Фото спайки кишечника: Все современные методы лечения спайки кишечника в Москве

Содержание

Лечение спаек остеопатией без операции – отзывы пациенток, СПб, МЦ Мудрый Доктор

Миллионы людей по всему миру хотя бы раз в жизни оказывались на операционном столе. Как правило, операции – и плановые, и экстренные – проходят успешно, и по истечении периода реабилитации человек возвращается к ведению привычного образа жизни. Тем не менее, врачи-остеопаты отмечают, что любое хирургическое вмешательство – даже если оно было произведено лапароскопическим методом – может негативно сказаться на функционировании внутренних органов в случае развития у пациента спаечного процесса.

Спайки после операции на органах брюшной полости – после аппендицита, операции на кишечнике, удаления матки и других хирургических вмешательств в сфере гинекологии – а также после операций на позвоночнике являются одним из распространенных осложнений. Как показывает практика, именно в первое время после хирургического вмешательства проще всего предотвратить развитие спаечного процесса, а также устранить уже сформировавшиеся спайки.

В первые недели и месяцы после операции лечение спаек остеопатией особенно эффективно! Обычно для этого достаточно одного-двух сеансов у остеопата.

Спайки после операции – механизм формирования

Внутренние органы человека покрывает тонкая полупрозрачная пленка – серозная оболочка. Внутри живота это так называемая брюшина, выстилающая снаружи органы малого таза, желудок и кишечник, в полости грудной клетки это покрывающая легкие плевра. У здорового человека листки серозных оболочек подвижны – мягко скользя, они тем самым дают органам возможность функционировать полноценно.

Тем не менее, механическое повреждение внутренних органов – в том числе, иссечение их частей в ходе операции — или воспалительный процесс способны стать причиной повреждения данных серозных оболочек. В стремлении восстановить их целостность организм начинает замещать поврежденный участок пленки соединительнотканными волокнами, которые стягивают между собой листки серозных оболочек, препятствуя их скольжению друг относительно друга и образуя неэластичные перетяжки.

Именно эти перетяжки специалисты и называют спайками.

Что касается внутренних органов, то у них есть собственные связки – гибкие, эластичные, помогающие органам удерживаться на месте и в то же время обеспечивающие должный уровень их физиологической подвижности. Травмы и некоторые заболевания способны стать причиной деформации этих связок – их утолщения, неравномерного распределения плотности по составляющей их ткани и срастания фрагментов связок с органами. Подобные нарушения провоцируют смещение внутренних органов, а также к появлению во внутрибрюшном и/или плевральном пространстве так называемых зон избыточного напряжения. Так, удерживающие желудок связки в патологически натянутом состоянии способны стать причиной появления у пациента болей в области спины. Со временем спаечный процесс может разрастаться, образуя протяженные цепочки неэластичного соединения органов, тканей и связок. И подобная цепочка, направленная, например, от желчного пузыря через печень и диафрагму в область сердца, может спровоцировать появление у человека болей в груди.

При этом назначенное кардиологом лечение будет малоэффективным или совсем бесполезным, ведь причиной появления болей в данном случае будет именно проведенное на желчном пузыре несколько лет назад хирургическое вмешательство!

Так, спайки в области малого таза могут образоваться вследствие проведенной операции – аборта, удаления матки или маточной трубы и т.д., а также вследствие воспаления. Выраженным воспалительным процессом могут сопровождаться в том числе такие гинекологические заболевания, как эндометриоз, воспаление придатков, аденомиоз и т.д.

