Уреаплазмоз симптомы и лечение у женщин: Уреаплазма: симптомы, лечение и профилактика. Часто-задаваемые вопросы женщин и мужчин, мифы и реальность

Содержание

Уреаплазма: симптомы, диагностика и лечение у мужчин и женщин

Автор статьи: КМН, врач уролог-андролог, специалист УЗДСерёженков А. В. Стаж работы: 13 лет

Опубликовано: 05-08-2020

Обновлено: 07-10-2020

До 60-х годов прошлого века болезнями, о которых было стыдно говорить, считались сифилис и гонорея. После сексуальной революции оказалось, что таких неприличных инфекций гораздо больше. Эти инфекции назвали скрытыми, так как они имеют мало проявлений и трудно выявляются. Уреаплазма одна из таких инфекций.

Цены на услуги

Первичный приём уролога ДЛЯ МУЖЧИН + УЗИ предстательной железы (оценка жалоб, сбор анамнеза, при необходимости ректальное пальцевое исследование, узи предстательной железы у мужчин)

Первичный прием – обращение к врачу конкретной специальности в первый раз. Включает беседу с пациентом, первичный осмотр, сбор анамнеза, при необходимости ректальное пальцевое исследование, узи предстательной железы. Цена действительна с 01.02.2022

Записаться на прием

Первичный приём зав. отделением урологии Рыльчиковым И.В. + УЗИ (включает беседу с пациентом, первичный осмотр, сбор анамнеза, при необходимости ректальное пальцевое исследование, узи предстательной железы)

Первичный прием – обращение к врачу конкретной специальности в первый раз.

Записаться на прием

Что такое уреаплазмоз?

Уреаплазмоз — заболевание, вызываемое уреаплазмой (Ureaplasma urealyticum), микроорганизмом по размерам похожим на крупные вирусы и не имеющим ни ДНК, ни клеточной оболочки.

Зачастую уреаплазмоз ходит парой с микоплазмозом. Оба эти возбудителя относятся к внутриклеточным микробам и передаются половым путём. Также часто к этой парочке присоединяются другие неприятные возбудители, например, гонорея, трихомониаз или хламидиоз. Эти малютки совсем не безобидны, они подтачивают организм незаметно, но трудолюбиво и упорно.

Симптомы заболевания

Уреаплазмоз протекает бессимптомно. Лишь в периоды обострения возможны слабые прозрачного цвета выделения, возможно жжение и дискомфортные ощущения при мочеиспускании. 

Хроническая форма и осложнения уреаплазмоза

Что плохого может случиться, если не лечить какой-то там уреаплазмоз, от которого ничего не болит, не чешется? Увы, он может стать причиной ряда неприятностей. Хронический уреаплазмоз приводит к воспалительным заболеваниям органов малого таза, к образованию камней мочевого пузыря и почек, к образованию спаек, которое в одних случаях может привести к внематочной беременности, в других — к бесплодию.

В отсутствие лечения у мужчин уреаплазмоз может вызывать простатит. Беременные женщины с уреаплазмозом, переносят беременность с осложнениями, у них нередко бывают преждевременные роды.

Скрытые инфекции

В настоящее время трудно найти человека, у которого не было бы тех или иных скрытых инфекций. Причём, чем раньше и активнее начал человек свою сексуальную жизнь, тем гарантированней он станет носителем заразы. Существует даже классификация возрастных групп риска: с 14 до 19 лет (начало половой жизни) и 20-29 лет (расцвет сексуальной активности, поиск спутника жизни).

Отдельно хочется отметить геометрическую прогрессию, с которой скрытые и другие половые инфекции распространяются по миру: каждый заражённый «дарит» партнёру не только свою болячку, но и все те болезни, которые насобирал от предыдущих, а те — от ещё более ранних связей. И так далее. Конечно, так происходит только в случае отказа от барьерной контрацепции — презерватива.

Особенно остро эта проблема стоит среди подростков и молодых людей, которые по последним статистическим данным, становятся распространителями всё большего числа болезней во всё более юном возрасте.

Ещё один путь распространения уреаплазмоза, когда ребёнок получает его от инфицированной матери во время родов, проходя через родовые пути.

Записаться на прием

Диагностика

Как проходит диагностика инфекции? По результатам общего мазка (как у мужчин, так и у женщин) можно лишь предположить наличие уреаплазм. Но в норме уреаплазмы живут в каждом женском организме (у мужчин их не должно быть). Разница лишь в их количестве. У больных уреаплазмозом людей колоний уреаплазмы огромное количество. Поэтому для выявления возбудителя используют более точные методы исследования — метод полимеразной цепной реакции (ПЦР) и бактериальный посев.

Лечение

Лечение уреаплазмоза назначает только врач, с учётом особенностей биологии возбудителя, его устойчивости к антибиотикам и возможных сопутствующих болезней. В курс лечения входит антибактериальная терапия, физиотерапия, инстилляции. Помимо этого, на время лечения нужно скорректировать образ жизни — отказаться от интимных отношений, соблюдать диету и воздерживаться от алкоголя.

Профилактика

Лучшего метода профилактики упеаплазмоза, чем презерватив никто ещё не придумал. А для поддержания собственного спокойствия можно посоветовать только регулярные профилактические лабораторные обследования.

Важно поставить в известность о своём заболевании прошлых и настоящих партнеров, такой подход говорит об ответственном отношении не только к себе, но и к другим.

Другие статьи автора

Врачи

Все врачи

Лечение уреоплазмоза у женщин и мужчин

Уреаплазмоз – это заболевание, которое вызывается микроорганизмом – уреаплазмой, и проявляется в заражении мочеполовой системы, как у мужчин, так и у женщин. Как правило, это заболевание передаётся половым путем при контакте с инфицированным человеком.

ЛЕЧЕНИЕ УРЕАПЛАЗМОЗА ДОСТУПНО В ФИЛИАЛАХ:

Лечение уреапламоза в Приморском районе

Адрес: г. Санкт-Петербург, Приморский район, ул. Репищева, 13

Лечение уреапламоза в Петроградском районе

Адрес: г. Санкт-Петербург, Петроградский район, ул. Ленина, 5

Лечение уреапламоза во Всеволожске

Адрес: г. Всеволожск, Октябрьский пр-т, 96 А

Уреаплазмы — это организмы, размером с крупные вирусы, обладающие способностью размножаться за пределами клетки — «хозяина» и расщеплять мочевину. От бактерий их отличает тот факт, что у них нет клеточной стенки (также как у хламидий и микоплазмы) и ДНК, поэтому они вынуждены существовать в других организмах. В отличие от вирусов, уреаплазмы чувствительны к некоторым видам антибиотикам.

В основном они заселяют клетки эпителия слизистых половых органов и мочевыделительных путей.

В норме, в теле человека сосуществует ряд микроорганизмов, который составляет так называемую микрофлору организма, выполняющую, в том числе, и защитную функцию. Однако, при ослаблении иммунной системы, физиологическая защита нарушается, и, попавшая в организм уреаплазма, начинает активно размножаться, проникать в клетки, разрушая клеточную мембрану и, тем самым, вызывать воспалительные процессы.

Симптомы уреаплазмоза

Очень часто заболевание проходит бессимптомно (носительство инфекции). Кроме того, уреаплазма иногда обнаруживается у здоровых людей.

Однако, как было сказано выше, ослабление иммунитета ведёт к развитию заболевания — уреаплазмоза. Симптомы уреаплазмоза сходны с теми, которые обычно возникают при инфекции мочеиспускательного канала (при уретрите):

  • проблемы, связанные с мочеиспусканием
  • боль и жжение в области мочеиспускательного канала
  • частое мочеиспускание
  • ощущение «давления на мочевой пузырь»

Для мужчин характерны следующие симптомы уреаплазмоза:

  • выделения из мочеиспускательного канала
  • усиление жжения и боли в области полового члена во время полового акта или мочеиспускания
  • тянущие боли внизу живота и в промежности
  • болевые ощущения в мошонке

Симптомы уреаплазмоза у женщин обычно такого характера:

  • жжение и боли во время мочеиспускания
  • боли внизу живота
  • могут быть кровянистые выделения из влагалища после половых контактов

Как осложнение, у мужчин может развиваться воспаление предстательной железы (простатит) и уретрит, в то время как у женщин — воспаление яичников, маточных труб или матки. Отсутствие лечения инфекции у женщин может спровоцировать выкидыш.

Врачами отмечается связь между уреаплазмозом и бесплодием, женским и мужским (при заражении уреаплазмой, сперма мужчин характеризуется меньшей подвижностью и большим количеством сперматозоидов с неправильной формой — нарушение сперматогенеза). Уреаплазмоз при беременности может отразиться на преждевременных родах, задержке развития плода и низком весе ребёнка в неонатальном периоде (после рождения).

Существует большая вероятность заражения уреаплазмой новорожденного при родах. При этом инфекция вызывает хронические заболевания лёгких (особенно у недоношенных) – из 80 % новорожденных с кашлем у 1/3 случаев в горле малышей обнаруживается уреаплазма. При лечении уреаплазмоза выраженность симптомов заболевания дыхательной системы ослабевала. В каждом из этих случаев у матерей также обнаруживалась скрытая нелеченая инфекция мочеиспускательного канала.

Диагностика уреаплазмы

Регулярное посещение врача позволит своевременно выявить заболевание. Стандартная диагностика уреаплазмы включает в себя ряд обязательных процедур:

  • первичный осмотр
  • методика ПЦР (полимеразная цепная реакция — выявление типа бактерии по его наследственной информации)
  • серологический анализ (выявление в крови антител, которые образуются при попадании в организм чужеродных элементов)
  • бактериальный посев пробы биологического материала

Лечение уреаплазмы

Как уже говорилось выше, в отличие от вирусов, уреаплазмы можно лечить при помощи антибактериальной терапии. Ввиду того, что уреаплазма не имеет клеточной стенки, а большинство антибиотиков воздействует именно на эту часть клетки, не все антибиотики эффективны при лечении данного заболевания. Принцип лечения уреаплазмоза у мужчин и женщинодинаков. Применяются такие антибиотики, как тетрациклин или эритромицин, действие которых не направлено на разрушение клеточной стенки бактерий.

Самостоятельное лечение запрещено! Антибиотики тетрациклинового ряда противопоказаны при беременности!!!

К счастью, уреаплазмоз полностью излечим. Поэтому, при наличии каких-либо симптомов, указывающих на возможную инфекцию, необходимо немедленно обратиться к врачу.

Терапия антибиотиками должна сопровождаться витамино- и иммунотерапией для укрепления защитных систем организма. Кроме того, после прохождения курса антибиотиков, рекомендуется провести пробиотический курс «хороших» бактерий, для восстановления микрофлоры организма.

Получить квалифицированную консультацию гинеколога в нашей клинике «Династия» Вы можете, записавшись по телефону или форму обратной связи внизу страницы.

Прием ведут врачи:

Выберите филиал“Династия” на Новочеркасском пр-те, Красногвардейский район“Династия” на Ленина, Петроградский район“Династия” на Репищева, Приморский район“Династия” во ВсеволожскеВыездная служба

Стоимость лечения уреоплазмоза:

Наименование услуг  Цена в рублях
Санкт-Петербург Всеволожск
Первичный прием акушера-гинеколога 1 ступени 1850 1500
Повторный прием акушера-гинеколога 1 ступени 1650 1300
Первичный прием акушера-гинеколога 2 ступени 2100
Повторный прием акушера-гинеколога 2 ступени 1900
МАНИПУЛЯЦИИ
Введение акушерского пессария 1500 1500
Введение внутриматочной спирали (ВМС) 2500 2500
Введение внутриматочной спирали «Мирена» 4000 4000
Введение имплантируемого контрацепива «ИМПЛАНОН» (без стоимости контрацептива) 2500 2100
Видеокольпоскопия 1700 1700
Забор мазков (гинекологический) 400 400
Инструментальное удаление внутриматочной спирали (ВМС) 2500 2100
Интравагинальное введение свечей (без стоимости медикаментов), 1 процедура 500 500
Лечебная обработка влагалища 700 700
Медикаментозное прерывание беременности 8000
Местная обработка наружных половых органов 700 700
Удаление акушерского пессария 1000 1000
Удаление внутриматочной спирали (ВМС) 1500 1500
Удаление внутриматочной спирали «Мирена» 3000 3000
Удаление имплантируемого контрацепива «ИМПЛАНОН» 2500 2300
Удаление инородного тела из влагалища 1800 1800
Штрих-биопсия эндометрия (пайпель-диагностика) 1500 1200
PRP-терапия 3500
УЛЬТРАЗВУКОВАЯ И ФУНКЦИОНАЛЬНАЯ ДИАГНОСТИКА
УЗИ органов малого таза (одним датчиком) 1600 1300
УЗИ органов малого таза (двумя датчиками) 1900 1500
КТГ (кардиотокография плода) 1800
КТГ (многоплодная беременность) 2300
Фолликулометрия (1 исследование) 1400 1400
Фолликулометрия (4 исследования) 3900 3900
ЛАЗЕРНАЯ ХИРУРГИЯ
Биопсия шейки матки + гистология 5000 4000
Единичная киста шейки матки 1500 1500
Единичные папилломы и кондиломы стенок влагалища 3000 3000
Распространенный кондиломатоз, папилломатоз от 6000 от 6000
Удаление единичных кондилом, папиллом вульвы, шейки матки (за 1 ед. ) 600 600
Эктопия (эрозия) шейки матки (менее 2 см) 6000 4000
Эктопия (эрозия) шейки матки (более 2 см) 9000 9000
Эндометриоз шейки матки (единичный очаг) 1000 1000
РАДИОХИРУРГИЯ
Биопсия шейки матки радионожом 2500 2000
Лечение лейкоплакии и крауроза вульвы с помощью радиохирургического ножа 5300 5100
Лечение патологии шейки матки с помощью радиохирургического ножа до 1 см 5000 3700
Лечение патологии шейки матки с помощью радиохирургического ножа до 2 см 6500 6000
Удаление полипов шейки матки с помощью радиохирургического ножа 4000 2500
Фульгурация кист, эндометриоидных очагов с помощью радиохирургического ножа 3500 2200
Электрокоагуляция кондилом на коже в области промежности радионожом (за 1 ед. ) 800 800
Электрокоагуляция кондилом, папиллом вульвы радионожом 1400 1400
Электрокоагуляция кондилом, папиллом влагалища радионожом от 3200 от 3200
ОПЕРАЦИИ
Интимная контурная пластика 26000
Хирургическая дефлорация 8000 8000

ЗАПИСЬ НА ЛЕЧЕНИЕ УРЕАПЛАЗМОЗА

Ваша заявка отправлена

Менеджер свяжется с вами для уточнения деталей

Мы ценим ваше обращение в наш медицинский центр «Династия»

Уреаплазмоз, симптомы и лечение уреаплазмоза в клинике ИнТайм

Методы лечения уреаплазмоза

Уреаплазмоз – распространенное заболевание, которое передается половым путем, встречается и у мужчин, и у женщин. Последствия уреаплазмоза у мужчин – воспаления предстательной железы, уретры, бесплодие. У женщин уреаплазмоз приводит к воспалениям матки, придатков, к спайкам и, как следствие, к бесплодию. Для беременных существует опасность патологий плода.

Центр лечения бесплодия «ИнТайм» имеет большой опыт в лечении многих заболеваний, передающихся половым путем. Используя комплексный подход и комбинируя новейшие методики, врачи Центра, среди которых академики, профессора, врачи высшей категории, добиваются успеха в 98% случаях.

Отправьте заявку
на бесплатную консультацию

Мы осуществляем первую бесплатную консультацию для новых пациентов. Просто оставьте свои контактные данные, и мы свяжемся с вами в течение рабочего дня.

Если вы уже были нашим клиентом, вы можете воспользоваться этой формой для заказа обратного звонка.

Спасибо!

Ваша заявка принята.
Мы свяжемся с вами в течение рабочего дня.

Три причины лечения уреаплазмоза в клинике «ИнТайм».

Уникальные возможности диагностики

Клиника планирования семьи «ИнТайм оснащена современным оборудованием: УЗИ, проводятся аппаратами GE Logiq C5 и Mindray DC-3 с функцией 3D. Наличие дополнительных датчиков дает возможность диагностировать органы с высокой точностью. Анализ на уреаплазмоз исследуют в уникальной лаборатории, принадлежащей клинике. Лаборатория имеет современный инструментарий и расходные материалы на уровне мировых стандартов.

Персонал высочайшего уровня

Клиника планирования семьи «ИнТайм» по праву гордится своими врачами-специалистами, имеющими высокую квалификацию по своим направлениям и прошедшими стажировку в зарубежных клиниках. Академики, профессора, работающие в Центре, регулярно принимают участие в научных конгрессах и мастер-классах, как в России, так и за рубежом.

Комфортные условия

Квалифицированный медицинский персонал создает пациентам комфортную и удобную обстановку, гарантирует полную анонимность лечения. Внедрена предварительная запись, поэтому сдать анализы на уреаплазмоз можно без очередей. Клиника «Интайм» находится в центре Москвы рядом с метро «Фрунзенская», что делает ее доступной для посещений. На автомобиле к клинике удобно подъехать по Комсомольскому проспекту.

Диагностика и лечение уреаплазмоза

Симптомы уреаплазмоза у женщин – зуд или жжение слизистых оболочек, выделения из влагалища, боль внизу живота, болезненное частое мочеиспускание. У мужчин похожие симптомы: неприятные ощущения или боль при мочеиспускании, незначительные мутные выделения, резь и жжение в уретре. Пациенты должны сдать анализы на уреаплазмоз по методу ПЦР и, если уреаплазмы обнаружены, проводится дальнейшая диагностика. Самым точным на сегодняшний день является культуральный метод или бактериологический посев. Кроме главного результата анализа – количества уреаплазмы, можно определить ее чувствительность к разным антибиотикам, что упрощает их назначение.

Как вылечить уреаплазмоз в конкретном случае определяет врач, опираясь на полученные анализы. Основное лечение уреаплазмоза – прием антибиотиков в виде таблеток, иъекций, свечей. Дополнительно врач назначает физиотерапию, для мужчин – массаж простаты. По окончанию курса следует восстановить нормальную микрофлору половых путей и микрофлору кишечника. Очень важно укрепить иммунитет. Чтобы не было повторных заражений, следует лечиться обоим половым партнерам и впоследствии соблюдать правила половой гигиены.

