило: 27 декабря 2019 г.
Началась экспертная оценка : 27 декабря 2019 г.
Первое решение : 14 февраля 2020 г.
Доработано: 27 марта 2020 г.
Принято: 23 мая 2020 г.
Статья в прессе : 23 мая 2020 г.
Опубликована онлайн: 7 июня 2020 г.


ВВЕДЕНИЕ

С быстрым развитием технологий секвенирования и анализа генома нового поколения, анализ генома человека закончился, и акцент сместился на исследования комменсальных микробиомов [1-8].Участки тела, которые подвергаются воздействию широкого спектра внешних антигенов через участки слизистой оболочки, такие как органы дыхания и желудочно-кишечный тракт, постоянно колонизируются микроорганизмами, что приводит к симбиотическим отношениям. Если эта связь нарушена, иммунный ответ хозяина на микроорганизмы искажается, что иногда вызывает заболевание. Дисбиоз, который определяется как дисбаланс в репертуаре кишечной микробиоты, связан со многими заболеваниями у людей [9-11]. Следовательно, необходимы новые стратегии борьбы с заболеваниями, связанными с дисбактериозом, путем ослабления функции родственных микроорганизмов.

Антибиотики, которые были впервые применены в 1910 году, коренным образом изменили нашу жизнь [12]. В частности, пенициллин, открытый в 1928 году, способствовал открытию природных антибиотиков. Антибиотики продлили нашу жизнь более чем на 20 лет. Однако из-за чрезмерного использования и ненадлежащего потребления и применения антибиотиков произошло быстрое увеличение числа бактерий с множественной лекарственной устойчивостью, что показывает, что антибиотики не являются панацеей от инфекционных заболеваний [13,14]. Кроме того, антибиотики иногда вызывают дисбактериоз и могут приводить к таким заболеваниям, как Clostridioides difficile ( C.difficile ) инфекция [15]. Таким образом, хотя доступны антибиотики для уничтожения комменсальных бактерий, специфичных для заболевания, они не подходят для уничтожения только патогенов.

Трансплантация фекальной микробиоты (FMT), эффективная терапия связанных с дисбактериозом заболеваний, таких как инфекция C. difficile , улучшает аберрантную микробиоту кишечника [16,17]. Фекалии здоровых людей, которые считаются относительно безопасными, обычно используются для FMT. Однако недавно сообщалось, что устойчивые к антибиотикам бактерии из донорских фекалий передавались реципиентам и вызывали бактериемию [18].Это неотложная проблема, и сейчас FMT не является рекомендуемой схемой. Фактически, удаление только патобионтов через слизистую кишечника затруднено; поэтому крайне желательна разработка новых методов борьбы с заболеваниями, связанными с дисбактериозом, путем ослабления функции патобионтов.

В этом обзоре мы представляем текущие знания о кишечном микробиоме при здоровье и болезнях, а также обсуждаем вакцину для слизистых оболочек нового поколения типа «прайм-буст», которую мы недавно разработали и сообщили для борьбы с болезнями, опосредованными кишечными бактериями.

КИШЕЧНЫЙ МИКРОБИОМ В ЗДОРОВЬЕ И ЗАБОЛЕВАНИЯХ

Кишечные комменсальные микробы в первую очередь анализировались путем выделения отдельных видов бактерий. Поскольку большинство кишечных бактерий не любят аэробные условия, их было трудно культивировать. Однако достижения в культурально-независимых технологиях, таких как секвенирование следующего поколения, показали динамику микробиоты кишечника человека [9,19]. Например, триллионы кишечных микробов обитают в желудочно-кишечном тракте, а дисбактериоз коррелирует с такими заболеваниями, как ожирение [20-22], диабет [23-25], ревматоидный артрит (РА) [26-31] и воспалительные заболевания кишечника ( ВЗК), включая болезнь Крона и язвенный колит [32].Таким образом, в дополнение к лучшему в настоящее время лечению, предполагается, что контроль дисбактериоза может улучшить эти заболевания.