Причины развития спаечного процесса

Основными факторами, провоцирующими образование спаек, являются:

  • воспалительный процесс. И сам процесс, и присоединение к нему бактериального заражения, способны стать причиной повреждения обволакивающих внутренние органы серозных оболочек. Примером может являться развитие спаечного процесса в груди вследствие плеврита, а в брюшной полости – вследствие перитонита;
  • проведенные хирургические вмешательства. И лазер, и скальпель, и радиоволны неизбежно повреждают серозные оболочки внутренних органов, что может стать причиной формирования после операции фиброзных спаек;
  • травмы. Повреждение серозных оболочек в этом случае также способно спровоцировать развитие спаечного процесса;
  • наконец, в ряде случаев спаечный процесс активизируется в отсутствие каких-либо видимых причин. Врачи полагают, что это следствие неблагоприятной в этом смысле наследственности.

Спайки после операции: симптомы

Симптоматика обусловлена тем, какие именно органы вовлечены в патологический процесс. Так, наличие спаек в плевральной полости провоцирует у пациента частые простудные заболевания и/или одышку, которая, в свою очередь, способна значительно снизить его работоспособность, усиливая утомляемость. Другие симптомы спаечного процесса в груди – это боли и давление в области сердца, а также постоянный кашель, медикаментозное лечение которого малоэффективно.

В отсутствие своевременной диагностики и лечения спайки кишечника могут стать причиной грубой деформации его петель, затруднения прохождения через них полупереваренной пищи, проблем с всасыванием стенками кишечника питательных веществ и как следствие – ее постепенным атрофическим изменениям, а в наиболее запущенных случаях даже привести к некрозу части кишечной стенки. Спайки кишечника могут спровоцировать появление у пациента следующих симптомов:

  • спастические боли в животе, которые могут иметь различную интенсивность, и, как правило, становятся более выраженными в момент физической активности или несоблюдении диеты;
  • запоры – следствие деформации кишечных петель;
  • нарушения стула;
  • вздутие живота, метеоризм;
  • нарушение всасывания питательных веществ кишечной стенкой может стать причиной стремительной потери веса пациентом.

Встречается и бессимптомное течение патологии. Тем не менее, можно быть абсолютно уверенным, что если у пациента когда-либо была операция на органах брюшной полости, то в ней гарантированно имеются спайки.

Если говорить о локализованных в области малого таза спайках, то они проявляются прежде всего болезненностью при пальпации. Боль может быть от едва ощутимой до практически нестерпимой – последняя обычно свидетельствует об остром течении патологии. Кроме того, пациент может жаловаться на тошноту, рвоту, нарушения стула.

Наконец, у женщин спайки в области малого таза могут стать причиной нарушения менструального цикла, болезненности при половом акте и даже бесплодия.

Лечение спаек у остеопата

Уникальная возможность организма самостоятельно компенсировать различные нарушения его функционирования позволяет ему до определенного момента сохранять серозные оболочки взаимно подвижными, а связки – эластичными. Тем не менее, утрата их функциональных характеристик способна привести к нарушению подвижности внутренних органов.

Лечение спаек без операции методом остеопатии, по отзывам пациентов врачей-остеопатов нашего медицинского центра в Санкт-Петербурге, является высокоэффективным методом, позволяющим буквально за несколько сеансов избавиться от дискомфорта и боли. Это щадящая методика, которая не имеет побочных эффектов и может применяться для пациентов любого возраста и любого состояния здоровья, позволяющая без операции восстановить подвижность и нормальное функционирование внутренних органов.

В ходе сеанса остеопат оказывает бережное воздействие на внутренние органы пациента, тем самым восстанавливая их нормальное положение друг относительно друга и подвижность, одновременно с этим освобождая защемленные нервы и кровеносные сосуды. Подобное мануальное воздействие стимулирует работу внутренних органов, благоприятно сказываясь на их состоянии и стимулируя восстановление целостности покрывающей их поверхность серозной оболочки. Это не только устраняет патологическое натяжение связок, но также и способствует предотвращению развития у пациентов других заболеваний – следствий наличия в теле участков перенапряжения.

Попутно специалист восстанавливает нормальный лимфоток и кровообращение, а также нормализует мышечный тонус. При этом устраняется как атония, так и гипертонус мышц, в том числе и тех, которые входят в структуру внутренних органов.