Не запускайте уреаплазмоз – вовремя обращайтесь в Центр «ИнТайм»!

Эта болезнь самостоятельно не лечится! Можно убить часть вирусов, а остальные приобретут устойчивость к антибиотикам. При подозрении на признаки уреаплазмоза сразу обращайтесь в клинику, не рискуйте своим здоровьем, звоните прямо сейчас!

Уреаплазмоз у женщин и мужчин: симптомы, лечение, причины

Автор: врач, научный директор АО «Видаль Рус», Жучкова Т. В., [email protected]

Оглавление:

Что такое уреаплазмоз?

Уреаплазмоз — это заболевание, возбудителем которого является одноклеточный микроорганизм — уреаплазма. Данный возбудитель относится к внутриклеточным микробам. Уреаплазмоз является заболеванием, склонным к хроническому течению. Кроме того, возбудитель данного заболевания является условно-патогенным микроорганизмом, поскольку для некоторых женщин он представляет нормальную флору влагалища. Под уреаплазмозом подразумевают наличие воспалительного процесса в мочеполовой системе, при котором, в ходе лабораторных исследований, выявляется уреаплазма и не обнаружен другой возбудитель.

Причины возникновения уреаплазмоза

Чаще всего заражение уреаплазмозом происходит половым путем при контакте с больным, либо носителем возбудителя заболевания.

Во время беременности существует вероятность передачи заболевания от матери к плоду через околоплодные воды. Во время родов также существует вероятность заражения ребенка, при прохождении им родовых путей: микробы могут попадать в половые пути ребёнка и сохраняться там всю жизнь, находясь в неактивном состоянии.

Причиной появление уреаплазмоза могут быть различные факторы:

  • ранее начало половой жизни, частая смена половых партнеров,
  • незащищенные половые акты,
  • возрастная группа до 30 лет,
  • перенесенные гинекологические заболевания и заболевания, передающиеся половым путем.

Рост условно-патогенной флоры, к которой относится и возбудитель уреаплазмоза, может быть спровоцирован приемом антибиотиков, препаратов гормональной терапии, постоянными стрессами и общим ухудшением качества жизни человека, радиоактивным облучением и другими факторами, которые значительно снижают иммунный статус человеческого организма.

Проявления уреаплазмоза

Уреаплазмоз проявляется не сразу, не беспокоя человека долгое время. Из-за этого носитель заболевания может даже и не знать о нем и продолжает заражать половых партнеров длительный период. Инкубационный период уреаплазмоза составляет 2-4 недели. Отсутствие симптомов заболевания в некоторых случаях может привести к переходу уреаплазмоза в хроническую стадию и довольно серьезным последствиям для здоровья человека.

Нередко у детей, зараженных во время родов, со временем происходит самоизлечение от уреаплазм. Особенно часто это происходит у мальчиков.

Как уже говорилось, основным проявлением уреаплазмоза являются воспалительные процессы мочеполовой системы. Симптомами уреаплазмоза у мужчин могут быть скудные, мутные выделения из мочеиспускательного канала, вялотекущий уретрит (ощущения жжения и зуда в области мочеиспускательного канала, умеренной болезненности самого процесса мочеиспускания), при котором выделения то появляются, то исчезают. У женщин появляются выделения из влагалища, которые могут сопровождаться болью внизу живота, зуд и раздражение слизистой влагалища, реже наблюдается частое и болезненное мочеиспускание, цервицит. Отсутствие своевременного и адекватного лечения, попытки самолечения могут привести к переходу заболевания в хроническую форму, ухудшая общее состояние организма, сопровождаясь повышением температуры тела, а также стать причиной появления простатита, кольпита, эндометрита, цистита, пиелонефрита, везикулита, воспаления придатков матки, образования спаек в маточных трубах, приводит к самопроизвольным абортам и преждевременным родам.

Хроническая инфекция может со временем вызвать стриктуру уретры (сужение мочеиспускательного канала).

Одним из самых серьезных последствий уреаплазмоза считается астеноспермия — один из видов мужского бесплодия. Возбудитель уреаплазмоза влияет на снижение подвижности сперматозоидов, паразитируя на них и снижая их жизнеспособность. Кроме заболеваний мочеполовой системы, уреаплазма также оказывает влияние и на здоровье суставов, вызывая их воспаление.

Без лечения уреаплазмоз может время от времени проявляться. Повторные обострения могут быть связаны с употреблением алкоголя в большом количестве, простудой, эмоциональными перегрузками.

Что может сделать Ваш врач?

Лечение уреаплазмоза – это в первую очередь устранение тех самых условий, которые дали возможность уреаплазме беспрепятственно размножаться. Это коррекция иммунитета, устранение всех состояний, которые снижают иммунную защиту, и, наконец, мощное воздействие на самого возбудителя.

Проведение бактериального посева позволяет определить чувствительность патогенного организма к использованию того или иного антибактериального препарата. Это помогает врачу выбрать оптимальную схему лечения, что позволит исключить проявление рецидивов заболевания.
Кроме препаратов антибактериальной терапии целесообразно применение иммуностимуляторов, местных бактерицидных средств, проведение физиопроцедур. Важным требованием является проведение лечения у обоих партнеров, что позволит избежать случаев повторного заражения. На время лечения рекомендуется воздерживаться от половой жизни, соблюдать предписанную диету, а также строго следовать всем рекомендациям лечащего врача.

Что можете сделать Вы?

Очень важно сообщить своим половым партнерам о заболевании, даже если их ничего не беспокоит, и убедить их пройти обследование и лечение.

Учитывая, что уреаплазмы могут быть причиной самопроизвольного аборта и преждевременных родов, перед планируемой беременностью целесообразно избавиться от уреаплазм.

Уреаплазмоз, микоплазмоз. Причины заражения, симптомы, лечение уреаплазмоза и микоплазмоза.

Уреаплазмоз и микоплазмоз – распространенные как у мужчин, так и у женщин инфекции, передающиеся половым путем.

Уреа- и микоплазмы относятся к патогенным микроорганизмам, которые в случае большой концентрации (свыше 10*4 КОЕ) вызывают воспалительный процесс. Так, уреаплазмоз, микоплазмоз могут вызвать воспалительные заболевания матки и придатков, бесплодие самопроизвольные аборты и преждевременные роды у женщин, уретрит, простатит у мужчин, цистит у обоих партнеров.

Уреаплазмоз у женщин и мужчин нередко сочетается с такими заболеваниями, как кандидоз, микоплазмоз, хламидиоз и трихомониаз. Трихомонады, например, могут транспортировать возбудителей уреаплазм, поэтому развивается сочетанная инфекция, которая протекает тяжелее. Например, уреаплазмоз гарднереллез, хламидиоз уреаплазмоз и другие. При сочетанной инфекции уреаплазмы способны негативно повлиять на сперматогенез, снизив подвижность сперматозоидов, что в дальнейшем может привести к мужскому бесплодию.

1

Диагностика уреаплазмоза и микоплазмоза в МедикСити

2

Диагностика уреаплазмоза и микоплазмоза в МедикСити

3

Диагностика уреаплазмоза и микоплазмоза в МедикСити

Сегодня огромное число пар обращается к специалистам с проблемой бесплодия. В 55% случаев при качественной диагностике в организме обоих партнеров выявляются возбудители микоплазмоза и уреаплазмоза.

Впервые микоплазму удалось выявить в 90-х годах 19 века из организма коров, больных пневмонией. Через 30 лет этот вирус нашли у больных быков, а еще через 10 лет микоплазма обнаружилась в организме у людей (у мужчин в уретре, у женщин – в области церквикального канала).

А затем было доказано, что микоплазмоз и уреаплазмоз – венерические заболевания, грозящие серьезными последствиями.

Сейчас ученым удалось выявить более 70 видов микоплазм и 3 вида уреаплазм. Воспаление в мочеполовом тракте могут вызвать: микоплазма хоминис, микоплазма гениталиум и уреаплазма уреалитикум.

Микоплазмоз

Микоплазма – одноклеточный микроорганизм, занимающий промежуточное положение между грибами, вирусами и бактериями. У клеточной мембраны микоплазмы нет жесткой клеточной оболочки, вместо нее имеется очень тонкая пленка – плазмалемма. При помощи этой пленки микроорганизм приклеивается к клеткам хозяина и начинает паразитировать за его счет. Размер микоплазмы от 0,2 до 0,8 мкм, поэтому его не чувствуют защитные барьеры организма. Попав на слизистые оболочки, микоплазма начинает вызывать воспаление в клетках и усиливает развитие аутоимунных процессов.

Симптомы микоплазмоза

Урогенитальный микоплазмоз (вызванный Mycoplasma genitalium), может быть обнаружен как у мужчин, так и у женщин. В целом при микоплазмозе симптомы схожи с признаками воспалительных заболеваний мочеполовой системы (вагинит, эндометрит, цистит, уретрит, пиелонефрит и др.). Больные жалуются на зуд и жжение в половых органах, учащенное мочеиспускание. У мужчин после отхода мочи наблюдается жжение и боль в уретре, так как поражаются близлежащие к уретре ткани. У женщин после полового контакта возникает сильная боль внизу живота. Симптомы появляются примерно через 10 дней после заражения микоплазмой гениталиум.

Однако нередки случая бессимптомного протекания микоплазмоза.

Лечение микоплазмоза

Лечение этого заболевания – достаточно трудный процесс, требующих комплексных мер. Наибольшее действие оказывает лечение антибактериальными препаратами. Хорошей эффект дает использование экстракорпоральной антибактериальной терапии (плазмафереза).

Назначаются противогрибковые и противопротозойные препараты, физиотерапевтическое лечение и промывание мочевоиспускательного канала лекарственными средствами. Курс лечения -10 дней, затем проводится бакпосев.

1

Лечение микоплазмоза в МедикСити

2

Плазмаферез при лечении микоплазмоза

3

Плазмаферез при лечении микоплазмоза

Уреаплазмоз

Уреаплазма — условно-патогенный микроорганизм, который для многих женщин представляет нормальную влагалищную флору. Когда содержание уреаплазм превышает допустимые нормы и вызывает воспаление в мочеполовых путях, речь идет о заболевании, получившем название урогенитальный уреаплазмоз.

Мужчины уреаплазмозом страдают реже. Инкубационный период уреаплазмоза длится от 15 до 45 дней. Если у инфицированного отсутствует воспалительный процесс, то лечение не назначается. Эта особенность уреаплазмоза и микоплазмоза отличает их от таких заболеваний, как хламидиоз и трихомониаз, которые нуждаются в безотлагательном лечении.

Как и другие заболевания ИППП, уреаплазмоз может иметь острую и хроническую форму. Острая форма уреаплазмоза проявляется гораздо четче, и лечить ее намного легче. Несвоевременное лечение приводит к хроническому уреаплазмозу, который гораздо тяжелее поддается лечению.

Основные причины уреаплазмоза – любые виды половых контактов с зараженным человеком, а также передача инфекции ребенку от матери при беременности и родах. Возможно заражение при трансплантации органов и тканей.

Симптомы уреаплазмоза

Инфекция уреаплазмоза длительно протекает бессимптомно.

Основные признаки уреаплазмоза у мужчин:
  • незначительный зуд в уретре, который усиливается при мочеиспускании;
  • небольшие мутноватые выделения, которые появляются при вовлечении дальних отделов уретры;
  • когда инфекция уреаплазмоза захватывает ткани предстательной железы, появляются признаки простатита — тянущие боли в промежности, возможные нарушения эрекции, снижение либидо;
  • покраснение и жжение в области головки, которое усиливается при согревании;
  • при инфицировании мочевого пузыря появляются признаки цистита (частое мочеиспускание в первую очередь).
Признаки уреаплазмоза у женщин:
  • рези при мочеиспускании;
  • прозрачные, а в случае перехода инфекции на канал шейки матки, желтоватые выделения;
  • эрозии шейки матки;
  • при распространении инфекции уреаплазмоза на тело матки и придатки проявляются тянущие боли, усиливающиеся при месячных, и густые желтые выделения.

Признаки уреаплазмоза у женщин проявляются на 50-60 день после инфицирования и диагностируются лишь у 12% женщин. Большинство женщин длительно являются бессимптомными носительницами уреаплазмоза. При этом у 50% женщин с бесплодием выявляется уреаплазмоз и микоплазмоз.

Уреаплазмоз у беременных может привести к невынашиванию или замершей беременности, а также рождению ребенка с множественными тяжелыми пороками развития. Но при своевременной адекватной терапии уреаплазмоз при беременности может не иметь таких трагических последствий.

Диагностика уреаплазмоза

В диагностике мико- и уреаплазмоза ключевыми являются лабораторные методы. Анализ на уреаплазмоз включает в себя использование метода ПЦР и бакпосев.

Метод ПЦР (полимеразной цепной реакции) позволяет определить возбудителя, но не дает информации о его количестве. Для количественной оценки используется культуральный метод, т.е. посев на питательные среды. Диагностическое значение имеет концентрация микробов более 10*4 КОЕ в одном мл. Более низкие концентрации не учитываются, поскольку в таких количествах те же микоплазмы и уреаплазмы могут присутствовать в организме здоровых людей.

Лечение уреаплазмоза

Схема лечения уреаплазмоза направлена на приведение в норму содержания условно-патогенных организмов в микрофлоре человека, уничтожение факторов, провоцирующих болезнь, и восстановление защитных сил организма.

Терапия при уреаплазмозе носит комплексный характер. Назначаются антибактериальные, антимикробные препараты, иммуномодуляторы, пробиотики, гепатопротекторы. Большое значение имеет местное лечение уреаплазмоза: вагинальные таблетки или свечи (антибактериальные и противовоспалительные) для женщин, физиотерапия для мужчин и женщин.

Лечение уреаплазмоза в обязательном порядке должно проводиться сексуальному партнеру инфицированного, иначе заражение произойдет повторно. Половые контакты исключаются на весь период лечения микоплазмоза и уреаплазмоза. После лечения необходимо провести контрольное обследование.

В нашей клинике вы сможете пройти все необходимые исследования, сдать анализы, пройти курс лечения как уреаплазмоза, так и других половых инфекций. Опытные врачи-урологи и врачи-гинекологи помогут вам избавиться от любых заболеваний мочеполовой системы и проблем репродуктивного здоровья. Будьте здоровы с клиникой «МедикСити»!

Анализ на уреаплазму в СПб, лечение уреоплазмы у женщин и мужчин

Лечение уреаплазмоза нужно производить сразу же после диагностики заболевания. Болезнь, которую вызывает специфический микроорганизм – уреаплазма, имеет сложный характер течения, поэтому при неправильной или несвоевременной терапии патология может стать устойчивой к препаратам.

Стоимость анализов

Исследования на уреаплазму методом ПЦР 210

Смотреть все цены

Запись к врачу

В клиниках «Даная» врачи осуществляют диагностику инфекции у женщин и мужчин. Вы можете обратиться в наш центр при подозрении на наличие болезни: специалисты проведут обследование и составят правильную схему терапии.

Симптомы болезни

О наличии заболевания люди зачастую не догадываются. Потому оно и называется скрытым, так как клиническая картина часто неясна: никаких жалоб у пациентов нет либо они незначительные, и об истинных причинах нарушений в мочеполовой сфере свидетельствуют только специальные анализы.

У женщин признаки хронической или первичной патологии могут не проявляться долгое время. Течение болезни периодически сопровождается выделениями из влагалища, редко – жжением во время мочеиспускания, частыми позывами, если развивается воспаление матки и придатков – «тянущими» болями внизу живота.

У мужчин могут быть следующие симптомы уреаплазмоза, которые требуют незамедлительного лечения:

  • симптомы уретрита;
  • простатит;
  • выделения из уретры;
  • жжение при мочеиспускании;
  • нарушения эрекции и эякуляции.

Хламидиоз, уреаплазмоз, микоплазмоз и ряд других ЗППП схожи по проявлениям, поэтому пытаться самостоятельно диагностировать у себя заболевание и выбирать способы избавления от него – не только напрасное, но и опасное занятие!

При хронической стадии симптомы могут отсутствовать на протяжении нескольких лет. Болезнь иногда заявляет о себе более или менее выраженными обострениями. О хроническом уреаплазмозе свидетельствуют почечные инфекции, воспаления женских половых органов, брюшной полости и суставов.

Диагностика уреаплазмоза

Выявление хронической либо острой стадии врачом невозможно только на основании проявлений заболевания, поскольку эти признаки свидетельствуют как минимум о нескольких инфекциях. Поэтому диагностика болезни обязательно включает в себя исследования методами ПЦР-анализа.

При подтверждении заболевания у одного из партнеров второй также обязательно проходит полное обследование.

В центре «Даная» возможно осуществить все виды исследований, которые позволят диагностировать патологию. Например, возможно сделать мазок на наличие уреаплазмы у женщин. Стоит отметить, что цена анализа в нашей клинике отличается доступностью.

Лечить или не лечить?

Выделяют два подвида возбудителя болезни – Ureaplasma parvum и Ureaplasma urealyticum. Организм инфицируется половым путем, также часто происходит заражение ребенка от матери во внутриутробном и родовом периодах. Все врачи дают положительный ответ на вопрос о том, нужно ли лечить уреаплазмоз, особенно хронический. Они относят уреаплазму к опасным возбудителям: болезнь поражает мочеполовую систему, иногда провоцирует воспаления суставов.

Патология у беременной опасна тем, что во время родов возможно заражение ребенка при движении по родовым путям. Инфекция может вызвать и выкидыш на ранних сроках. Поэтому обязательно необходимо провести диагностику и лечение инфекции заранее, ведь в ходе беременности терапия может негативно сказаться на развитии плода – и это еще один довод для положительного решения, нужно ли лечить патологию.

Стоит отметить, что стоимость диагностики и лечения уреаплазмоза в клинике «Даная» в Санкт-Петербурге весьма невысокая, поэтому каждый пациент сможет пройти процедуры в нашем центре.

Лечение уреаплазмоза

В первую очередь, нужно подчеркнуть, что нельзя пытаться лечиться самостоятельно, выискивая рецепты в интернете или спрашивая их у знакомого: уреаплазма является промежуточной формой между бактериями и вирусами, поэтому при неправильной терапии может «затаиться» на несколько лет.

Лечение инфекции у мужчин и женщин – это комплекс мероприятий, которые определяются локализацией воспалительного процесса. Врач назначает прием антибактериальных препаратов, уничтожающих инфекцию, и иммуномодуляторов, активизирующих защиту самого организма. Половые партнеры нуждаются в одновременном курсе, иначе не избежать повторного инфицирования.