Широко признано, что метаболические заболевания, такие как ожирение и диабет, тесно связаны с диетой и дисбактериозом [22,33]. У мышей без зародышей (GF) не развивается ожирение, вызванное западной диетой [34–36]. В 2006 году также было показано, что колонизация мышей GF кишечной микробиотой мышей с ожирением приводила к значительно большему увеличению общего количества жира в организме, чем колонизация микробиотой от тощих мышей [21].Это предполагает тесную связь между кишечной микробиотой и метаболизмом хозяина. Кишечный микробиом мышей и людей с ожирением имеет значительно более высокое соотношение Firmicutes и Bacteroidetes (соотношение F / B), чем у их худых собратьев [21,37-40]. Кроме того, бактериальное разнообразие у тучных людей ниже, чем у худых [39,41]. Однако другие исследования не показали разницы в соотношении F / B между тучными и худыми людьми [42–46]. Следовательно, хотя разнообразие людей с ожирением невелико по сравнению с таковым у худощавых людей, корреляция между ожирением и соотношением F / B неясна.

Существует повышенный риск развития диабета 2 типа при ожирении; следовательно, дисбактериоз также может влиять на диабет 2 типа. Предыдущие сообщения показали, что нарушение кишечного углеводного обмена и воспаление кишечника слабой степени вызывают инсулинорезистентность [47–49]. Уменьшение количества короткоцепочечных жирных кислот, таких как бутират, связано с диабетом 2 типа [50]. Vrieze et al [51] показали, что FMT улучшает инсулинорезистентность у людей с метаболическим синдромом за счет изменения уровней кишечных бактерий, продуцирующих бутират, что указывает на то, что кишечные микроорганизмы могут быть разработаны в качестве терапевтических инструментов в будущем.

РА — системное воспалительное заболевание, в том числе полиартрит, которое приводит к разрушению суставов. Хотя в патогенезе РА участвуют как генетические факторы, так и факторы окружающей среды, в последнее время большое внимание уделяется анализу кишечной микробиоты, наряду с анализом однонуклеотидного полиморфизма. Когда мышей выращивают в условиях GF, артрит не развивается, что указывает на то, что кишечная микробиота связана с началом артрита [28,52-54]. Abdollahi-Roodsaz et al [53] показали, что у мышей с нокаутом антагониста рецептора интерлейкина-1 не развивается спонтанно опосредованный Т-клетками артрит в условиях GF.Однако у них действительно развивается артрит в условиях отсутствия специфических патогенов, и моноколонизация мышей с помощью Lactobacillus bifidus вызывает артрит [53]. Мацумото и др. [55] также показали, что у трансгенных мышей с Т-клеточным рецептором K / BxN развивается артрит в условиях отсутствия специфических патогенов, но не в условиях GF, а моноколонизация мышей сегментированными нитчатыми бактериями вызывает артрит. Предыдущие исследования показали, что состав микробиоты изменяется при раннем РА [26,28,56].На доклинических стадиях РА в кишечнике преобладают видов Prevotella , такие как Prevotella copri ( P. copri ). Маеда и др. [28] показали, что микробиота, выделенная от пациентов с РА, чьи фекальные бактерии содержали высокие уровни P. copri , способствует развитию Th27-зависимого артрита и моноколонизации мышей SKG с помощью P. copri . достаточно, чтобы вызвать артрит. Таким образом, хотя необходимы более точные исследования, чтобы определить, какая бактерия является мишенью для лечения РА, настоятельно рекомендуется наличие кишечных патогенов, которые связаны с патогенезом РА у человека.

Заболеваемость ВЗК во всем мире растет [57]. Также в Японии число пациентов с ВЗК быстро увеличилось за последние 30 лет, что позволяет предположить, что помимо генетической предрасположенности, в развитии ВЗК в большей степени участвуют факторы окружающей среды, такие как дисбактериоз [58]. Сообщалось о различных изменениях кишечной микробиоты у пациентов с ВЗК [59–61]. Появление секвенирования следующего поколения выявило ряд измененной микробиоты в кишечнике. Однако общая проблема заключается в том, что неясно, является ли дисбактериоз, наблюдаемый у пациентов с ВЗК, причиной или следствием воспаления кишечника.Учитывая сложные взаимоотношения между иммунной системой кишечника и микробиотой кишечника, необходимы дальнейшие исследования для выяснения патогенеза ВЗК и разработки более эффективных методов лечения.

PRIME – BOOST TYPE MUCOSAL VACCINE

Обычные инъекционные вакцины, включая подкожные вакцины, обладают способностью индуцировать антигенспецифические IgG, поддерживать антигенспецифическую иммунную память и способствовать предотвращению тяжелой инфекции [62–64]. Детская вакцинация — ключевой фактор защиты от многих опасных для жизни инфекций [64].Однако, несмотря на прогресс в технологии вакцин, во всем мире многие инфекции остаются не полностью контролируемыми как у людей, так и у животных.