Практически при любой степени патологического процесса лечение спаек у врача-остеопата позволяет добиться стойкого положительного результата. Разумеется, устранить застарелые спайки без операции не представляется возможным; тем не менее, специалист может восстановить нормальную подвижность и функционирование даже внутреннего органа со спайками.

Больше клетчатки и меньше нагрузки. Врач о том, как избежать заворота кишок | ЗДОРОВЬЕ: Медицина | ЗДОРОВЬЕ

Завороток кишок – не слишком распространённое, но весьма опасное заболевание. Начинается оно с боли в животе, а может привести к летальному исходу. О причинах развития недуга, его симптомах и последствиях корреспонденту «АиФ-Воронеж» рассказал врач-колопроктолог высшей категории, кандидат медицинских наук, заведующий колопроктологическим отделением областной больницы №1, главный внештатный колопроктолог департамента здравоохранения Воронежской области Роман Попов.

Запоры, нагрузки и анатомия

Дарья Вербицкая, «АиФ-Воронеж»: Роман Владимирович, что такое заворот кишок?

Роман Попов: Заворот – это перекрут кишечной петли вокруг оси брыжейки тонкой или толстой кишки с формированием полной или частичной непроходимости. Перекрут может быть в любых отделах толстого и тонкого кишечника. 

— Каковы причины заворота?

— Основные причины возникновения заворота кишок можно разделить на две категории. Первая – это анатомические особенности – врождённая аномалия развития толстого кишечника, удлинение всей толстой кишки или её части. Вторая – спаечный процесс брюшной полости. Заворот возникает из-за того, что в организме после ранее перенесённых травм или операций на брюшной полости появляются спайки – соединяются кишки.

— В детстве существовала такая страшилка, что нельзя бегать после еды или как-то физически напрягаться, иначе будет заворот кишок. Это как-то связано?

— Да, этот недуг может появиться и от тяжёлой физической нагрузки. Если она сочетается с запорами. На самом деле, тут должны совпасть несколько факторов. 

Резкая боль и шум плеска

— Как распознать болезнь, какие бывают симптомы?

— Заворот может случиться на любом участке кишечника, где есть спайки. Если у детей чаще наблюдается заворот тонкого кишечника, то у взрослых в 50% случаев встречается заворот сигмовидной кишки.

Болезнь начинается остро. Сначала наступает резкая боль в животе, которая от приступов переходит к постоянной. При завороте сигмовидной кишки боль локализуется в среднем отделе живота, больше слева. Потом появляется асимметрия живота. При пальпации ощущается, что кишки раздулись, а при прослушивании можно услышать шум плеска. Это симптом Склярова – шум плеска в тонкой или толстой кишке. Далее может появиться рвота. Также характерны запоры и задержи отхождения газов.

При любой резкой боли в животе я советую сразу же вызывать скорую помощь и везти больного в хирургический стационар. Не стоит принимать спазмолитик, так как он может нивелировать клиническую картину заболевания. Когда боль появляется и усиливается, надо бить тревогу.

— Можно ли вылечить этот недуг?

— Для распознавания кишечной непроходимости проводится обзорная рентгенография, УЗИ и/или РКТ брюшной полости.

Если кишка перекрутилась на 90 градусов, то она ещё не омертвела. Такую патологию лечат консервативно. Проводится эндоскопическое расправление заворота через прямую кишку. Иногда получается разрешить ситуацию таким способом. При неполном завороте даже клизма может помочь расправить кишку.

Если перекрут больше чем на 180-360 градусов, то уже страдает и кровоснабжение кишки. Когда наступает некроз, появляются серьезные последствия. Кишка может лопнуть, а всё её содержимое – вылиться в брюшную полость. Смертность при осложненных формах некроза или перитонита составляет около 47%.