Уреаплазмоз беременных вдвойне сложнее в терапии. Врачу необходимы огромный опыт и знание новейших методик, чтобы принять решение о вмешательстве или невмешательстве в течение болезни, а при беременности она, увы, имеет свойство обостряться.

Если вы решили пройти терапию заболевания платно, то вы всегда можете обратиться в нашу клинику. Цена на лечение уреаплазмоза зависит от того, какие анализы и другие диагностические меры будут назначены.

Специалисты центров «Даная» обладают многолетним опытом в успешном лечении уреаплазмоза, хламидиоза, папилломавирусной инфекции и еще множества других заболеваний. Мы поможем защитить вашу репродуктивную систему от этих опасных и часто незаметных врагов. Также врачи клиники дадут ценные рекомендации для профилактики заболевания.

Задайте ваш вопрос

Прием ведут:

Уреаплазмоз у женщин | Централ Клиник

Уреаплазмы относятся к условно-патогенным микроорганизмам. Могут находиться в организме здоровой женщины и никаким образом не проявлять себя долгое время.

Иногда, при большом количестве, уреаплазмы могут приводить к неспецифическим воспалительным процессам в мочеполовой системе. Чаще, это проблемы с почками, уретрит или цистит которыми страдают в основном мужчины, возможно воспалительные органов малого таза и у женщин. В последних Российских Рекомендациях Общества Дерматовенерологов и Косметологов сказано, что«…уреаплазмы надо лечить, если они обнаруживаются в концентрации 104КОЕ/мл и выше при наличии признаков воспаления на слизистой…»

Причины появления:

Уреаплазмоз передается половым путем, во время родов от матери к ребенку. В бытовых условиях заражения маловероятно.

Симптомы:

  • слизистые выделения из влагалищных путей;
  • боль во время половых актов;
  • дискомфорт, зуд и жжение во время мочеиспускания;
  • дискомфорт или боль внизу живота.

Диагностика и лечение:

Если нет дискомфорта, то специально сдавать анализы на уреаплазму нет необходимости. В случае, когда появились симптомы — определить одного из возбудителей можно с помощью ПЦР диагностики, посетив врача и сдав мазок на анализ.

Симптомы многих инфекций похожи друг на друга, но выявить истинного возбудителя может только ваш лечащий врач. Часто, при снижении иммунитета, происходит присоединение других инфекций к уже имеющимся и не доставляющим дискомфорта, вследствие чего начинается воспалительный процесс. Только высококвалифицированному специалисту под силу разобраться в причинах заболевания и назначить адекватный комплекс лечения.

Помните, при лечении заболеваний необходимо параллельное лечение вашего полового партнера во избежание повторного заражения. Весь комплекс лечебно-диагностических мероприятий вы можете получить у специалистов Централ Клиник в удобное для вас время.

Микоплазма и уреаплазма – большая загадка

Не только у вас, дамы, но и у медицинских работников существует много путаницы в отношении этих маленьких насекомых. Итак, мы решили разобрать его для вас. Вот совок того, что на самом деле микоплазма и уреаплазма….

Что такое микоплазма и уреаплазма?

Термин «микоплазма» широко используется для обозначения любого организма в классе Mollicutes, который состоит из восьми родов (включая Mycoplasma , Ureaplasma , Acholeplasma , Anaeroplasma и Asterolo9).

К микоплазмам относятся:

  • Mycoplasma hominis
  • Mycoplasma genitalium
  • Mycoplasma fermentans (штамм incognitus)
  • M.pneumoniae
К уреаплазмам относятся:

  • Уреаплазма парвум
  • Уреаплазма уреалитикум

Что это? Это бактерии или вирусы?

Микоплазма и уреаплазма — мельчайшие свободноживущие организмы.У них отсутствует клеточная стенка, поэтому ни микоплазма, ни уреаплазма не могут быть визуализированы при обычной микроскопии с окрашиванием по Граму. Их присутствие трудно диагностировать из-за сложности их выращивания или культивирования в лаборатории. Для культивирования этих организмов требуются специализированные среды и очень строгие условия.

Живут ли микоплазмы и уреаплазмы в нормальных половых путях?

Да, многие здоровые бессимптомные взрослые имеют мочеполовую колонизацию Mycoplasma и Ureaplasma spp. Процент женщин с вагинальной колонизацией M. hominis , M. genitalium и Ureaplasma spp увеличивается после полового созревания пропорционально количеству половых партнеров в течение жизни. Было замечено, что он варьируется от 0% у никогда не активных женщин до 70% у сексуально активных женщин

.

Означает ли это, что эти женщины инфицированы и заразны?

Это не означает, что эти женщины «заражены», если они не вызывают никаких симптомов, то эти микоплазмы и уреаплазмы считаются нормальными обитателями половых путей.

Чем M. genitalum отличается от других микоплазм и уреаплазм?

M. genitalium была впервые описана в 1981 г. после выделения из уретральных образцов двух мужчин с диагнозом негонококковый уретрит (НГУ). Исследования показали сильную причинно-следственную связь между инфекцией M. genitalium и уретритом у мужчин и связь с цервицитом и воспалительным заболеванием органов малого таза (ВЗОМТ) у женщин.

Когда Mycoplasma и Ureaplasma spp могут вызывать инфекции?

Mycoplasma  и Ureaplasma  spp обычно остаются прикрепленными к эпителиальным клеткам слизистой оболочки (выстилке) дыхательных или мочеполовых путей.Однако они могут распространяться на другие участки и вызывать инфекцию при разрыве слизистой оболочки и/или скрытом дефекте защитных сил хозяина, например, у развивающегося плода, недоношенного ребенка или взрослых с ослабленным иммунитетом.

M. genitalum в дополнение к вышеперечисленному ускользает от иммунной системы и изменяет иммунную систему хозяина, что позволяет ему выживать в организме хозяина.

Насколько распространен M. Genitalum?

Согласно исследованиям, проведенным в Соединенных Штатах, M. genitalium присутствует примерно у 1 процента молодых людей в общей популяции.Для сравнения, распространенность гонореи составляет 0,4%, а хламидиоза — 2,3%. Среди ИППП-клиник и среди населения с множественными факторами риска ИППП распространенность может колебаться от 4 до 38 процентов.

Каковы факторы риска этих инфекций?

Некоторыми факторами риска являются молодой возраст (например, от 20 до 22 лет), курение, недавний половой акт и увеличение числа сексуальных партнеров.

При каких состояниях могут возникать микоплазменные и уреаплазменные инфекции?

Инфекции, которые были связаны с различными типами микоплазмы и уреаплазмы , включают:

М.гоминис

  • Воспалительные заболевания органов малого таза (ВЗОМТ) – не доказано
  • Хориоамнионит
  • Послеродовая и послеабортная лихорадка
  • Пиелонефрит
  • Инфекции центральной нервной системы
  • Септицемия
  • Раневые инфекции, особенно послеоперационные раны
  • Инфекции суставов
  • Инфекции верхних и нижних дыхательных путей
  • Эндокардит
  • Неонатальная бактериемия и менингит
  • Абсцессы новорожденных

Уреаплазма  spp

  • Хориоамнионит
  • Послеродовая и послеабортная лихорадка
  • Врожденная пневмония
  • Неонатальная бактериемия
  • Абсцессы новорожденных
  • Негонококковый уретрит у мужчин – не доказано
  • УТИ

 

М Половые органы.

  • Негонококковый уретрит (мужчины)
  • Цервицит
  • ПИД-код
  • ИМП у мужчин и женщин
  • Преждевременные роды и аборты – не доказано

Является ли M. genitalum ЗППП и передается половым путем?

Половой путь передачи M. genitalium подтверждается как клиническими, так и молекулярно-эпидемиологическими данными. Как указано выше, M. genitalium чаще выявляется среди

сексуально опытных

Кроме того, в исследованиях ДНК-типирования половые партнеры часто являются носителями идентичных бактериальных геномных штаммов.

Могут ли другие инфекции сосуществовать с Mycoplasma Genitalum?

Chlamydia trachomatis является наиболее распространенным коинфицирующим микроорганизмом.

Как проявляется M. genitalum у мужчин?

На долю инфекции M. genitalium приходится от 15 до 20 процентов случаев НГУ, регистрируемых ежегодно среди мужчин в Соединенных Штатах. M. genitalium чаще обнаруживается у мужчин с персистирующим или рецидивирующим уретритом.Это также может быть связано с баланитом (воспаление головки полового члена) и поститом (воспаление крайней плоти).

Как M.genitalum влияет на женщин?

M. genitalium может подниматься из нижних отделов половых путей в верхние после передачи половым путем

Цервицит

Воспаление шейки матки является наиболее частым проявлением инфекции M. genitalium у женщин и обычно описывается как слизисто-гнойный цервицит (MPC).

Воспалительные заболевания органов малого таза

В нескольких исследованиях наблюдалась связь между обнаружением микроорганизма и клиническими признаками и симптомами ВЗОМТ.

Клиническая картина M. genitalium -ассоциированного воспалительного заболевания органов малого таза (ВЗОМТ) может включать тазовую боль от легкой до сильной, боль в животе, аномальные выделения из влагалища и/или кровотечение, сходное с ВЗОМТ, вызванным C. trachomatis .

Какой образец наиболее точен для мужчин и женщин?

У мужчин диагностическая эффективность образцов первой порции мочи при обнаружении M.genitalium  выше, чем в образцах мазка из уретры

У женщин вагинальные образцы являются более диагностическими. В одном исследовании с участием 400 женщин относительная чувствительность ПЦР для M. genitalium составила 86 процентов для вагинальных мазков по сравнению с 61 процентом для первой порции мочи.

Когда делать тест на M. Genitalum?

  Если у сексуально активного человека имеются признаки уретрита, цервицита или воспалительного заболевания органов малого таза, рекомендуется провести тест на M.genitalium также в дополнение к другим ИППП. Если у женщин или мужчин симптомы этих состояний сохраняются, несмотря на завершение соответствующей терапии, независимо от первоначальной причины, также рекомендуется тестирование на M. genitalium  .

Как диагностируются микоплазменные и уреаплазменные инфекции?

Они диагностируются путем тестирования вагинальных мазков или образцов мочи. Для женщин вагинальные мазки более точны.

Существуют тесты на основе культур или РНК для обнаружения этих организмов, называемые тестами на основе МАНК.

Методы на основе культуры трудно реализовать по причинам, описанным выше. Большинство больничных микробиологических лабораторий не готовы их культивировать.

Анализы на основе РНК или ПЦР становятся все более доступными в мультиплексных наборах для диагностики патогенов дыхательных и мочеполовых путей. Единственным недостатком является то, что мы не можем проверить чувствительность к лекарствам с помощью тестов на основе РНК.

Анализ ДНК-чипа позволяет идентифицировать 13 целевых патогенов мочевыводящих путей, включая M.hominis и U. urealyticum, с относительно высокой чувствительностью и специфичностью по сравнению с ПЦР-тестами. В настоящее время он не используется в коммерческих целях в США.

Какие препараты эффективны при лечении Mycoplasma spp. и Ureaplasma spp.?

Большинство микоплазм и уреаплазм in vitro чувствительны к макролидам (например, азитромицину), тетрациклинам (например, доксициклину) и фторхинолонам (например, ципрофлоксацину). Азитромицин активен в отношении Mycoplasma genitalum (считается ЗППП).Исключением является M. hominis , который , а не чувствительный к макролидам.

Какой антибиотик лучше всего подходит для каких видов?

М. GENITALUM

Азитромицин – является препаратом первой линии. Он в 100 раз более активен в отношении этого микроорганизма, чем тетрациклины или большинство фторхинолонов. Однако сопротивление увеличивается. В некоторых регионах расчетная частота резистентности к азитромицину у изолированных M.genitalium  доходит до 40 процентов. Рекомендуемая лечебная доза составляет 1 г азитромицина перорально.

Неудачная или рецидивирующая инфекция M. genitalum

Моксифлоксацин – Если азитромицин оказался неэффективным и есть подтвержденная персистенция или рецидив, следующим выбором будет моксифлоксацин. Также появляется все больше доказательств устойчивости к фторхинолонам.

МИКОПЛАЗМА ЧЕЛОВЕЧЕСКАЯ

Доксициклин – рекомендуется небеременным взрослым с заболеванием, вызванным M.гоминис

Клиндамицин : рекомендуется для младенцев с заболеванием, вызванным M. hominis ,

Было обнаружено, что фторхинолоны

эффективны, однако наблюдается усиление развития резистентности микоплазм.

UREAPLASMA SPP.

Доксициклин – рекомендуется небеременным взрослым с заболеванием, вызванным Ureaplasma spp.

Кларитромицин, азитромицин и офлоксацин (фторхинолоны) также эффективны в отношении уреаплазмы.

Клиндамицин не активен в отношении уреаплазмы

Азитромицин или кларитромицин: рекомендуется для младенцев с заболеванием, вызванным Ureaplasma spp. ,

.

Какие симптомы могут указывать на клиническое заболевание, требующее лечения у женщин?

  • Рецидивирующие вагинальные инфекции, не реагирующие или резистентные к обычному лечению БВ.
  • Рецидивирующие инфекции после полового акта.
  • Стойкое жжение во влагалище, зловонные выделения с отрицательными посевами на обычных возбудителей — Candida и Gardnella и т. д. с отрицательными результатами на гонорею/хламидии и трихомонады.

Пожалуйста, помните, что это предполагаемые ассоциации и связи. Нам все еще нужны надежные испытания и более масштабные исследования, чтобы доказать, что эти организмы являются основными возбудителями вагинальных инфекций.

Нужно ли партнеру лечиться от инфекции M. genitalum?

Несмотря на отсутствие рекомендаций по направлению и лечению партнеров, разумно проводить скрининг всех половых партнеров лабораторно подтвержденных случаев M. genitalium и лечить в случае положительного результата.Если скрининг половых партнеров индексных пациентов с подтвержденным M. genitalium  невозможен, целесообразно эмпирически лечить M. genitalium  с учетом данных о передаче этого микроорганизма половым путем.

Сколько времени требуется M. genitalum, чтобы вырасти и заразить человека?

Хотя инкубационный период этого возбудителя остается неустановленным, скрининг должен быть направлен на половых партнеров в течение последних 60 дней. Лечение партнеров пациентов с подтвержденным M.genitalium  такая же, как и у пациентов.

Когда следует лечить микоплазму или уреаплазму?

Если у пациентов есть клинические признаки и симптомы, вызванные Mycoplasma или Ureaplasma spp, их следует лечить. Напротив, пациенты, у которых эти микроорганизмы находятся в половых путях без каких-либо симптомов, не нуждаются в лечении.

Схема лечения микоплазмы и уреаплазмы

М.гоминис

Небеременные

Доксициклин: 100 мг перорально два раза в день в течение 7 дней

При аллергии

Моксифлоксацин: 400 мг перорально ежедневно x 10 дней

или

Беременная

*Клиндамицин: 600 мг перорально каждые 8 ​​часов x 7 дней

Уреаплазма

Доксициклин: 100 мг перорально 2 раза в сутки в течение 10 дней (14 дней при ВЗОМТ)

или

Азитромицин: 1 г внутрь однократно

*Клиндамицин не эффективен против уреаплазмы

 

М.гениталии

Азитромицин: 1 г внутрь однократно

При резистентной или рецидивирующей инфекции

Моксифлоксацин: 400 мг перорально ежедневно x 10-14 дней

Будьте уверены, мы здесь, чтобы помочь вам решить этот сложный вопрос в Walk IN GYN Care

Добрые пожелания

Доктор Адити Гупта

 

Уреаплазменная инфекция – обзор

Лечение генитальных микоплазм

Не имея клеточной стенки, микоплазмы естественным образом устойчивы к бета-лактамным антибиотикам (т. э., пенициллины, цефалоспорины, монобактамы и карбапенемы), полимиксины, сульфаниламиды и ванкомицин. 113,1209,1210,1214 Хотя они могут иметь умеренную чувствительность к аминогликозидам, МПК этих агентов для генитальных микоплазм обычно слишком высоки для терапевтического использования. Тетрациклины и макролиды были препаратами выбора, хотя из-за опасений по поводу токсичности тетрациклинов и относительной легкости приема короткого курса азитромицина предпочтение отдается последнему.Также считается, что азитромицин обладает дополнительным преимуществом при лечении как гонококковой, так и хламидийной инфекции половых органов, когда этиология еще не установлена ​​или может быть полимикробной. Однако устойчивость к антибиотикам растет, и некоторые Mycoplasma spp. теперь требуются альтернативные режимы. 240 Хинолоны, такие как моксифлоксацин и левофлоксацин, также обладают хорошей активностью против генитальных микоплазм и уреаплазм, 70,633,1126 , но уже появились резистентные варианты. По возможности следует проводить тестирование чувствительности к антибиотикам всех клинически значимых изолятов. Если место мутации известно, можно использовать анализ расплава с высоким разрешением 1160,1173 или генетическую амплификацию и секвенирование 544,1258 для быстрого выявления устойчивости к антибиотикам во время первоначальной диагностики и исключения риска лечения. отказ. Эти мутации также могут переноситься на плазмиды или мобильные генетические элементы, иногда придавая устойчивость к нескольким группам антибиотиков. 543,544,633,748,931,1050,1051,1124 Мутации в гене 23S рРНК генитальных микоплазм, как и в M. pneumonie , вызывают широко распространенную устойчивость к макролидам. Открытие того, что генитальные микоплазмы также могут образовывать биопленки, защищающие их от действия антибиотиков, еще больше усложняет терапию. 389

Уреаплазма spp. сохраняют чувствительность к макролидам, доксициклину, тетрациклину и хлорамфениколу. Развивается резистентность к ципрофлоксацину; однако оксифлоксацин и моксифлоксацин по-прежнему эффективны и лучше, чем левофлоксацин. 633 Исторически тетрациклин использовался для эмпирического лечения НГУ. 453,484 Однако из-за побочных эффектов эритромицин считался предпочтительной альтернативой для детей, и он также покрывал Chlamydia и Ureaplasma . Хотя эритромицин по-прежнему широко используется, он менее популярен из-за растущей резистентности 633 и побочных эффектов. Сообщалось о сердечной токсичности, заключающейся в остром сердечно-дыхательном ухудшении, возможно вторичном по отношению к сердечным аритмиям, у новорожденных, получавших внутривенное введение лактобионата эритромицина по поводу предполагаемой уреаплазменной пневмонии. 327 Ототоксичность наблюдалась у взрослых, но не у новорожденных. 246 Пероральный эритромицин также был связан с гипертрофическим стенозом привратника у младенцев в возрасте до 6 недель. 163 С тех пор доксициклин стал предпочтительным выбором при уреаплазменных инфекциях, а также эффективен против коинфекции M. hominis или гонореи.* Терапией первой линии при НГУ является доксициклин в дозе 100 мг два раза в день в течение 7 дней. В случае неэффективности лечения из-за резистентных штаммов рекомендуется 5-дневная терапия азитромицином. 494 Азитромицин и кларитромицин активны in vitro в отношении Ureaplasma spp., 584,991,1078,1208 , но их применение у новорожденных тщательно не оценивалось. При пероральном введении детям с очень низкой массой тела при рождении, колонизированными Ureaplasma spp., уровни кларитромицина в сыворотке в дозе 7,5 мг/кг каждые 12 часов были субтерапевтическими. 1004 По этой причине рекомендуется доза 15 мг/кг каждые 12 часов. Хотя точная продолжительность терапии неизвестна, 10–14-дневный курс кажется разумным, если в течение этого периода наблюдается клиническое улучшение и микробиологическая эрадикация.