Иммунные ответы слизистой оболочки считаются эффективными для предотвращения инфекции, поскольку чужеродные антигены, такие как микроорганизмы и пищевые антигены, проникают в организм хозяина через поверхности слизистой оболочки [65–69]. В участках слизистой оболочки секреторный IgA (SIgA) играет важную роль в регулировании здоровья кишечника и профилактике заболеваний [70–78]. Основными функциями IgA являются (1) предотвращение прилипания, колонизации и инвазии патогенных микроорганизмов, которые проникают на поверхность слизистой оболочки; (2) нейтрализующее действие на токсины и ферменты, вырабатываемые патогенными микроорганизмами; (3) захват патогенных микроорганизмов в слое слизи; и (4) антимикробная активность.На сегодняшний день доступно лишь ограниченное количество вакцин для слизистых оболочек; поэтому для индукции полезных системных иммунных ответов настоятельно необходима новая стратегия вакцинации слизистых оболочек.

IgA — антитела, наиболее часто встречающиеся в секреторных компонентах слизистой оболочки. В слизистой оболочке кишечника существует два типа механизмов продукции IgA, представленных Т-клеточно-зависимыми и Т-клеточно-независимыми иммунными ответами [79–82]. В кишечнике Т-клеточно-зависимые ответы антител участвуют в активации В-клеток антигеном в организованной лимфоидной ткани пейеровских бляшек, брыжеечных лимфатических узлов и изолированных лимфоидных фолликулов [82-84].Было показано, что как CD40L, так и трансформирующий фактор роста-β1 важны для индукции Т-клеточно-зависимого переключения классов IgA [85]. Напротив, независимая от Т-клеток рекомбинация переключения класса IgA происходит в клетках B1 кишечной лимфоидной ткани (GALT), где IgA конститутивно индуцируется стимуляцией комменсальными бактериями [82].

GALT, такой как пятна Пейера и изолированные лимфоидные фолликулы, является первичным сайтом индукции IgA [86,87]. Сообщалось, что антиген-специфические IgA-продуцирующие В-клетки развиваются в GALT с помощью GALT-дендритных клеток (DC).Примечательно, что ретиноевая кислота, синтезируемая GALT-DC, может вносить вклад в синтез IgA [87–89]. GALT-DC также способны отпечатывать хемокиновые рецепторы кишечника, такие как интегрин α4β7 и хемокиновый рецептор C-C типа 9, на B- и T-клетках, что является важным процессом миграции лимфоцитов в кишечник [90].

DCs собственной пластинки кишечника (LPDC) также являются важными индукторами SIgA-продуцирующих B-клеток независимым от T-клеток образом. Ранее мы сообщали о двух подгруппах LPDC тонкого кишечника на основе их дифференциальных паттернов экспрессии CD11c и CD11b: CD11c hi CD11b lo LPDC и CD11c hi CD11b hi LPDC [91-93] (Рисунок 1).CD11c hi CD11b hi кишечные LPDC экспрессируют ген, кодирующий фермент, превращающий ретиноевую кислоту, Raldh3 , и способны индуцировать антиген-специфический SIgA, а также системный иммунитет, опосредованный Toll-подобным рецептором (TLR) 5 или 9 стимуляции [91] (рис. 1). В отличие от LPDC CD11c hi CD11b hi , CD11c hi CD11b lo LPDC экспрессируют TLR3, TLR7 и TLR9, которые распознают олигодезоксинуклеотиды (ODN) dsRNA, ssRNA и CpG соответственно [93] (Рисунок 1). .Они не экспрессируют Raldh3 и не участвуют в синтезе IgA в собственной пластинке тонкого кишечника [93]. Кроме того, высокие титры антигенспецифического IgA были обнаружены в экстрактах фекалий мышей, иммунизированных LPDC, нагруженных антигеном CD11c hi CD11b hi [93]. Соответственно, CD11c hi CD11b hi LPDC считаются идеальной мишенью для вакцины для слизистых оболочек, но до сих пор было технически сложно вызвать антиген-специфический иммунитет слизистой оболочки с использованием обычных инъекционных вакцин.