Связаны ли Mycoplasma hominis, Ureaplasma urealyticum и Ureaplasma parvum со специфическими генитальными симптомами и клиническими признаками у небеременных женщин? | Клинические инфекционные болезни

Получить помощь с доступом

Институциональный доступ

Доступ к контенту с ограниченным доступом в Oxford Academic часто предоставляется посредством институциональных подписок и покупок. Если вы являетесь членом учреждения с активной учетной записью, вы можете получить доступ к контенту следующими способами:

Доступ на основе IP

Как правило, доступ предоставляется через институциональную сеть к диапазону IP-адресов.Эта аутентификация происходит автоматически, и невозможно выйти из учетной записи с проверкой подлинности IP.

Войдите через свое учреждение

Выберите этот вариант, чтобы получить удаленный доступ за пределами вашего учреждения.

Технология Shibboleth/Open Athens используется для обеспечения единого входа между веб-сайтом вашего учебного заведения и Oxford Academic.

  1. Щелкните Войти через свое учреждение.
  2. Выберите свое учреждение из предоставленного списка, после чего вы перейдете на веб-сайт вашего учреждения для входа.
  3. Находясь на сайте учреждения, используйте учетные данные, предоставленные вашим учреждением. Не используйте личную учетную запись Oxford Academic.
  4. После успешного входа вы вернетесь в Oxford Academic.

Если вашего учреждения нет в списке или вы не можете войти на веб-сайт своего учреждения, обратитесь к своему библиотекарю или администратору.

Вход с помощью читательского билета

Введите номер своего читательского билета, чтобы войти в систему. Если вы не можете войти в систему, обратитесь к своему библиотекарю.

Члены общества

Многие общества предлагают своим членам доступ к своим журналам с помощью единого входа между веб-сайтом общества и Oxford Academic. Из журнала Oxford Academic:

  1. Щелкните Войти через сайт сообщества.
  2. При посещении сайта общества используйте учетные данные, предоставленные этим обществом. Не используйте личную учетную запись Oxford Academic.
  3. После успешного входа вы вернетесь в Oxford Academic.

Если у вас нет учетной записи сообщества или вы забыли свое имя пользователя или пароль, обратитесь в свое общество.

Некоторые общества используют личные аккаунты Oxford Academic для своих членов.

Личный кабинет

Личную учетную запись можно использовать для получения оповещений по электронной почте, сохранения результатов поиска, покупки контента и активации подписок.

Некоторые общества используют личные учетные записи Oxford Academic для предоставления доступа своим членам.

Институциональная администрация

Для библиотекарей и администраторов ваша личная учетная запись также предоставляет доступ к управлению институциональной учетной записью.Здесь вы найдете параметры для просмотра и активации подписок, управления институциональными настройками и параметрами доступа, доступа к статистике использования и т. д.

Просмотр учетных записей, вошедших в систему

Вы можете одновременно войти в свою личную учетную запись и учетную запись своего учреждения. Щелкните значок учетной записи в левом верхнем углу, чтобы просмотреть учетные записи, в которые вы вошли, и получить доступ к функциям управления учетной записью.

Выполнен вход, но нет доступа к содержимому

Oxford Academic предлагает широкий ассортимент продукции.Подписка учреждения может не распространяться на контент, к которому вы пытаетесь получить доступ. Если вы считаете, что у вас должен быть доступ к этому контенту, обратитесь к своему библиотекарю.

. Целью данного исследования было определить распространенность биоваров Ureaplasma и Ureaplasma parvum ( U.parvum ) серовары, связанные с ними факторы риска и симптомы, связанные с половыми ИППП. Методы . ДНК, полученная из образцов шейки матки 1053 женщин, посещающих отделение акушерства и гинекологии и лабораторию патологической анатомии университетской больницы Хасана II в Фесе, Марокко, была использована для обнаружения биоваров Ureaplasma ( U. urealyticum и U. parvum ) и к подтипу U. parvum с помощью полимеразной цепной реакции (ПЦР). Результаты .Из 1053 обследованных женщин у 25,4% (268/1053) было положительных результатов на уреаплазму . Показатели U. urealyticum и U. parvum составили 12,1% (128/1053) и 7% (74/1053) соответственно, а совместное присутствие этих биоваров отмечено в 6,3% (66/1053) случаев. . В субтипе U. parvum выявлено преобладание серовара 3/14 (61,4%). Ассоциация демографических переменных с биоварами Ureaplasma была изучена и показала, что возраст («<30» лет), по-видимому, является фактором риска Ureaplasma spp.и U. urealyticum носитель (ОШ 1,729, 95% ДИ [1,113–2,687] и ОШ 1,848, 95% ДИ [1,026–3,330] соответственно). Не было различий в распространенности уреаплазмы типа в отношении симптомов. Однако была обнаружена значительная связь между сероваром 1 U. parvum и бесплодием (4). Заключение . Это первое исследование, проведенное в Марокко, дает представление о биоварах Ureaplasma и сероваров U. parvum , циркулирующих в этом регионе, связанных с ними факторах риска и симптомах, связанных с генитальными ИППП.Поэтому необходимы дальнейшие исследования для уточнения и подтверждения патогенной роли этих видов Ureaplasma .

1. Введение

Урогенитальный Уреаплазма относится к нормальной комменсальной флоре половых путей человека [1, 2]. Однако он может быть патогенным, если его бактериальная нагрузка составляет ≥10 4 организмов на мл (инфекционная доза). Этот показатель обычно принимается в качестве бремени, указывающего на инфекцию, которую необходимо лечить [2, 3]. Фактически он может быть связан со многими гинекологическими или акушерскими патологиями, такими как негонококковый уретрит, воспалительные заболевания органов малого таза, преждевременные роды или поздний аборт, бесплодие [4].

Человек Ureaplasma spp. включают два вида патогенов человека: Ureaplasma urealyticum ( U. urealyticum ) (биовар 2) и Ureaplasma parvum ( U. parvum ) (биовар 1). Специфическая идентификация каждого вида основана на молекулярных методах [5], и некоторые исследования показывают, что U. parvum встречается чаще, чем наиболее патогенный U. urealyticum [6]. Уровень колонизации у здоровых женщин составляет около 18-87% для U.parvum и около 6-10% для U. urealyticum [7].

На основании биохимических и генетических характеристик [5] U. parvum (биовар парво) разделен на четыре серовара (1, 3, 6 и 14), а U. urealyticum (биовар Т960Т) разделен на три подтипы. Подтип 1 включает серовары 2, 5, 8 и 9; подтип 2 включает серовары 4, 10, 12 и 13; и подтип 3 содержит серовары 7 и 11. Польское исследование показало, что инфекция верхних отделов мочеполового тракта U.parvum чаще встречается у женщин с бесплодием, чем у женщин фертильного возраста [2]. Несколько исследований предполагают, что патогенность Ureaplasma может зависеть от серотипа, а другие показали, что некоторые серотипы чаще связаны с синдромами, чем другие [8–10]. U. parvum серовара 3 наиболее часто выявляется у бесплодных женщин и мужчин, а некоторые исследования показали, что инфильтрация U. parvum сероваров 1, 3 и 6 вызывает морфологические изменения наружных половых органов у самок мышей, что может вызвать нарушения верхних отделов половых путей, что может привести к бесплодию [11].Однако U. parvum серовар 6 занимает второе место по распространенности (как у женщин, так и у мужчин) и ассоциируется с преждевременными родами [12–14]. Это ведущая причина смерти детей в возрасте до пяти лет в развивающихся странах [15].

В Марокко нет информации о распространенности биоваров Ureaplasma , распространении сероваров U. parvum и их связи с факторами риска и симптомами, связанными с инфекциями, передающимися половым путем (ИППП).

Настоящее исследование направлено на определение распространенности биоваров Ureaplasma и сероваров U. parvum , связанных с ними факторов риска и симптомов, связанных с половыми ИППП.

2. Материалы и методы
2.1. Пациенты и отбор проб

Проспективное исследование проводилось с 2013 по 2015 год среди женщин, посещающих отделение акушерства и гинекологии и лабораторию патологической анатомии Университетской больницы Хасана II в Фесе, Марокко, для определения распространенности бактериальных ИППП и характеристики видов. [16].Все собранные образцы шейки матки использовались для определения распространенности биоваров Ureaplasma и подтипа U. parvum . Доступны все демографические и клинические данные пациентов. Пациентки были разделены на две группы: бессимптомные женщины, пришедшие на гинекологическое обследование в связи с плановым осмотром, и симптомные женщины, у которых был хотя бы один из следующих симптомов: бели, тазовая боль/диспареуния, зуд, меноррагия, метроррагия или дизурия. .

2.2. Этика

Исследование было одобрено Институциональным наблюдательным советом Феса, Марокко (№ 02/15), и от всех женщин было получено письменное согласие.

2.3.
Ureaplasma Biovars Detection и U. parvum Subtyping

U. urealyticum и U. parvum были обнаружены в образцах шейки матки методом ПЦР с использованием праймеров UreaA-B (F и R) и UMS-57/UMA222 соответственно. , как описано ранее [5, 17]. Образцы, которые были положительными на U. parvum , были дополнительно типированы, и их серовары были определены с использованием ранее описанной ПЦР, направленной на ген mba (многополосный антиген) [5].Конкретные используемые пары праймеров, а также размер полученных продуктов описаны в таблице 1. Размер (BP) Ссылка


9074 9 Уреа-B Gaa ACG ACG TCC ATA AGC AAC T 423 [17] GCA АТЦ ТГК ТКГ ТГА АГТ АТТ АЦ У.Parvum UMS-57 (T / C) AA ATC TTA GTG TTC ATA TTT TTT AC 326/327 [5] [5] [5] UMA222 GTA AGT GCA GCA TTA AAT TCA ATG У. parvum серовара 1 UMS83 TACTGATAGAAATTATGTAAGATTGC 398 UMA269 CCAAATGACCTTTTGTAACTAGAT У. parvum серовар 6 UMS54 CTTAGTGTTCATATTTTTTACTAG 369 UMA269 CCAAATGACTTTTGTAACTAGAT U.parvum серовар 3/14 UMS125 GTATTTGCAATCTTTATATGTTTTCG 442 UMA269 CTAAATGACCTTTTTCAAGTGTAC
2.4. Статистический анализ

Статистический анализ был выполнен с использованием программного обеспечения SPSS (версия 20). Различные корреляции были сделаны с использованием критерия хи-квадрат или точного критерия Фишера. Многофакторный анализ был проведен с помощью бинарной логистической регрессии для определения факторов риска, включая все переменные исходной модели.Результаты выражали в виде отношения шансов (ОШ), 95% доверительных интервалов (ДИ) и значений. Во всех тестах значение <0,05 считалось значимым.

3. Результаты
3.1. Описание популяции исследования

Всего в это исследование было включено 1053 пациента. Набранные участники были в возрасте от 18 до 85 лет (средний возраст 42 года). Среди этих женщин 29% (302/1053) находятся в менопаузе и 19% (197/1053) беременны. Из 1053 женщин, включенных в исследование, у 39% (409/1053) были выявлены симптомы, связанные с половыми ИППП.Наиболее частыми симптомами были бели (32,3%; 132/409), тазовая боль/диспареуния (26,6%; 109/409), зуд (19,3%; 79/409), метроррагия (14%; 57/409), дизурия. 4,6%; 19/409) и меноррагия (3,2%; 13/409). Более того, более половины (61%) (644/1053) участников не имели симптомов, связанных с половыми ИППП. Социально-демографии и клинические характеристики исследования населения представлены в таблице 2.

. Распространенность и распространение Ureaplasma Biovars и U. parvum Serovars

Из 1053 обследованных женщин 25,4% (268/1053) были Ureaplasma положительными. Доля U. urealyticum и U. parvum составила 12,1% (128/1053) и 7% (74/1053) соответственно, и оба биовара присутствовали у 6.3% (66/1053) случаев. С учетом смешанной инфекции/колонизации распространенность U. urealyticum составила 18% (194/1053), а U. parvum — 13% (140/1053).

Типирование U. parvum показывает, что наиболее частым был серовар 3/14 (80/140, 57,1%), за ним следуют серовар 1 и серовар 6 (20%, 28/140 и 17,9%, 25 /140 соответственно). Это распределение было другим, если рассматривать только беременных женщин. Таким образом, серовар 3/14 по-прежнему является наиболее преобладающим (64.5%), за которым следуют серовары 6 (25,8%), а затем серовары 1 (9,7%) (рис. 1).


Наличие множественных сероваров отмечено в семи случаях 5% (7/140) с преобладанием двух сероваров в шести случаях 4,3% (6/140) [Два случая (серовар 1 и серовар 3/14), три случая (серовары 3/14 и серовары 6) и один случай (серовары 1 и серовары 6)] и один случай тройного серовара 0,7% (1/40). Эти серовары коинфекции/колонизации были обнаружены только у небеременных женщин.

3.3. Факторы риска, связанные с биоварами
Ureaplasma и сероваров U. parvum

U. urealyticum / U. parvum () и U. parvum серовары ().

Переменные, используемые для этого анализа, включают социально-демографические факторы, историю болезни и сексуальное поведение.Результаты этого анализа представлены в таблице 3.


%

площадь
 Сельская местность 212 20.5
Городские 823 79,5
Возраст (лет),
<30 167 16
30-50 624 59,5
> 50 > 50 256 24.5949 24.0749
731 707 70.8
302 29.2
Уровень образования,
Неграмотные 657 63,3
Грамотный 381 36,7
Количество беременностей,
≤4 724 69.8
> 4 3 3 313 30.2 30.2 30.2
Паритет,
≤4 832 80.2
> 4 206 19,8
Пассивное курение,
Нет 785 76,1
Да 246 23,9
оральную контрацепцию ,
Нет 722 76,1
Да 246 23,9
Возраст на 1 половой акт (лет),
≤20 656 63.6
> 20 375 36,4
Количество сексуальных партнеров в течение жизни,
1 974 94,7
≥1 54 5,3
статус Беременность
Нет 856 81
Да 197 19
Наличие половых STI-связанных симптомов
Нет 644 61
Да 40749 409 39 39 39
1006 95.5
 Да 47 4,5





96 (12.2) 96 (12.2) 99 (6.7) ≤4 0.536 ≤4 9044 57 (6.9) 94 (12.0) 94 (12.0) 1


Характеристики Число всего участников U. Umeyticum (положительный) () U. parvum положительный) () U. urealyticum / U. parvum (положительный) () Ureaplasma spp. (Положительный) ()
(%) (%)

площадь
площадь
212 26 (12.3) 14 (6.6) (6.6) 18 (8.5) 58 (27.4)
Urban 823 823 100 (12.2) 59 (7.2) 48 (5.8) 207 ( 25.2)
0,96 0,774 0,158 0,512
Возрастная группа (лет)
<30 167 27 (16.2) 11 (6,6) 16 (9.6) 54 (32.3)
30-50 624 624 76 (12.2) 47 (7.5) 35 (5.6) 158 (25.3)
> 50 254 24 (9.4) 16 (6,3) 15 (5,9) 55 (21.7)
0,119 0,782 0,165 0,048
менопауза
 № 731 97 (13.3) 49 (6.7) 49 (6.7) 195 (26.7) 95 (26.7)
302 29 (9.6) 22 (7.3) 17 (5.6) 68 ( 22.5)
0,101 0,737 0,521 0,163
уровень образования
Безграмотное 657 83 (12.6) 44 (6.7) 42 (6.4) 169 (25.7)
грамотный 381 43 (11.3) 29 (7.6) 24 (6.3) 24 (25.2)
0.522 0.579 0.953 0.851
Количество беременностей
724 94 (13,0) 45 (6.2) 50 (6.9) 189 26.1)
> 4 > 4 3 313 32 (10.2) 28 (8.9) 16 (5.1) 76 (24.3)
0.212 0,215 0.277 0.536
90
832 832 104 (12.549 56 (6.7) 217 (26.1)
> 4 206 22 (10.7) 16 (7,8) 10 (4,9) 48 (23.3)
0,474 0,645 0,323 0,413
пассивное курение
785 94 (12.0) 58 (7.4) 56 (7.1) 208 (26.5)
Да 246 31 (12.6) 15 (6.1) 10 (4.1) 56 (22,8)
0,793 0,491 0,086 0,242
оральную контрацепцию
Нет 722 89 (12,3) 52 (7.2) 52 (7.2) 48 (6.6) 189 (26.2)
Да 308 308 37 (12,0) 21 (6.8) 18 (5.8) 76 (24.7)
0.888 0.826 0,630 0,614
Возраст на 1 половой акт (лет)
≤20 656 84 (12,8) 47 (7.2) 36 (5.5) 167 (25.5)
> 20 > 20 375 42 (11.2) 42 (11.2) 26 (6.9) 30 (8,0) 98 (26.1)
0,449 0889 0.113 0.811
Количество пожизненных сексуальных партнеров
974 122 (12.5) 68 (7,0) 60 (6.2) 250 (25.7)
≥1 54 4 (7.4) 5 (9.3) 6 (11.1) 15 (27.8)
0.264 0.264 0,126 0 .730

значение, или точный критерий Фишера.

Соотношение Уреаплазма Biovars и U. Parvum Серовары к возрасту показывают, что UreaPlasma SPP., U. Umeyticum , и U. Parvum Серовар 3/14 имел пик распространенность среди женщин «<30» лет. Однако U. parvum серовара 6 максимально встречались у женщин «30-50 лет» и U.parvum серовара 1 чаще встречался в возрастной группе «> 50» (рис. 2). Таким образом, одномерный анализ показывает значительную связь между Ureaplasma и возрастом «<30» лет () (таблица 3).


Все переменные со значением ≤ 0,2 были использованы в многомерном анализе, и результаты представлены в Таблице 4. Возраст («<30» лет), по-видимому, является фактором риска Ureaplasma spp. и носитель U. urealyticum (ОШ 1,729, 95% ДИ [1.113–2,687] и ОШ 1,848, 95% ДИ [1,026–3,330] соответственно).



Переменные Коэффициент коэффициентов 95% CI Value


Уреаплазма SPP. Возраст (лет) <30 <30 1,729 1.113-2.687 0.015 0.015
30-50 1.227 0.865-1.739 0.251
> 50 1 —
У. urealyticum Возраст (лет) < 30 1,848 1.026-3.330 0,041
30-50 1,329 0.81949 0.81949 0.249
> 50 1

3.4. Корреляция между биоварами
Ureaplasma и сероваров U. parvum и симптомами, связанными с генитальными ИППП

Для изучения корреляции между симптомами, связанными с генитальными ИППП, и биоварами Ureaplasma был проведен статистический анализ. Для этого анализа Ureaplasma отрицательных случаев и коинфекция Ureaplasma spp. случаи с другими ИППП (вирус папилломы человека, Chlamydia trachomatis , Neisseria gonororhea , Mycoplasma genitalium и Mycoplasma hominis ) были исключены.Таким образом, было учтено только 87 случаев Ureaplasma (45 и 42 случая U. urealyticum и U. parvum соответственно). Результаты корреляций представлены в таблице 5. Таким образом, 36 женщин имели симптомы, связанные с ИППП, по сравнению с 51 бессимптомной женщиной, и 5 женщин были бесплодными по сравнению с 82 женщинами детородного возраста. U. urealyticum и U. parvum были одинаково распределены среди пациентов с симптомами и без симптомов. Однако более высокая частота U.parvum наблюдали у бесплодных женщин (табл. 5).

значение 91 857 (%) 39 (47.6)

Ureaplasma Биовары
У. urealyticum, У. parvum,

Генитальные симптомы ИППП
2) 0.869
№, 26 (51.0) 25 (49,0)
Да, 2 (40,0) 3 (60,0) 0.591
NO, 43 (524) 43 (524) 43 (52.4) 39 (47,6)

Значение или точный тест Fisher.

Для определения корреляции между наличием генитальных симптомов, связанных с ИППП, и U.parvum сероваров, случаи множественных сероваров () были исключены. Результаты представлены в Таблице 6. Результаты показывают значительную связь между U. parvum серовара 1 и бесплодием () (Таблица 6).

сероваров

+ U. parvum
серовара 1, серовара 3/14, серовара 6,
(%)

Генитальные симптомы, связанные с ИППП
 Да, 1 (5.9) 15 (88.2) 15 (88.2) 1 (5.9)
№, 5 (22.7) 15 (68.2) 2 (9.1)
0,154 0.154 0.146 0.713 0.713
Да,
2 (66,749 2 (66,7) 1 (33,3) 0 (0) 0 (0)
№, 4 (11.1) 29 80,6) 3 (8,3)
  значение 0.011 0,066 0,607

значение, или точный критерий Фишера.
4. Обсуждение

Ureaplasma spp. в основном находится на слизистых поверхностях урогенитального тракта у взрослых или в дыхательных путях младенцев [18]. Эти виды могут быть причиной негонококкового уретрита и осложнений беременности. Их заболеваемость выше у женщин по сравнению с мужчинами [19], а их колонизация была связана с возрастом, низким социально-экономическим уровнем, множественностью сексуальных партнеров, этнической принадлежностью и использованием оральных контрацептивов [20].

Насколько нам известно, это первое исследование, проведенное в Марокко с целью определения распространения, распространенности биоваров Ureaplasma и циркулирующих сероваров U. parvum , а также их связи с факторами риска и генитальными заболеваниями. Симптомы, связанные с ИППП.

Настоящее исследование показывает, что 25% женщин были носителями Ureaplasma spp. Этот показатель немного похож на показатель, полученный в итальянском исследовании (23%) [21], но ниже, чем показатель, полученный в хорватском исследовании (34%) [3] (таблица 7).Тем не менее, в итальянском исследовании полученная распространенность представляет собой только случаи уреаплазмы с положительным результатом посева с бактериальной нагрузкой ≥10 4 КОЕ (случаи инфекции). Это может объяснить низкую скорость, полученную по сравнению с нашими результатами, где обнаружение U. u realitum было сделано непосредственно с помощью ПЦР без количественного определения бактерий.

9 (22/158) 97: P Женщины 9.7 (29/197) 99 (74/191) 91 (137/169)


Исследование Учебная группа Проведение Распространенность% ()
Уреаплазма SPP. UU UU UU UU / UP SV до
SV 1 SV 3/14 SV 6 Множественные SV

Наши исследования, Марокко 1053: P и NP женщины 25.4 (268/1053) 12.1 (128/1053) 7 (74/1053) 6.3 (66/1053) 20 (28/140) 57.1 ( 80/140) 17,9 (25/140) 5 (7/140)
[21]; Италия 80749 80749 806: P и NP Женщины 23 (186/806) 14 (22/158) 86 (136/158) Нет 37 (50/136) 39 (53 / 136) 24 (33/136) Нет
[3]; Хорватия 1370: P и NP женщины 34.4 (471/1370) 7.4 (18/244 × ) 92,6 (226/244 × ) NO ND ND ND ND
Наше исследование, Morocco 856: NP Женщины 24.3 (208/856) 11.6 (99/856) 6.8 (58/856) 6 (51/856) 6 (51/856) 26.6 29/109 60.6 (66 /109) 15,6 (22/109) 6,4 (7/109)
[22]; Бразилия 302: сексуально активные женщины с инвалидностью 76.2 (230/302) (230/302) 16.6 (50/302) 60749 60.6 (183/302) 4.6 (14/302) 23.6 (37/156 «) 39.5 (62 / 156 ) 40,8 (64/156 ) 11,5 (18/156 )
Наше исследование; Марокко 197: P Женщины 30.5 (60/197) 14.7 (29/197) 8.1 (16/197) 7.6 (15/197) 9.7 (3/31) 64,5 (20/31) 25.8 (8/31) Нет
[14]; Австралия 191: P Женщины 48 (91/191) 13 (25/191) 39 (74/191) ND 15.3 (11/72 #) SV3: 37,5 (27/72 # )
SV14: 0 (0/72 # )
43 (31/72 # )
SV6.1: 1,4 (1/72 #

) /72

# )
[5]; Австралия 78: U из вагинальных мазков женщин Р 78 Уреаплазма положительные 19.2 (15/78) 79,5 (62/78) 1,3 (1/78) 27 (17/63) 49 (31/63) 16 (10/69 8 4 5/63)
[23]; Соединенные Штаты 169: U От вагинальных мазков P Женщины 169 Уреаплазма Postives 14 (24/169) 81 (137/169) 4 (7/169 ± ) 23 (33/144) SV3: 59.7 (86/144)
SV14: 4.2 (6/144)
28.5 (41/144) ND

P: Беременные ; НП: небеременные; UU: Ureaplasma urealyticum ; UP: Ureaplasma parvum ; СВ: серовар; НД: не определено.Суммарная культура положительна только на Ureaplasma urealyticum. × Только 244 образца были успешно генотипированы на UU и UP. 76,2% (230/302) исследованных женщин были заселены Mollicutes. 27 Положительные результаты на U. parvum были отрицательными для всех четырех известных сероваров U. parvum . # Без усиления 1% (2/72). ± Отрицательно Уреаплазма spp. 1% (1/169).

Что касается биоваров Ureaplasma , наши результаты показали преобладание U.urealyticum (18%; 194/1053) по сравнению с U. parvum (13%; 140/1053) (с учетом смешанной инфекции/колонизации). Это распределение кажется обратным по сравнению с тем, что сообщается о других географических областях, таких как Италия и Хорватия [3, 21]. Результаты субтипирования U. parvum показывают, что наиболее распространенным был серовар 3/14 U. parvum , за которым следуют серовары 1 и 6 соответственно. Подобное распределение наблюдалось в итальянском исследовании, хотя показатели различались [21] (таблица 7).Это различие можно объяснить изучаемой популяцией и географическим положением.

В группе небеременных женщин и независимо от их фертильного статуса распространенность U. urealyticum и U. parvum составила 11,6% (99/856) и 6,8% (58/856) соответственно (исключая случаи смешанного обнаружение). Это распределение и распространенность отличаются от тех, о которых сообщалось в бразильском исследовании, в котором была отмечена высокая распространенность U. parvum (60,6%) [22] (таблица 7). Отличие заметно наблюдается при U.parvum и отмечена [22], по сравнению с нашим результатом, наименьшей частотой случаев коинфекции/колонизации серовара 1 и выше [22] (табл. 7). Эта разница может быть связана с географическим районом, размером выборки и сексуальной активностью.

В группе беременных женщин U. urealyticum преобладает над U. parvum (14,7% (29/197) против 8,1% (16/197)), соответственно (и с учетом только простой инфекции/колонизации). ), обратно обратным результатам, полученным на австралийских женщинах [14] (таблица 7).В распределении типа U. parvum также было получено различие в том, что даже если в обеих популяциях преобладает серовар 3/14, то в австралийском исследовании серовар 1 значительно преобладает над сероваром 6 [5] (табл. 7). Тем не менее, наше распределение сероваров сходно с недавно полученным в американском и другом австралийском исследованиях (где наиболее часто встречаются серовары 3 и 6) [14, 23] (табл. 7). Это может поставить вопрос об эпидемиологической эволюции или изменении распределения видов с течением времени.Тот факт, что в этих более поздних исследованиях серовар 6 достоверно ассоциировался с преждевременными родами [14, 23], позволяет предположить, что беременные нашей серии, носители серовара 6 (25,8%), вероятно, находились в группе риска преждевременных родов. Таким образом, необходимо контролировать течение их беременности, чтобы проверить эту гипотезу и усилить программы скрининга Ureaplasma для предотвращения осложнений.

В нашем исследовании наличие множественных сероваров U. parvum в группе беременных не выявлено, в то время как отмечено у 8% и 2.8% случаев в австралийских исследованиях [5, 14] (табл. 7). Это различие может быть связано с географическим положением и сексуальным поведением женщин, а также их партнеров.

Корреляция между сероварами U. parvum и возрастом была изучена, и результаты показывают, что высокие уровни U. parvum серовара 3/14 и серовара 6 были в основном получены у молодых женщин «≤50 лет» (которые могут быть связаны с сексуальной активностью), тогда как U. parvum s еровар 1 чаще встречался у женщин в возрасте «> 50» лет.Это может быть связано с гормональным статусом (менопаузой) этих женщин, как сообщают Iwasaka et al. который описал наличие Ureaplasma spp. во влагалищной флоре у 25% женщин в постменопаузе [24]. На самом деле менопауза может быть связана с атрофией влагалища, истончением стенки влагалища, сухостью и изменением рН из-за недостатка эстрогена, факторами, которые могут влиять на половую функцию и способствовать инфицированию/колонизации [25].

Используя модели логистической регрессии, была получена значительная связь между возрастной группой «<30 лет» и Ureaplasma spp.(). Эти результаты не удивительны и подтверждают результаты предыдущих исследований [26, 27], а также тот факт, что генитальные микоплазмы связаны с половой активностью. В нашей серии большинство включенных в исследование пациентов заявили, что у них в жизни был только один сексуальный партнер (муж), что связано с социокультурным и религиозным контекстом. Таким образом, связь между половым поведением и биоварами Ureaplasma не может быть установлена.

Корреляция между Ureaplasma biovars и симптомами, связанными с генитальными ИППП, не показывает никакой связи ни для U.parvum , ни для U. urealyticum . Эти результаты согласуются с результатами других исследований, проведенных в Австралии, Словении и Хорватии [3, 28, 29]. Однако в итальянском исследовании сообщалось, что U. urealyticum и U. parvum серовара 3/14 были в значительной степени связаны с симптоматическими пациентами [21]. В нашем исследовании была получена значимая ассоциация между U. parvum серовара 1 и бесплодием (). Для подтверждения этих данных исследование большей популяции и уточнение Ureaplasma spp.молекулярная характеристика представляет интерес.

Были некоторые ограничения настоящего исследования: во-первых, пациенты, участвовавшие в этом исследовании, не могли быть действительно репрезентативными для населения Марокко; другими словами, данные, полученные по этому региону, могут не отражать ситуацию в других географических регионах, и необходимы исследования в других регионах Марокко. Во-вторых, после последовательного набора пациенток размер выборки в группах бессимптомных и симптоматических женщин был разным.Аналогичным образом, культивирование и количественное определение Ureaplasma spp. не проводились. Поэтому простую колонизацию нельзя отличить от инфекции. Тем не менее, наша основная цель состояла в том, чтобы определить распространенность биоваров Ureaplasma и сероваров U. parvum , связанные с ними факторы риска и симптомы, связанные с половыми ИППП.

5. Заключение

В этом исследовании распределение и распространенность биоваров Ureaplasma и каждого из U.parvum сероваров. Таким образом, результаты показали преобладание U. urealyticum по сравнению с U. parvum . Кроме того, подтип U. parvum показал, что наиболее распространенным является серовар 3/14, за которым следуют серовары 1 и 6, а также значительная связь между сероваром 1 и бесплодием. Это позволяет предположить необходимость тестирования этого вида в случаях бесплодия.

Полученные результаты дают представление о биоварах Ureaplasma и U.parvum , распространение сероваров в Марокко и особенно в районе Феса, связанные с ними факторы риска и симптомы, связанные с генитальными ИППП. Необходимы дальнейшие исследования для выяснения и подтверждения патогенной роли этих видов.

Доступность данных

Данные, использованные для поддержки результатов этого исследования, можно получить у соответствующего автора по запросу.

Этическое одобрение

Это исследование было одобрено Институциональным наблюдательным советом Феса, Марокко (No.15.02).

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов в связи с публикацией данной статьи.

Благодарности

Мы хотели бы поблагодарить сотрудников отделения акушерства и гинекологии и анатомо-патологической лаборатории CHU Hassan II of Fez за их помощь в клиническом обследовании и сборе образцов соответственно.

Уреаплазма — Причины | Симптомы | Лечение

Что такое уреаплазма?

Как мы все знаем, человеческое тело является хозяином нескольких бактерий.Для здорового функционирования организма необходим бактериальный баланс в нашем организме. Одна такая группа крошечных бактерий, обитающих в мочевыводящих и репродуктивных путях, называется уреаплазмой. Эти бактерии считаются одними из самых маленьких живых организмов в мире, так что их невозможно идентифицировать даже под микроскопом.

Эти крошечные оргазмы считаются частью человеческого микробиома. Это не что иное, как совокупность триллионов клеток, обнаруженных в человеческом теле и на нем.Эти крошечные организмы помогают во многих функциях нашего организма, таких как переваривание пищи, борьба с инфекциями и поддержание хорошего репродуктивного здоровья.

Хотя эти бактерии, как правило, безвредны, они склонны разрастаться и вызывать воспаление здоровых тканей. Это приводит к колонизации бактерий и в конечном итоге вызывает инфекцию. Уреаплазму связывают с некоторыми состояниями, такими как бактериальный вагиноз, осложнения беременности и т. д.

Каковы причины уреаплазменной инфекции?

Вообще говоря, уреаплазма передается преимущественно половым путем.При этом уреаплазма является распространенным заболеванием у взрослых, ведущих половую жизнь. Эти группы бактерий могут попасть в организм через влагалище или уретру.

Известны случаи передачи уреаплазмы от матери ребенку. Этот тип инфекции очень недолговечен и обычно проходит сам по себе в течение одного-двух месяцев. Вообще говоря, уреаплазма очень редко встречается у детей и взрослых, не ведущих половую жизнь.

Также высок риск заражения уреаплазмой у людей с ослабленным иммунитетом.Группа населения, подпадающая под этот сценарий, включает людей, перенесших трансплантацию органов, или людей, инфицированных ВИЧ (ВИЧ-позитивных).

Также установлено, что женщины имеют высокий риск заражения уреаплазмой наряду с вагинальными инфекциями, если у них было несколько половых партнеров.

Каковы симптомы уреаплазменной инфекции?

Большинство больных уреаплазмой не имеют симптомов. Поскольку уреаплазма является потенциальной причиной воспаления уретры, она может привести к уретриту как у мужчин, так и у женщин.Вот некоторые из симптомов уретрита:

Также у женщин уреаплазма может вызывать бактериальный вагиноз, и некоторые из симптомов бактериального вагиноза включают:

  • Водянистые выделения из влагалища.

  • Неприятный запах из влагалища.

  • Вагинальный зуд.

  • Периодические выделения зеленого или серого цвета.

Кроме того, уреаплазма может повышать риск других заболеваний, таких как:

Влияет ли уреаплазма на фертильность?

Было проведено очень мало исследований, чтобы связать бесплодие с уреаплазмой.Даже эти исследования не дали убедительных доказательств. Но бактерии уреаплазмы были выявлены как у мужчин, так и у женщин, страдающих бесплодием. Врачи предположили, что бактерии, возможно, влияют на качество и количество спермы у мужчин. Когда дело доходит до женщин, особый тип уреаплазмы, называемый ureaplasma urealyticum, часто наблюдается в случаях необъяснимого бесплодия.

В целом на любую инфекцию половых путей приходится 15 процентов всех случаев бесплодия у мужчин.Эти инфекции возникают не только из-за уреаплазмы, но и из-за заболеваний, передающихся половым путем, таких как хламидиоз или гонорея.

Но есть результаты, показывающие, что уреаплазма играет значительную роль в повышении риска преждевременных родов. Контекст таков, что уреаплазма не вызывает преждевременных родов, а является лишь частью серии сложных событий.