Рис. 1. Функция двух отдельных дендритных клеток собственной пластинки тонкой кишки. Дендритные клетки собственной пластинки тонкой кишки мыши (LPDC) делятся на две подгруппы на основе экспрессии CD11c и CD11b. CD11c hi CD11b lo LPDC экспрессируют Toll-подобный рецептор (TLR) 3, TLR7 и TLR9, тогда как CD11c hi CD11b hi LPDC экспрессируют TLR5 и TLR9.После стимуляции TLR активированные CD11c hi CD11b hi LPDC могут продуцировать интерлейкин (IL) -12p40, IL-6, трансформирующий фактор роста β и ретиноевую кислоту, а затем индуцировать антигенспецифические ответы Th2 и Th27 и антигенспецифические -IgA-продуцирующие плазматические клетки. В отличие от LPDC CD11c hi CD11b hi , активированные LPDC CD11c hi CD11b lo могут индуцировать антиген-специфические ответы Th2, но не антигенспецифические ответы Th27 и антиген-специфические IgA-продуцирующие плазматические клетки.TLR: Toll-подобный рецептор; TGF: трансформирующий фактор роста; IL: интерлейкин; DC: дендритная клетка.

Недавно мы сообщили, что селезеночные ДК, стимулированные курдланом, лигандом дектина-1, и CpG-ODN, лигандом TLR9, успешно индуцировали антиген-специфические фекальные IgA, а также антигенспецифические сывороточные IgG и ответы Th2 и Th27 в селезенке у мышей [ 94]. Это указывает на то, что комбинация курдлана и CpG-ODN доступна в качестве адъюванта парентеральной вакцинации для индукции широкого функционального иммунитета против антигенов слизистой оболочки.Мы обнаружили, что внутримышечная иммунизация комбинацией курдлана и CpG-ODN, эмульгированного с неполным адъювантом Фрейнда, индуцировала антиген-специфические фекальные IgA, а также сывороточные IgG и ответы Th2 и Th27 селезенки [94] (рис. 2). Однако, хотя антиген-специфический IgG в сыворотке постоянно обнаруживался после первичной инъекции, продукция антиген-специфического IgA в кале была обнаружена только временно при парентеральной иммунизации курдланом + CpG-ODN [94]. Следовательно, считается, что необходима дополнительная иммунизация, например, бустерная, для индукции более стойкого иммунитета слизистой оболочки на целевых участках слизистой оболочки.Мы продемонстрировали, что после перорального, назального или вагинального введения антигена индуцируются высокие титры длительного антиген-специфического кишечного, легкого или вагинального IgA [94] (рис. 2). Кроме того, эта прайм-буст-вакцина эффективна против диареи, вызванной холерным токсином, и инфекции, вызванной Streptococcus pneumoniae ( S. pneumoniae ) [94]. Таким образом, мы создали внутримышечную инъекцию антигена с адъювантом курдлан + CpG-ODN и последующее введение антигена на участки слизистой оболочки (первичная вакцинация) в качестве новой стратегии вакцины, способной вызывать сильный и устойчивый системный и слизистый иммунитет.

Рисунок 2 Схема антиген-специфических иммунных ответов при первичной буст-вакцинации. Парентеральная иммунизация антигеном, эмульгированным в курдлане и CpG-олигодезоксинуклеотидах, индуцирует антиген-специфические фекальные IgA, а также сывороточные IgG и ответы Th2 и Th27 в селезенке. После праймирования высокие титры длительного антиген-специфического легочного, кишечного или вагинального IgA индуцируются после назального, перорального или вагинального введения антигена соответственно.Кроме того, в органах-мишенях индуцируются антиген-специфические ответы Th2 и Th27. CpG-ODN: олигодезоксинуклеотиды CpG.

БУДУЩЕЕ РЕГУЛИРОВАНИЕ ЗАБОЛЕВАНИЙ, СВЯЗАННЫХ С ДИСБИОЗОМ

Дисфункция кишечника коррелировала с многофакторными заболеваниями [9], предполагая, что иммунные реакции слизистой оболочки обеспечивают прочную причинную связь между патологическими симптомами в организме хозяина и ассоциированным с заболеванием дисбиозом. Несколько исследований идентифицировали некоторых патобионтов, таких как Clostridium ramosum ( C.ramosum ) [95], P. copri [26,28], Helicobacter pylori [96], адгезивный инвазивный вирус Escherichia coli [97], Clostridium scindens [98] и Enterococcus gallinarum Enterococcus gallinarum 99]. Следовательно, регулирование функции патобионтов, связанных с заболеванием, может привести к профилактике или лечению нарушений, связанных с дисбактериозом. Однако антибиотики не подходят для уничтожения только патогенов, поскольку они могут вызывать дисбактериоз или бактерии с множественной лекарственной устойчивостью [100].