Преждевременные роды в основном связаны с воспалением репродуктивных тканей. Это воспаление может быть вызвано многими факторами, включая бактериальные инфекции, например, в амниотическом мешке, шейке матки и влагалище.Уреаплазма может вызвать некоторые тяжелые осложнения во время беременности, такие как:

Кроме того, уреаплазма связана с увеличением риска послеродового эндометрита, который представляет собой не что иное, как воспаление матки после родов.

Как выявляют уреаплазму?

Не существует конкретного метода диагностики, который использует врач для выявления уреаплазмы. Если врач наблюдал за каждым симптомом и исключил любое другое заболевание, врач возьмет образец и отправит его в лабораторию.Для диагностики уреаплазменной инфекции можно использовать следующие тесты:

  • Мазок с шейки матки.

  • Эндометриальный мазок.

  • Мазок мочи.

  • Биопсия эндометрия.

Как предотвратить заражение уреаплазмой?

Поскольку уреаплазма в основном передается половым путем, безопасный секс является основным профилактическим действием, которое может помочь избежать заражения уреаплазмой.Для взрослых, ведущих активную половую жизнь, крайне важно использовать противозачаточные средства, такие как мужские и женские презервативы и зубные прокладки, и избегать негигиеничных действий. Соблюдая эти простые правила безопасного секса, риск заражения значительно снижается.

Также не забудьте помыть пенис и влагалище перед сексом. Это поможет избавиться от любых инфекционных агентов, которые могут вызвать воспаление уретры. Барьерные методы контроля над рождаемостью не обеспечивают никакой защиты от этих инфекций или каких-либо ЗППП.

Людям с ослабленным иммунитетом, страдающим любыми другими заболеваниями, необходимо регулярно наблюдаться у врача и регулярно контролировать свое лечение, чтобы избежать инфекций, а не только уреаплазмы.

Как лечат уреаплазменные инфекции?

Подобно лечению других инфекций, уреаплазменная инфекция также лечится с помощью антибиотиков. Наиболее часто используемыми антибиотиками, эффективными против уреаплазмы, являются азитромицин (зитромакс) и доксициклин.Этих лекарств, как правило, достаточно для большинства пациентов, чтобы победить инфекцию, вызванную уреаплазмой. Но в некоторых незначительных случаях, когда эти лекарства не влияют на инфекцию, врач может перейти на другой тип антибиотиков, называемый фторхинолонами.

При выявлении уреаплазменной инфекции у новорожденных могут возникнуть проблемы с легкими. Это лечится антибиотиком под названием Эритромицин. У беременных женщин, страдающих преждевременным разрывом плодных оболочек, в лечении используются макролидные антибиотики, такие как азитромицин, кларитромицин и эритромицин.

Заключение:

Как упоминалось ранее, уреаплазма присутствует в нашем организме как постоянная часть микробиома. В большинстве случаев они не вызывают никаких проблем, а инфекции также проходят в течение короткого периода времени. Занимайтесь здоровым и безопасным сексом, чтобы предотвратить распространение инфекции.

Инфекция во время беременности представляет собой серьезную проблему, поэтому беременные женщины должны обращать внимание на любые необычные симптомы и регулярно проходить предродовые осмотры. К счастью, некоторые антибиотики показали многообещающие эффекты, которые могут помочь в борьбе с этими инфекциями.

Часто задаваемые вопросы

KoreaMed Synapse

1. Abrams P, Cardozo L, Fall M, Griffiths D, Rosier P, Ulmsten U, et al. Стандартизация терминологии функции нижних мочевыводящих путей: отчет подкомитета по стандартизации Международного общества воздержания.Неуророл Уродин. 2002. 21:167–178.

2. Поттс Дж.М., Уорд А.М., Рэкли Р.Р. Ассоциация хронических мочевых симптомов у женщин и Ureaplasma urealyticum. Урология. 2000. 55:486–489.

3. Буркхард Ф.К., Блик Н., Хохрайтер В.В., Штудер Ю.Е. Ургентное и частое мочеиспускание, хроническая уретральная и/или тазовая боль у женщин. Доксициклин может помочь? Дж Урол. 2004. 172: 232–235.

4. Бака С., Кускоуни Э., Антонопулу С., Сиутис Д., Папаконстантиноу М., Хассиакос Д. и соавт.Распространенность ureaplasma urealyticum и mycoplasma hominis у женщин с хроническими симптомами мочеиспускания. Урология. 2009. 74: 62–66.

5. Разин С. Баловс А., Трупер Х.Г., Дворкин М., Хардер В., Шлейфер К.Х., редакторы. Роды микоплазма, уреаплазма, ахолеплазма, анаэроплазма и астеролеплазма. Прокариоты. 1991. 2-е изд. Нью-Йорк: Springer-Verlag; 1937–1959.

6. Krause DC, Taylor-Robinson D. Maniloff RN, Mcelhany LR, Finch JB, редакторы. Микоплазмы, поражающие человека.Микоплазмы: молекулярная биология и патогенез. 1992. Вашингтон, округ Колумбия: Американское общество микробиологии; 417–444.

7. Далло С.Ф., игрок с низов Дж.Б. Репликация внутриклеточной ДНК и долговременное выживание патогенных микоплазм. Микроб Патог. 2000. 29:301–309.

8. Брюстер-Джордан Дж.Л., Гуан З., Грин Х.Л., Джумадилова З., Койн К.С. Установление достоверности содержания шкалы мочевых ощущений (USS). 2005. Вашингтон, округ Колумбия: Международное общество фармакоэкономики и исследований результатов.

9. Coyne KS, Matza LS, Kopp Z, Abrams P. Подтверждение восприятия пациентом состояния мочевого пузыря (PPBC): глобальная мера по одному пункту для пациентов с гиперактивным мочевым пузырем. Евр Урол. 2006. 49:1079–1086.

10. Брукс С.Т., Донован Дж.Л., Райт М., Джексон С., Абрамс П. Оценочная форма Бристольского опросника по симптомам нижних мочевыводящих путей у женщин: данные рандомизированного контролируемого исследования хирургического вмешательства у женщин с недержанием мочи при напряжении. Am J Obstet Gynecol. 2004.191:73–82.

11. Kilic D, Basar MM, Kaygusuz S, Yilmaz E, Basar H, Batislam E. Распространенность и лечение Chlamydia trachomatis, Ureaplasma urealyticum и Mycoplasma hominis у пациентов с негонококковым уретритом. Jpn J Infect Dis. 2004. 57:17–20.

12. Плейл А.М., Койн К.С., Риз П.Р., Джумадилова З., Ровнер Э.С., Келлехер К.Дж. Валидация глобальных оценок пациентами пользы от лечения, удовлетворенности и готовности продолжать лечение — BSW. Цените здоровье.2005. 8: Приложение 1. С25–С34.

13. Manhart LE, Holmes KK, Hughes JP, Houston LS, Totten PA. Mycoplasma genitalium среди молодых людей в Соединенных Штатах: новая инфекция, передающаяся половым путем. Am J Общественное здравоохранение. 2007. 97:1118–1125.

14. Clegg A., Passey M., Yoannes M., Michael A. Высокие показатели генитальной микоплазменной инфекции в горных районах Папуа-Новой Гвинеи, определяемые как с помощью посева, так и с помощью коммерческого набора для обнаружения. Дж. Клин Микробиол. 1997. 35:197–200.

15. Tibaldi C, Cappello N, Latino MA, Masuelli G, Marini S, Benedetto C. Вагинальные и эндоцервикальные микроорганизмы у симптоматических и бессимптомных небеременных женщин: факторы риска и частота встречаемости. Клин Микробиол Инфект. 2009. 15:670–679.

16. Фальк Л., Фредлунд Х., Дженсен Дж.С. Признаки и симптомы уретрита и цервицита у женщин с инфекцией Mycoplasm genitalium или Chlamydia trachomatis или без них. Секс Трансм Инфекция. 2005. 81:73–78.

17.Уно М., Дегучи Т., Комеда Х., Хаясаки М., Иида М., Нагатани М. и др. Mycoplasma genitalium в шейке матки японских женщин. Секс Трансм Дис. 1997. 24:284–286.

Молекулярное исследование для диагностики уреаплазмы парвум у женщин с привычным невынашиванием беременности

2. Материалы и методы

2.1. Бактериальные изоляты

В общей сложности 130 образцов, включая вагинальное кровотечение, вагинальный мазок и мочу, были взяты у женщин с привычным абортом, а 40 образцов включали вагинальный мазок и мочу от контрольных женщин без повторного аборта.Все образцы культивировали в бульоне IH, который состоит из бульона PPLO, триптонового соевого бульона, порошка дрожжевого экстракта, дистиллированной воды и добавок [22]. Затем делают пересев на IH-агар, который состоит из агара PPLO, триптонового соевого бульона, MgSO 4 ·H 2 O, порошка дрожжевого экстракта, агар-агара, дистиллированной воды и добавок [22]. Ureaplasma spp. изоляты были идентифицированы при изучении морфологии колоний на агаризованной среде IH как темно-золотисто-коричневые или насыщенно-коричневые и зернистые из-за накопления оксида магния внутри и снаружи колонии [17].

2.2. Молекулярные эксперименты

Молекулярные эксперименты включали выделение ДНК Ureaplasma с использованием набора Reagent Genomic DNA Kit (Geneaid, New Taipei, Taiwan). ПЦР-идентификацию U. parvum проводили в соответствии с Kong et al. [23, 24] и набор мастер-миксов (BioNeer, Ирвин, Калифорния). ПЦР проводили с праймерами, специфичными для высококонсервативных областей на 50-м конце многополосного гена антигена U. parvum . Праймер для диагностики У.parvum , UMS-57/UMA222, представлен в табл. 1 [23, 24]. Праймеры для выявления сероваров UMS3S/UMA26, UMS14S/UMA314A, UMS-83/UMA1A и UMS-54/UMA269 (BioNeer, Irvine, California) представлены в табл. 2 [23, 24] и использовались для субтипирования U. parvum для амплификации повторяющихся генов антигенов с множественными полосами сероваров U. parvum .

Организм Primer (F) / (R) Sequence (5′-3 ‘) Размер усиленного продукта (BP) Target Gene
У.Parvum UMS-57 UMS-57 F (TAA ATC TTA GTG TTC ATA TTT TTT AC -57) 326 326 5 ‘Концы генов MBA и Repstream
UMA222 R (GTA AGTGGA TTA AAT TCA ATG 222)

Таблица 1.

Праймер для ПЦР, используемый для обнаружения Ureaplasma parvum .

MBA, многополосный антиген. Адаптировано с разрешения [23–25].

0
Организм Primer (F) / (R) Sequence (5′-3 ‘) Размер усиленного продукта (BP) Target Gene
У.Parvum
Servar 1
UMS-83 ​​/ UMA1A F (TTACT GTA GAA ATT ATG TAA GAT TGC)
R (TTT CTT TTG GTT CTT CAG TTT TTG AAG)
578 MBA
U , parvum
servar 3
UMS3S / UMA269 F (TTA CTG Tag AAA TTA TGT AAG ATC ACC)
R (AA CTA AAT GAC CTT TTT CAA GTG TAC)
400 MBA
U , Parvum
Servar 6
UMS-54 / UMA269 F (AAT CTT AGT GTT CAT ATT TTT TAC TAC)
R (ACCA AAT GAC CTT TTG TAA CTA GAT)
370 MBA
У.parvum
Servar 14
UMS14S / UMA314A F (AAT TAC TGT AGA AAT TAT GTA AGA TTA AGA AAT TAT GTA AGA TTA AT)
R (GTT GTT CTT TAC CTG GTT GTG TAG)
572 MBA

Таблица 2

Праймеры для ПЦР, используемые для субтипирования Ureaplasma parvum в серовары.

MBA, многополосный антиген; U. парвум , Уреаплазма парвум . Адаптировано с разрешения [23–25].

2.3. Техника ПЦР

20 мкл реакционных смесей для амплификации содержали 10 пмоль каждого праймера, 5 мкл матрицы ДНК и воду для ПЦР, добавленную к 20 мкл для идентификации ЕД.парвум . Условия ПЦР использовали следующие: начальная денатурация при 95°С в течение 5 мин, денатурация при 95°С в течение 30 с, отжиг при 58°С в течение 30 с, удлинение при 72°С в течение 1 мин для 40 циклов и конечная денатурация. удлинение при 72°C в течение 5 мин в термоциклере. ПЦР-положительные изоляты для U. parvum были далее субтипированы в серовары, как описано в Таблице 2. Вкратце, условия ПЦР использовали следующим образом: начальная денатурация при 95°C в течение 5 мин, денатурация при 95°C в течение 30 с, отжиг при 55–62°С 30 с, удлинение при 72°С 1 мин 40 циклов.Амплифицированные продукты ПЦР (12,5 мкл) визуализировали в УФ-свете после электрофореза в 2% агарозном геле, который окрашивали 0,5 мг/мл бромистого этидия. Положительным результатом считали видимую полосу соответствующего размера при просвечивании УФ.

3. Статистический анализ

Данные были проанализированы с использованием статистического программного обеспечения SPSS версии 20 (IBM, Армонк, США) для сравнения качественных переменных с использованием P  < 0,05 и коэффициента нечетности. Ассоциация между U.parvum и повторные аборты были статистически значимыми.

4. Результаты и обсуждение

4.1. Лабораторная идентификация

Ureaplasma spp. (колониальная морфология)

В этом исследовании Ureaplasma spp. изоляты были идентифицированы путем изучения морфологии колоний на агаризованной среде IH, используемой в этом исследовании, как темно-золотисто-коричневые или насыщенно-темно-коричневые и зернистые. Все изоляты показали положительный анализ мочевины. Эти результаты соответствовали [17, 26].

4.2. Выделение

Ureaplasma spp. на питательных средах

Обнаружение Ureaplasma spp. возможна путем характерного роста на соответствующих питательных средах, но видовая идентификация U. parvum наряду с идентификацией сероваров молекулярным методом особенно важна для правильной интерпретации результатов лабораторных исследований и оценки патогенности. В настоящем исследовании для выделения Ureaplasma spp.уровень выделения составляет (52,3%) из вагинального кровотечения, (30,7%) из вагинального мазка и (7,6%) из мочи. Причина высокой изоляции Ureaplasma spp. на среде IH можно объяснить добавлением ДНК, путресцина — дигидрохлорида, цистеина, который усиливает микроорганизмы липидными материалами, необходимыми для роста этих бактерий. Также использовалась смесь антибиотиков (цефтриаксон, амоксициллин, аугментин, нистатин и флуконазол) для предотвращения возможного заражения в обычных бульонных средах.Количество лошадиной сыворотки уменьшено с 20 до 10 мл для снижения себестоимости и достаточно для роста этих микроорганизмов. Агаризованная среда Ureaplasma (среда IH) дополнена необходимыми условиями для выращивания этих микроорганизмов. Это лошадиная сыворотка, дрожжевой экстракт, мочевина, цистеин, антибактериальные и противогрибковые средства, ингибирующие рост других бактерий и грибков и оптимальный рН (6,0) [22].

Среда содержит мочевину и чувствительные индикаторы аммиака, сульфат марганца, впервые использованный [27].Было описано, что сульфатная соль марганца поддерживает рост. Сульфат марганца был добавлен в конечной концентрации 0,03%, поэтому он был выбран в качестве предпочтительного реагента для обнаружения аммиака. Уреаплазма spp. колонии появились в течение 2 дней и были идентифицированы как темно-золотисто-коричневые из-за накопления оксида марганца в колонии.

Кроме того, был добавлен путресцин-дигидрохлорид для усиления Ureaplasma spp. рост и развитие осадка в колониях (Phillips et al., 1986). Кроме того, размер Ureaplasma spp. было замечено, что они были больше при добавлении путресцина – дигидрохлорида. Оригинальность этой среды заключается в использовании лошадиной сыворотки (10%) вместо (20%), дрожжевого экстракта в виде порошка, триптонно-соевого бульона BBL вместе с PPLO, а также ДНК и путресцина в той же среде. Кроме того, смесь антибиотиков предотвращает заражение среды бактериями и грибками, которые легко загрязняют обычные среды. Кроме того, в среду добавляли агар – агара было более 3%, что, как считалось, подавляло рост бактерий [22].Таким образом, среды IH считаются обогащенными, дифференциальными и селективными в отношении Ureaplasma spp. потому что это решило важную проблему культивирования этих бактерий.

В другом исследовании использовалась среда IH для изолята Mycoplasma spp. и Ureaplasma spp. [28] выделили Mycoplasma hominis , Ureaplasma urealyticum и Ureaplasma parvum на среде IH от бесплодных самцов в количестве (5,8%), (5,8%) и (3,5%) соответственно. Также [29] выделили Mycoplasma pneumoniae в количестве (18%) на средах ИГ от больных тонзиллитом.В другом исследовании было выделено Ureaplasma urealyticum в частоте (16,8%) от бесплодных самок, (20%) от бесплодных самцов и выделено Mycoplasma hominis в частоте (27,7%), (1,6%) от бесплодных самок и самцов соответственно на MAU. -среда аналогична среде IH [30]. В настоящем исследовании результаты на среде IH Ureaplasma spp. был идентифицирован как темно-золотисто-коричневые или насыщенно-коричневые колонии (рис. 1). Более того, Ureaplasma spp. был идентифицирован по его зернистому внешнему виду (рис. 2).

Рисунок 1.

Ureaplasma spp. в виде темных золотисто-коричневых колоний в среде IH под световым микроскопом 10X.

Рисунок 2.

Ureaplasma spp. как гранулы в среде IH под световым микроскопом 10X.

4.3. Сравнение возрастных групп женщин с невынашиванием беременности и процента выделения

Ureaplasma spp.

Результаты этого исследования показали, что возраст пациентов в диапазоне 17–26 и 27–36 лет представляет собой высокий показатель (46%), (40.7%) соответственно по сравнению с группой (37–46), представленной (13,3%), как показано на рисунке 3, включенном в это исследование. Заболеваемость Ureaplasma spp. в некоторых других исследованиях также сообщалось, что инфекция чаще встречается в возрасте 26–30 лет [31]. Выявление высокой изоляции у женщин с невынашиванием беременности в возрастных группах 17–26 и 27–36 лет. Это может быть связано с сексуальной активностью самок вместе с гормональными изменениями, поэтому половые пути более восприимчивы к инфекции [32]. Высокая частота Ureaplasma spp.инфекция, обнаруженная в этом исследовании, свидетельствует о том, что этот возбудитель широко распространен среди женщин, перенесших выкидыш.

Рисунок 3.

Гистограмма, показывающая распределение Ureaplasma spp. по 10-летним возрастным интервалам пациенток с привычным невынашиванием беременности.

Это может быть связано с сексуальной активностью среди этой группы, так как наблюдается увеличение гормона эстрогена, вырабатываемого женскими половыми путями, что приводит к изменению вагинальной среды, что считается фактором инфекции [33].поскольку эстроген является важным гормоном во время беременности, он заставляет регулировать уровень гормона прогестерона, необходимого для формирования и развития плода, поэтому беременность является одной из причин, ведущих к повышению уровня гормона эстрогена [34]. По этой причине при повышенном содержании эстрогенов он влияет на необходимый при беременности гормон прогестерон, который влияет на толщину слизистой оболочки матки и трудность адаптации плода с ней. Однако обычно трудно определить, вызывают ли эти агенты колонизацию или инфекцию.Поскольку на заболеваемость инфекцией влияют некоторые факторы, такие как: менструальный цикл, бактериальная и протозойная инфекция (коинфекции), а также социально-экономические условия, такие как бедность. Кроме того, возрастные группы 17–26 и 27–36 лет являются наиболее распространенными в нашем обществе для вступления в брак и размножения, по этой причине доля изоляции Ureaplasma spp. под кайфом. В этом исследовании было показано, что процент выделения Ureaplasma spp. была напрямую связана с возрастом.Снижение частоты выделения в 37–46 лет может быть связано с изменениями, связанными со снижением заболеваемости генитальной уреаплазмой , а также за счет атрофии многослойной оболочки влагалища в возрасте 37–46 лет. Все эти причины связаны со снижением частоты генитальной заболеваемости Ureaplasma spp. По результатам данного исследования можно сделать вывод, что генитальные уреаплазмы имели достоверную корреляцию с возрастом. Статистический анализ: ( P -значение = 0.001) оказался очень значимым между пациентами и контрольной группой в соответствии с возрастным интервалом с ( P  < 0,05).

4.4. Взаимосвязь между выделением из половых органов

Ureaplasma spp. и тип образца

На рис. 4 показано распределение бактериального изолята генитальной уреаплазмы по клиническому образцу. Результаты показали, что вагинальное кровотечение у женщин с выкидышем при высоком проценте изоляции (52,3%) с последующим вагинальным мазком (30.7%) и мочи (7,6%). По имеющимся данным генитальный Ureaplasma spp. не проверяются обычными исследованиями вагинальных кровотечений, мочи, вагинальных мазков у женщин, перенесших выкидыш, в медицинских лабораториях Ирака. Мало исследований, которые исследуют рабочие культуры на предмет обнаружения этих организмов в образцах, взятых у женщины с выкидышем. Результаты, полученные в этом исследовании, объясняют изолированную генитальную Ureaplasma в процентах более 38% от образцов вагинального кровотечения, это может быть связано с дисфункцией плаценты, а вагинальное кровотечение является маркером плацентарной дисфункции, вагинальное кровотечение наиболее вероятно. примерно во время лютео-плацентарного сдвига [35].Было мало исследований кровотечений в первом триместре. Интересно, что пик эпизодов кровотечения совпадает с развитием гормонально функциональной плаценты. На очень ранних сроках беременности желтое тело вырабатывает прогестерон. Переход от лютеиновой к плацентарной продукции прогестерона происходит к седьмой неделе беременности и может привести к временному снижению уровня прогестерона, если плацента не производит достаточного количества прогестерона [36]. Снижение уровня прогестерона связано с началом менструаций вне беременности; точно так же во время беременности снижение уровня может вызвать эпизод вагинального кровотечения и ограничить успешное сохранение беременности.Таким образом, кровотечение на этом сроке беременности может сигнализировать о том, что ранняя плацента не развилась оптимально [37]. Один из путей внутриутробного инфицирования Ureaplasma spp. при гематогенной диссеминации через плаценту возникает этот механизм, при котором микроорганизмы способны проникать через шейку матки, инфицировать материнский и плодный (хориоамнион) слои плаценты и нередко попадать в амниотическую жидкость, а в исходе распространенное внутриамниотическое инфицирование приводит к аборту [19].

Рис. 4.

Распространение генитальных Ureaplasma spp. изолировать среди клинических образцов.

Объяснение этих различий может быть связано с типом образцов, исследуемых для выделения, методами, используемыми для транспортировки и хранения, и средами, используемыми для первичной изоляции Ureaplasma spp. В свете наблюдений и опыта, полученных во время этого исследования, центрифугированные осадки мочи дают больше положительных культур, чем образец мочи без центрифугирования.

4.5. Молекулярное обнаружение для диагностики

Ureaplasma parvum с помощью полимеразной цепной реакции (ПЦР)

Результаты показали, что Ureaplasma parvum выделены со скоростью (29.6%) у женщин с повторным абортом и (11%) в контрольной группе, как показано на рисунке 5 (значение P- <0,05 оказалось очень значимым). Результаты показали положительные изоляты для Ureaplasma parvum с использованием праймера UMS-57/UMA222, как показано на рисунке 6. Отрицательные изоляты для U. parvum могут быть связаны с тем, что Ureaplasma разделены на два вида U .parvum и U.urealyticum эти два вида не могут быть идентифицированы по характерному росту на соответствующих средах, а идентифицируются только молекулярными методами [23, 25].Таким образом, отрицательные результаты могут быть Ureaplasma urealyticum , а не Ureaplasma parvum , и результаты, по-видимому, связаны с более высокой долей женщин с повторным абортом. Это могут быть гормональные эффекты, которые могут увеличить количество Ureaplasma parvum и, следовательно, вероятность обнаружения во время беременности. Предыдущее исследование показало, что с использованием метода ПЦР у женщин с повторным абортом в Китае выявлено Ureaplasma parvum (20%) [38].

Рисунок 5.

Распространенность Ureaplasma parvum среди пациентов и контрольной группы.

Рис. 6.

Окрашенный бромистым этидием агарозный гель, демонстрирующий продукт ПЦР-амплификации с праймерами (326 п.н.) для Ureaplasma parvum. Эталонный маркер M 100 п.н. стандартного размера. Дорожки (1, 3, 5, 6, 7, 9 и 11): положительный результат на уреаплазму парвум. Дорожки (2, 4, 8, 10 и 12): отрицательные образцы на Ureaplasma parvum.

Хотя Ureaplasma parvum была выделена в частоте (25%) от женщин с симптомами уретральных, цервикальных выделений, генитального зуда, дизурии в Индии [24, 39].Однако в некоторых других исследованиях этот организм был обнаружен в высокой степени (примерно 79%) у беременных женщин и женщин с заболеваниями, передающимися половым путем, в Австралии [23]. Положительные изоляты Ureaplasma parvum были далее субтипированы на серовары 1, 3, 6, 14; В результате выявлено, что у женщин с привычным абортом преобладала Ureaplasma parvum (биовар 2) серовара 3. Как показано на рисунках 7–9, Ureaplasma parvum серовара 3 был выделен в пропорции 42,8%, наиболее частый изолят у женщин с привычным абортом, за которым следует серовар 1 в пропорции 28.5%, тогда как серовары 6 и 14 показали одинаковую долю (14,2%) обнаруженных в группе больных; однако в контрольной группе было выделено только Ureaplasma parvum серовара 1, что составляет 11%. Среди различных сероваров Ureaplasma parvum , серовар 3 был наиболее частым сероваром, обнаруженным в группе пациентов. Таким образом, у женщин с привычным абортом преобладала Ureaplasma parvum (биовар 2) серовар 3. Мы предположили, что серовар 3 Ureaplasma parvum может играть роль в повторных абортах и ​​преждевременных родах.Также это может быть связано с внутриамниотической воспалительной реакцией на Ureaplasma parvum и что это связано не только с повторным абортом, но и с ранним началом сепсиса у ребенка. Хотя разница в частоте обнаружения различных сероваров Ureaplasma parvum была статистически значимой, преобладание серовара 3 согласовывалось с предыдущими сообщениями [24]. Другое исследование показало, что Ureaplasma parvum серовара 3 является наиболее распространенным сероваром, обнаруженным у репродуктивных людей [40].В другом исследовании была выделена полная последовательность генома Ureaplasma parvum серовара 3, клинический штамм SV3F4, выделенный от пациентки из Японии, у которой был инфекционный аборт на 13-й неделе гестации во время ее предыдущей беременности [41, 42]. Также Урсула и соавт. [10] выделили Ureaplasma parvum серовара 3/14 у 86% женщин с симптоматическими инфекциями половых путей. Возможно, сочетание вариабельных серовар-специфичных генов уреаплазмы с общеизвестными факторами вирулентности определяет развитие патологических процессов на поверхности слизистой половых путей и дыхательных путей человека у младенцев [43, 44].

Рисунок 7.

Распределение сероваров Ureaplasma parvum среди пациентов и контрольной группы.

Рис. 8.

Результаты ПЦР-амплификации для идентификации серовара 1 (578 п.н.) и серовара 3 (400 п.н.). Эталонный маркер M 100 п.н. стандартного размера. Дорожка (1, 5): положительный результат серовара 1. Дорожка (2, 3, 4, 6, 7, 8, 9): отрицательные образцы. Пер. (10, 14): серовар 3 положительный результат. Дорожка (11, 12, 13, 15, 16, 17): отрицательные образцы.

Рисунок 9.

Результаты ПЦР-амплификации для идентификации серовара 3 (400 п.н.), серовара 6 (370 п.н.) и серовара 14 (572 п.н.).Эталонный маркер M 100 п.н. стандартного размера. Дорожка (1, 3, 4, 5, 6, 8, 9, 10, 11, 13, 14): отрицательные образцы. Дорожка 2: положительные результаты серовара 3. Дорожка 7: положительный результат на серовар 6. Дорожка 12: положительные результаты серовара 14 (концентрация агарозы 2% и напряжение 100). * Статистический анализ включает значение P <0,05, которое показало высокую значимость между группой пациентов и контрольной группой в соответствии с выделением сероваров Ureaplasma parvum.

5. Заключение

Результаты явно указывают на то, что U.parvum может быть важным этиологическим агентом повторного аборта. И U. parvum серовара 3 был наиболее частым сероваром, выделенным в этом исследовании. Это может играть роль в повторяющихся абортах.

Конфликт интересов

Конфликт интересов отсутствует.

1. Введение

В главе анализируются источники метафор компьютерной визуализации и взаимодействие человека и машины. Суть метафоры состоит в интерпретации и переживании явлений одного рода через явления другого рода.

Метафора является основной идеей формирования видов визуализации, интерфейсов и сценариев вывода визуализации и взаимодействия с ней.

Источники метафоры — объекты окружающего мира, научные идеи, идеи, заимствованные из литературы, фольклора, научно-фантастического кино, компьютерных игр и т.п.

Метафоризация основана на взаимодействии структур исходной и целевой областей. В процессе метафоризации некоторые объекты целевой области структурируются по образцу объектов целевой области, и происходит метафорическое отображение (проекция) одной области на другую.Таким образом, метафору можно понимать как карту исходной области в целевую, и эта карта строго структурирована [1]. Идеи метафор часто основаны на реальной жизни, а также на абстрактных научных идеях. Следует упомянуть такие примеры визуализации докомпьютерной эпохи, как картография, инженерная графика и декартовы координаты, сыгравшие важнейшую роль в развитии современной цивилизации. Декартовы координаты были основой идеи компьютерной графики в первый период ее развития.Использование новых идей связано с развитием средств взаимодействия человека с компьютером. Именно в этой сфере появились такие метафоры, как световая кнопка и меню световой кнопки. Наиболее известная и до сих пор популярная метафора рабочего стола также связана с интерфейсами, предназначенными для обеспечения взаимодействия при компьютеризации офисной работы. Метафора рабочего стола почти полностью основана на реалиях офисной работы. Однако есть двойной щелчок, который можно назвать волшебной функцией и не имеющей аналогов в реальной жизни.Далее такие волшебные черты были добавлены в целый ряд метафор, используемых в системах компьютерной визуализации. Появление виртуальной реальности как среды компьютерной визуализации сделало актуальным использование метафор. Условия, присущие виртуальной реальности, чем-то похожи на магию и научную фантастику. Поэтому сказки и фантастика в литературе и кино могут стать интересным источником новых метафор.

Ниже мы обсудим основные идеи докомпьютерной визуализации, возможности метафор, основанных на реальных явлениях и на научных идеях.Затем мы проанализируем возможности сказок как источников метафор. Мы также приведем несколько примеров метафор, основанных на научной фантастике, и обсудим эволюцию визуализации от комикса до иммерсивного кино.

2. Глобальные метафоры визуализации

Концепция метафор популярна в публикациях по компьютерной визуализации и взаимодействию человека с компьютером. Можно выявить следующие два случая использования этого понятия:

Метафора как базовая идея представления данных, идея конвергенции сущностей компьютерной системы и домен-источник.

Метафора как идея взаимодействия с [виртуальной] средой, созданной компьютерными системами.

Рассматривается следующая иерархия компьютерных метафор:

Глобальные метафоры отображают основную идею дизайна. Например, рассматривать мир как «суперофис». ( Весь мир — контора, и все мужчины и женщины в ней всего лишь клерки ).

Рассмотрим метафоры глобальной визуализации. Эти идеи зависят от глобальных событий и изменений в обществе, искусстве и науке.Нас интересуют глобальные метафоры, имеющие визуальное («докомпьютерное» и компьютерное) представление. Эти идеи легли в основу картографии, инженерных чертежей и графиков функций на декартовой плоскости.

Мы рассматриваем взаимодействие метафорических идей и вызовов, стоящих перед экономикой, наукой и образованием в прошлом и настоящем.

Современная картография является результатом развития географии и предпосылкой Эпохи Великих Исследований. Использование проекции Меркатора и сетки параллелей и меридианов в современную эпоху является большим достижением в визуализации географических и навигационных данных.

Вариации географических метафор теперь используются в системах визуализации данных и программного обеспечения.

Инженерный чертеж — продукт промышленной революции, ее предпосылка и важный инструмент. Несколько представлений и проекций, набор правил, изображающих характеристики продукта, составляют некий явный код.

Инженерный чертеж в виде САПР является неотъемлемой частью компьютерных средств современных инженеров.

Одной из самых мощных идей визуализации современности является идея рисовать графики функций в декартовых координатах.Понятие функции отражает довольно абстрактные понятия, но благодаря графическим рисункам с ними могут ознакомиться даже самые маленькие школьники.

Двухмерные и трехмерные графики являются основой современной научной визуализации и важной частью визуализации данных и программного обеспечения [2].

3. Компьютерные метафоры

Для начала давайте пересмотрим то, как обстояли дела в области человеко-компьютерного интерфейса до появления визуальных метафор. В те времена инженеры-программисты (которые составляли основную долю пользователей во всем мире) еще помнили о работе с громоздкими компьютерными консолями.В интерактивных системах преобладал интерфейс командной строки. Например, команды редактирования текста включали индикацию операции, номер исходной строки (иногда и номер символа в строке) и (при необходимости) новый текст для исправления или вставки. Такой интерфейс, хотя и требовал от пользователя помнить о постоянно меняющемся тексте, и несмотря на случайные неудачи с сохранением изменений, был достаточно сносным для профессионалов. Графические дисплеи дали новый импульс взаимодействию человека с компьютером.Наряду со средствами визуализации данных стали использоваться средства программного интерфейса. Исходя из этого, в эксплуатацию вошли световые кнопки (примитив вывода, используемый для имитации функциональной клавиши) и меню световых кнопок. С их помощью можно было легко взаимодействовать как с системой программы, так и с программой пользователя.

Массовое появление персональных компьютеров просто не могло произойти без появления средств визуального взаимодействия, новых устройств и принципиально новых концепций организации интерфейса с пользователем, например, концепции прямого манипулирования.

Концепция прямой манипуляции была предложена в начале 1980-х профессором Б. Шнейдерманом, известным специалистом в области вычислительных наук, который объединил и проанализировал новые тенденции в организации интерфейса. В настоящее время эта концепция преобладает в дизайне интерфейсов.

Б. Шнейдерман определил следующие особенности интерфейса, созданного на основе концепции прямого манипулирования:

  1. Непрерывное изображение интересующего объекта

  2. Физические действия (манипуляции мышью, джойстиком, сенсорным экраном, и т.п.) или использование функциональной клавиатуры вместо команд со сложным синтаксисом

  3. Быстрые операции, разбиваемые на шаги и допускающие сброс, с мгновенно видимым воздействием на интересующий объект

Суть такого подхода к созданию интерфейса заключается в заставить пользователя воспринимать свою деятельность как непосредственное манипулирование объектами, отображаемыми на экране, а не как диалог с компьютером по поводу этих объектов. Вместо использования командного языка для описания операций с объектами пользователь манипулирует видимым восприятием этих объектов на экране.

Метафора интерфейса рассматривается как основная идея конвергенции и подобия между модельными объектами прикладного поля и интерактивными объектами. Роль интерфейсной метафоры заключается в том, чтобы способствовать лучшему пониманию семантики взаимодействия, а также дать визуальное представление об объектах диалога и определить набор действий пользователя с ними.

Метафора интерфейса в этом отношении рассматривается как основа семиотической системы, которая, в свою очередь, лежит в основе интерактивного языка.С помощью этого языка пользователь формирует свою задачу и добивается решения с помощью компьютера. Метафора интерфейса не только помогает описать абстракции, но и структурирует понимание новой прикладной области и определяет объекты интерактивного [визуального] языка [3].

Самая последняя глобальная метафора лежит в основе современной компьютеризации. По ряду экономических и социальных причин люди в конце ХХ века воспринимали окружающий мир не как мастерскую, где работают служащие, а как контору, где проводят время клерки и менеджеры.Краеугольный камень успеха настольной метафоры тесно связан с этим изменением в восприятии мира. Результаты современной компьютеризации (и метафора рабочего стола) отражают глобальные представления современного «постиндустриального» мира. Однако «офисные» интерфейсы порождают приемы офисной деятельности в таких «неофисных» областях, как медицина или образование. Это часто связано с эффектами нон-грата.

Первоначально эта метафора предлагалась для систем автоматизации делопроизводства, но затем ее использование было расширено для интерфейсов операционных систем. Эти идеи были связаны с программированием для конечных пользователей, как средства для офисных клерков и менеджеров, чтобы упростить свою работу с использованием компьютеров.