C. ramosum — облигатная анаэробная бактерия, впервые обнаруженная у пациента с аппендицитом в 1898 году и широко населяющая желудочно-кишечный тракт человека. Повышенные уровни C. ramosum связаны с ожирением и диабетом у человека [20,23]. C. ramosum также связан с клиническими симптомами метаболических нарушений у мышей-гнотобиотов, колонизированных только C. ramosum и упрощенным кишечным микробиомом человека, содержащим C.ramosum . Кроме того, было показано, что количество C. ramosum выше у мышей, получавших диету с высоким содержанием жиров, по сравнению с диетой с нормальным содержанием жиров, и это приводит к повышенной экспрессии Slc2a2 в слизистой оболочке тонкой кишки [95] . Поэтому недавно мы применили нашу первичную вакцинацию для борьбы с болезнями, опосредованными C. ramosum . Наша вакцина против C. ramosum значительно подавляла прибавку массы тела и повышала уровни C. ramosum в слизистой оболочке кишечника при диете с высоким содержанием жиров [94].Это также привело к снижению экспрессии Slc2a2 и, следовательно, к уменьшению непереносимости глюкозы [94]. Примечательно, что эта стратегия иммунизации не вызвала дисбактериоза [94]. Таким образом, он может быть эффективным для предотвращения ожирения и диабета, связанных с C. ramosum .

До сих пор существовало несколько методов, которые могут индуцировать высокие титры антиген-специфического IgA на участках слизистой оболочки-мишени с использованием слизистой вакцины инъекционного типа. Примечательно, что мы разработали первичную вакцину для слизистых оболочек нового поколения с использованием курдлана и CpG-ODN и использовали ее для борьбы с такими заболеваниями, как S.pneumoniae и другие заболевания, опосредованные кишечными бактериями [94]. С появлением гнотобиотических технологий функция кишечного микробиома была раскрыта. Однако, поскольку существует несколько методов специфического ослабления функции кишечных бактерий, многие заболевания, опосредованные кишечными бактериями, до сих пор полностью не выяснены. Наша вакцинация — это первая в мире стратегия иммунизации, которая может стать отличным методом функционального анализа кишечных бактерий.

ЗАКЛЮЧЕНИЕ

По мере того, как становится очевидной связь между различными заболеваниями и аберрантной кишечной микробиотой, возникает острая необходимость в разработке и распространении стратегий борьбы с дисбактериозом в дополнение к существующим эффективным методам лечения. Антибиотики неспецифичны для патобионтов и могут вызывать дисбактериоз, который может привести к заболеванию. Также были предприняты попытки контролировать заболевания, опосредованные кишечными бактериями, с помощью FMT или пробиотических препаратов, но это уже признанные и эффективные методы лечения.Важным лечением заболеваний, опосредованных кишечными бактериями, является улучшение основного заболевания, не вызывая нового дисбактериоза. Вакцинация курдланом + CpG-ODN и антигенами и последующее введение антигена могут эффективно индуцировать антигенспецифический системный иммунитет и иммунитет слизистых оболочек. Этот метод первичной буст-вакцины был запатентован в Японии, и в настоящее время разрабатываются первичные буст-вакцины против различных инфекционных заболеваний, которые будут отпускаться по рецепту человека. Нет сомнений в том, что технология вакцины, обсуждаемая в этом обзоре, станет новым методом лечения в следующем поколении противомикробных стратегий.Необходим дальнейший анализ микробиоты кишечника, но мы с нетерпением ждем возможности разработки специфичных для патобионтов методов лечения заболеваний человека в будущем.

БЛАГОДАРНОСТИ

Мы благодарим К. Огава, М. Маэда и К. Суэцугу за секретарскую помощь.

Источник рукописи: Приглашенная рукопись

Тип специальности: Гастроэнтерология и гепатология

Страна / территория происхождения: Япония

Научная классификация качества отчета экспертной оценки

Оценка A (отлично): 0

Оценка B (очень хорошо): 0

Оценка C (хорошо): C

Оценка D (удовлетворительная): 0

Оценка E (плохая): 0

P-рецензент: Abushady EAE S-редактор: Wang JL L-редактор: E-Editor : Ma YJ

.
Leave a Reply

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2021 © Все права защищены.