Метафора рабочего стола стала самой распространенной практикой в ​​1990-х годах. Эта метафора во многом лежит в основе современных визуальных интерфейсов. Успех десктопной метафоры, несомненно, связан не только (и не столько) с естественной образностью иконок, которые [не всегда] понятны пользователям, но с логичностью и системностью всех действий в визуальных средах, основанных на этой метафоре. .

Формула настольной метафоры описана в [1]. Помимо заимствования реалий офисной работы, у этой метафоры есть «волшебная» идея: все действия внутри системы совершаются посредством двойного клика по иконкам.

Примечательно, что расширения метафоры рабочего стола в сторону метафоры офисного стола, метафоры офисного пространства и метафоры картотеки оказались не очень успешными, несмотря на интересные решения и использование нескольких магических функций.

4. Сказки и фантастика как источник метафор

Предоставляя результаты расчетов, визуализация обеспечивает интерпретацию и анализ полученных данных.Можно выделить следующие подполя компьютерной визуализации: научная визуализация, визуализация программного обеспечения и визуализация информации. Научная визуализация предполагает использование средств компьютерной графики и взаимодействия человека с компьютером для получения данных об объектах, процессах и явлениях, моделируемых в научных расчетах. Визуализация программного обеспечения означает сочетание методов использования графики и средств взаимодействия человека с компьютером, используемых для лучшего понимания явлений и для эффективной эксплуатации программного обеспечения, а также для спецификации и представления объектов программного обеспечения в процессе создания программы.Термин визуализация информации относится к визуальному описанию и представлению абстрактной информации, полученной в результате сбора и обработки данных различных типов и функций.

Обычно в научной визуализации используются традиционные (докомпьютерные) методы отображения математических, физических, химических, биологических и других моделей (например, двумерные и трехмерные графики функций). Иногда также используются образы, естественные и/или типичные для данного приложения, например, представления молекул при моделировании химических процессов.Традиционная образность, иногда заимствованная из докомпьютерной статической графики, также используется в визуализации информации. Можно сделать вывод, что использование метафор в научной и информационной визуализации ограничено.

Компьютерные метафоры стали наиболее широко использоваться в системах визуализации программного обеспечения. Эти метафоры основаны на объектах и ​​явлениях реального мира или на моделях, полученных из конкретных отраслей науки. Среди этих метафор наиболее популярны пространственные метафоры: метафора города или метафора ландшафта и, в частности, их вариации.Пространственные (трехмерные) метафоры активно применяются при разработке презентационных представлений в системах визуализации, используемых для мониторинга, тестирования и отладки параллельных и распределенных программ, а также программ обработки событий и обеспечения реакции на них. Эти метафоры широко используются в системах, основанных на виртуальной реальности [4, 5, 6, 7].

Использование метафоры города предполагает структурирование входных данных посредством внутренней структуры города, состоящей из отдельных кварталов, улиц и зданий.Естественность метафор обуславливает как простоту ориентации в пространстве, так и легкость навигации. В системах программной визуализации в пределах города или ландшафта метафора транспортных артерий часто используется для представления потоков управления и потоков данных, а также различных связей между объектами и программными компонентами. При использовании этих метафор в системах, основанных на виртуальной реальности, возможен полет над городом. Известны примеры программных систем визуализации, основанных на расширенной метафоре города/здания/комнаты с использованием телепортации для мгновенного перемещения между районами города или зданиями, представляющими различные элементы большого программного комплекса.

В качестве идеи средства визуального программирования выбрана космическая метафора в ее современном понимании, с гелиоцентрическим мировоззрением. При этом части сущностей программы представлены в виде планет, их спутников, колец (как кольца Сатурна) и других элементов космического пространства. Представляется, что в случае применения виртуальной реальности более удобным может оказаться наиболее архаичный 3D-вариант геоцентрической модели, когда Земля представляется плоской, а небесные тела расположены на полушариях, покрывающих плоскую Землю [8].

Согласно научным взглядам, метафора молекулы может использоваться, в частности, для визуализации трассировок и графиков производительности параллельных программ. Эта метафора обеспечивает репрезентативное представление большого объема структурированных данных. Интерпретация метафоры физической молекулы (частицы) и ее модификаций в целом проста и естественна, хотя и требует от пользователя определенных (базовых) знаний физики. Перемещение и навигация могут осуществляться посредством облета молекулы (или набора частиц).Это означает, что метафора молекулы, так же как и метафора города/ландшафта, включает в себя некоторые магические или фантастические черты.

В статье [9] описана оригинальная метафора мозга, которая используется для анимированного представления работы параллельной программы. Идея визуализации активности мозга при предъявлении ему каких-либо стимулов переносится на визуализацию работы программы или приложения (активация процедур и функций, ввод/вывод и т.д.). Заметим, что в этой метафоре нет никаких магических черт; возможно, именно это затрудняет восприятие большого объема информации на его основе.

В настоящее время набирает популярность идея геймификации. Подразумевает использование идей компьютерных игр в неигровых областях применения. При разработке систем визуализации программного обеспечения этот подход предполагает создание инструментов, предоставляющих разработчикам программного обеспечения интерфейс, аналогичный интерфейсу компьютерных игр. В работе [5] рассматривается программная система визуализации на основе виртуальной реальности с использованием виртуальной реальности. Метафора города является базовой метафорой этой системы. Однако и образность, и способ взаимодействия в системе сильно напоминают популярные компьютерные игры.

Геймификация в разработке систем визуализации программного обеспечения на основе виртуальной реальности также упоминается в статье [10]. Описывается среда на основе виртуальной реальности, которая должна обеспечивать работу со структурами программного кода с использованием метафор города и космических метафор для визуализации, навигации и передачи данных программного кода в интерактивном режиме. Были выпущены игры, которые продемонстрировали потенциал геймификации для улучшения понимания структурных зависимостей и модульности кода.

Таким образом, источником метафор служат повседневная реальность, научные идеи и современные компьютерные игры. Далее в качестве источников рассмотрим сказки и фантастику, где используются предметы с магическими свойствами и персонажи, обладающие магическими способностями. Волшебные идеи, описанные в фантастических романах или в литературно обработанных фольклорных сказках, являются наиболее функциональными и, следовательно, наиболее полезными для наших целей.

Важным вопросом при формировании научных и, в частности, компьютерных метафор является вопрос о том, где найти источник [11, 12].Описание конструктивной процедуры поиска и/или генерации интерфейсных метафор представлено в [13]. Эта многоступенчатая процедура предусматривает (среди прочего) рассмотрение предметных областей, пользовательских задач и пользовательских характеристик.

Интерес к «волшебству» в связи с HCI и метафорами интерфейса проявился в начале 1990-х годов. Значительное внимание уделено понятию «магические черты». Это понятие в контексте HCI было впервые введено в [14].

Вопрос о магии и магических свойствах как источнике метафор при разработке интерактивных визуальных программных комплексов также обсуждается в статье [15] (см. также [16]).

Слово «магия» очень популярно в составе метафорических названий интерфейсных техник, например, «волшебная линза», «волшебное зеркало», «волшебный ланцет» и т. д. В [17] приводится ряд конкретных представлены примеры из сценической магии и обсуждается применение ее принципов и методов в дизайне человеческого интерфейса.Статья [18] посвящена источникам метафор для материальных пользовательских интерфейсов. Авторы предполагают, что магия и паранормальные явления могут быть полезным местом для поиска новых метафор для осязаемых пользовательских интерфейсов. Также магия вуду считается интересной идеей для интерфейсов с виртуальными объектами. В [19] техника куклы вуду используется как техника двуручного взаимодействия для манипулирования объектами на расстоянии в иммерсивной виртуальной среде.

Идеи оформления интерфейсных метафор, связанных с волшебными сказками, фэнтези и фантастическими романами, описаны в ряде статей.В [20], например, упоминается волшебная метафора ковра-самолета, а в [21] реализуется метафора ковра-самолета, например, движущегося в среде виртуальной реальности. В [22, 23, 24, 25, 26] описаны способы использования «волшебной палочки». Волшебная палочка считается метафорой манипуляции для формирования интерфейса в системах с элементами виртуальной реальности. Интересные идеи чудо-объектов (например, волшебного зеркала) были предложены (и реализованы в прототипах) для сторителлинга в современных музеях [27].В [28] описана информационная система, использующая метафору города. В этой системе постоянно используются магические/фантастические возможности. Среди этих возможностей есть «туннелирование сквозь пространство», представляющее собой типичное заимствование из научной фантастики. Комнаты с «волшебными окнами» тоже можно отнести к волшебному (научно-фантастическому) элементу. «Волшебное окно» — интересное расширение известной метафоры информационной стены.

Здесь мы рассматриваем фантастические магические возможности, выбирая образцы, плодотворные для метафор интерфейса и визуализации.

Волшебный транспорт: В сказках и фантастических романах встречается:

  1. Телепортация — мгновенное перемещение посредством словесного воздействия (заклинания) или посредством манипуляций с любыми предметами или использования таких устройств, как телепорты

  2. Довольно медленное перемещение с помощью магического транспорта. Магический перенос может происходить как для предметов, так и для (одушевленных и неживых) предметов магии

Магические навигационные средства: Пример — веха с волшебной легендой или волшебный клубок, следуя по которому можно попасть в Сказочную страну.

Магические средства связи: Примером может служить магическое зеркало, настроенное на интересного персонажа для его защиты или наблюдения.

Магия (дополнительная к обычной) возможности для манипуляций с предметами, процессами и даже природными явлениями. В некоторых вариантах сверхспособность, непобедимость и т.д. Вообще говоря, можно использовать термин «магическая сила» (или «сверхспособность»). Эти манипуляции и силы могут быть выполнены с помощью заклинаний и объективной магии, а также с помощью универсального манипулятора, волшебной палочки .

Можно выделить общий класс магических объектов как объекты, обладающие «магическими свойствами». Таким образом, возможно магическое расширение привычного функционала (например, семимильные сапоги), а также приписывание предметам дополнительных, несвойственных в реальной жизни функций (например, волшебная лампа Аладдина, используемая для вызова, активации и обезвреживания волшебных существ ). По отношению к магическим предметам, используемым в качестве манипуляторов, средств транспорта и связи, также можно использовать термин «магические орудия».»

Волшебные превращения предметов : В качестве примера можно рассмотреть строительство дворцов джинном в арабской сказке или превращение тыквы в карету для Золушки.

Аналогично магическим предметам могут быть представлены магические предметы, т.е. злые, добрые или нейтральные (по отношению к персонажам) маги, обладающие сверхспособностями. (Как вариант — волшебные антропоморфные существа, например, феи, гномы, тролли, джинны и др.)

Волшебные превращения людей : В сказках такие превращения могут быть спонтанными, неожиданными для персонажей, а могут быть результатом магические действия (некоторые магические заклинания или манипуляции).Эти преобразования могут осуществляться с учетом симпатической магии (т. е. магии, основанной на определенном сходстве).

Наше внимание привлекли две «волшебно-фантастические» метафоры из романов (а также фильмов) о Гарри Поттере. Это говорящие и движущиеся портреты и Карта мародеров, на которой даже были показаны движения людей. В данном случае активными объектами являются портреты умерших людей. Они могут без просьб обращаться к живым героям романа и даже переходить из одной портретной рамы в другую, чтобы навестить друг друга.Карта непрерывно отслеживает и показывает местонахождение человека, находящегося под наблюдением.

В сказках и фантастических романах много активных, антропоморфных и говорящих персонажей, таких как Голем, роботы К. Чапека и И. Азимова и т.д. Точно так же существуют многочисленные вариации магических/фантастических средств навигации и поиска как в сказках, так и в фэнтези.

В этих магических метафорах важны не столько визуальные характеристики, сколько спонтанная активность, присущая генерируемым объектам и субъектам.Спонтанную активность можно рассматривать как средство имитации разумного поведения. Важно также существование персонажа независимо от пользователей, имитирующего разумное поведение. В научно-фантастической и научно-популярной литературе и фильмах такие активные компьютерные «сюжеты» появились несколько десятков лет назад. В современной компьютерной практике агенты, действующие по собственной инициативе, часто вызывают раздражение. Мы начали наше исследование активных интеллектуальных агентов, чтобы понять, что, почему и где должны делать активные интеллектуальные агенты.

Рассмотрена идея «активной» карты, показывающей реальный ландшафт и движения объектов. «Активность» карты может быть связана с событиями так же, как и в навигационных системах: перемещение, поворот, пересечение и т. д.; но «деятельность» может быть и спонтанной, связанной с временными событиями. Еще одна возможная идея – разработка «активной» схемы охраняемой квартиры или территории. В этом случае могут понадобиться системы слежения и «подсветки» лиц.На схеме могут быть показаны движения всех без исключения персонажей, а метки позволят их идентифицировать. В контексте приведенных идей можно отметить, что работы в этом направлении на базе таких систем, как GPS, ведутся и есть примеры использования интерактивных карт в качестве путеводителей. Более того, сейчас легко разрабатывать говорящих антропоморфных агентов-аватаров, и примеров таких реализаций множество.

Мы решили связать идею активных агентов на основе метафоры говорящего портрета с экспертной системой.Дело в том, что активный агент со своей (возможно) назойливой активностью авторизован только в случае обучающих систем. Логика развития проекта привела нас к следующей идее «активного учебника». Этот учебник должен уметь анализировать поведение учащегося в процессе обучения, например, время чтения, манипуляции с текстом и так далее. На основе этих анализов «активный учебник» может детализировать учебный материал, искать новые источники данных или переходить к другим вещам.Анализ поведения пользователя может осуществляться на синтаксическом уровне (на уровне работы с мышью и клавиатурой, отслеживания взгляда и т. д.) и на семантическом (мониторинг открытых файлов или сайтов, запуск приложений, запись событий, так далее.). Такой анализ и элементы программирования на демонстрациях позволят нашей системе научиться обучать в процессе ее использования и действовать в заданном направлении «самостоятельно». Также возможно снабдить систему функциями советника.Система будет похожа на умного человека-советника и не будет навязывать свое мнение, а будет давать рекомендации и решения. Это человекоподобное поведение может быть обеспечено психологически обусловленным замедлением активности системы.

Предложено расширение метафоры города, используемой в программных системах визуализации, путем добавления активных агентов путем ввода параметров в определенные функции и методы. Агенты могут перемещаться по городу, определяя места, где они используются и меняются, а также то, как происходит процесс работы алгоритма.Таким образом, расширенная метафора создает такие дополнительные свойства, как возможность наблюдать программные объекты внутри зданий или помещений, отражая те или иные сущности при перемещении активных агентов по городу.

В системах визуализации на основе сред виртуальной реальности встречаются такие задачи, где необходимы сложные манипуляции с объектами, например, вытягивание чего-либо, вырезание или увеличение. В качестве метафоры инструмента для таких задач, прежде всего, дизайнеру приходит в голову идея волшебной палочки.Однако волшебная палочка не имеет дифференцированных действий и, следовательно, требует средств для изменения режимов работы. В специализированных системах более естественно использовать специализированные «магические инструменты». Например, в медицинской информационной системе в качестве метафоры манипулятора предлагается идея «волшебного ланцета». Ланцет позволяет «препарировать» тот или иной участок организма для более глубокого исследования. При «препарировании» любого объекта человеческого организма визуализируются все физические изменения, как если бы мы делали это в реальности. В случае сочетания метафоры «волшебного ланцета» с трехмерной моделью человеческого тела можно получить виртуальную модель операций, а в настоящее время разрабатывается прототип системы визуализации информации для медицинских целей.Системы, основанные на этой метафоре, можно использовать, например, для обучения хирургии [29].

Научная фантастика может быть скрытым источником метафор, используемых для управления визуальными объектами в среде виртуальной реальности. Так, например, в работе [30] описывается среда для эксперимента по изучению психологических состояний в виртуальных средах. Пользователь должен манипулировать кубиками, чтобы составить заданный узор. Эти кубы в виртуальных средах «ловятся» специальной ловушкой, в которой может активироваться режим антигравитационного движения в нужную точку или режим вращения куба.При использовании специальной команды куб поднимается над виртуальным столом и летит в заданном пользователем месте.

Наше предварительное исследование показывает применимость «магических» метафор для задач в интерактивных системах и системах, основанных на средах виртуальной реальности. Например, поиск метафор для движений в виртуальной среде может потребовать магических транспортных средств, таких как телепорты и полеты различных типов (ковёр-самолет, летающий корабль, Рух, крылатый конь).Метафоры интеллектуальных агентов-информаторов также могут основываться на магических средствах навигации.

В сказках и фантастических романах можно найти массу магических явлений, таких как магическое знание, военная магия, исполнение желаний, телепатия и чтение мыслей и т. д. Но мы пока точно не знаем, являются ли эти функции полезны для поиска метафор. Однако для выбора метафор манипуляций с объектами и процессами в виртуальных средах интерес может представлять «военная магия».Военная магия связана с переносом событий, происходящих в волшебном мире, в реальность. Например, любые вариации «волшебных шахмат», где игры с шахматными фигурами переносятся в наземные сражения, или «морская» военная магия, где модели борьбы в бочке с водой переносятся в морские сражения. Эти идеи (отчасти близкие к магии вуду) можно найти в ряде народных и литературных сказок.

Обратите внимание, что народные сказки подчиняются строгой логике развития сюжета и выбора персонажей.Кстати, в литературных сказках и фантастических романах эта логика тоже обычно соблюдается.

Анализ показывает, что экзотические «магические» метафоры могут использоваться для формирования любых интерфейсных функций. Однако реализация интерактивных систем на их основе может быть как сложной, так и противоречивой. Волшебные метафоры часто трансформируются в абстрактные интерфейсные возможности, теряя ощутимую связь с исходными идеями. Например, в случае метафоры говорящего портрета антропопатия агента оказалась ненужной.Но необходимо наделить его функцией волшебного помощника/проводника в мир знаний. Конечно, трансмутированная абстрактность метафор является скорее преимуществом, чем недостатком их использования. В системах, созданных, например, для автоматизации делопроизводства или для программирования конечных пользователей, наличие волшебных руководств по интерфейсу может выступать отвлекающим или даже раздражающим фактором. Однако использование таких «магических возможностей», как автоматический возврат электронных аналогов бумажных документов на место по окончании обработки, может осуществляться без особых предупреждений даже для неопытных пользователей.

Leave a Reply

Добавить комментарий

Ваш адрес email не будет опубликован.

2022 © Все права защищены.