Если консервативное лечение не помогло, необходимо хирургическое вмешательство. Проводится так называемая операция Гартмана. Патологический участок удаляется, отводящий сегмент заглушается, а другой конец кишки, раздутый калом и газами, выводится на переднюю брюшную стенку в виде стомы. В дальнейшем через это противоестественное отверстие будут выделяться каловые массы вплоть до выполнения реконструктивной операции.

— Можно ли как-то предупредить заворот кишок?

— Человека должны насторожить частые запоры. Необходимо наладить регулярность стула, организовать правильно режим труда и отдыха. Стоит обратить внимание и на питание. Чтобы не было запоров, человеку необходимы продукты с клетчаткой. Желательно, чтобы она была термически обработана. Она содержится в цельнозерновом хлебе, овощах, фруктах, отрубях, бобовых, грибах, крупах, орехах. Тем, кто страдает панкреатитом и гастритом, овощи и фрукты лучше употреблять после термической обработки.

Смотрите также:

Операции при спаечной болезни в Genesis Dnepr. Хирургическое лечение спаек при бесплодии в Украине.


Операции при спаечной болезни

Когда возникает спаечная болезнь?
Пленки или тяжи из соединительной ткани, которые словно «склеивают» органы брюшной полости между собой, вызывая изменения анатомического расположения, называют спайками. Они возникают вследствие особой ответной реакции специальной изолирующей тканевой оболочки, которая запускает процесс нарастания новой соединительной ткани. Зачастую их образованию предшествует оперативное вмешательство. Также среди причин спаечной болезни можно выделить аутоиммунные факторы, инфекционные и воспалительные процессы, химическое либо механическое воздействие. Для хирургического вмешательства используют преимущественно лапароскопический метод.

Симптомы и диагностика спаечной болезни
Так как образование спаек характеризуется склеиванием соединительной ткани, в результате возможно сдавливание органов и нарушение их деятельности вследствие перетяжек либо заворотов, а также полная или частичная непроходимость (например, маточных труб либо кишечника). К основным симптомам относят болевые ощущения, нарушения пищеварения, бесплодие. Бессимптомные формы, не мешающие пациенту, не всегда требуют оперативного вмешательства, однако заболевание коварно и может проявить себя самым серьезным образом, требующим немедленного хирургического вмешательства. Диагностика спаечных процессов включает сбор анамнеза, ультразвуковую диагностику брюшной полости, допплерографию и другие способы. Тактику дальнейших действий определяет лечащий врач.

Операции при спаечной болезни

Несмотря на то, что причиной возникновения спаек в большинстве случаев являются проведенные ранее операции, для их удаления также приходится прибегать к хирургическому вмешательству. Каждый клинический случай требует уникального подхода в лечении и нет универсальных методов, однако наиболее часто используется лапароскопический адгеолизис. С его помощью рассечение спаек происходит без вскрытия брюшной полости, оставляя впоследствии незаметные шрамы, и достигается минимальная травматичность. Потребуются лишь небольшие проколы для эндоскопа особой конструкции и двух (максимум, трех) вспомогательных трубок. Для рассечения новообразований соединительной ткани возможно использование лазерного, электрического и аквадиссекционного метода. Операция проводится под общим наркозом. Противопоказанием к проведению операции является значительное поражение брюшной полости, перитонит или наличие кишечных свищей.

Преимущества лапароскопии

Современный способ проведения операции при спаечной болезни методом лапароскопического адгеолизиса значительно снижает период восстановления, позволяя пациенту намного быстрее вернуться к привычному ритму жизни и не страдать от болевого синдрома. Также метод практически полностью исключает инфицирование и развитие осложнений. В клинике Genesis Dnepr представлен ультрасовременный инструментарий, который, в сочетании с профессионализмом опытных врачей-хирургов, гарантирует успешное проведение операций при спаечной болезни любой сложности. Процесс выздоровления проходит в условиях комфортного современного стационара и при комплексной полноценной реабилитации.
У нас есть всё для Вашего здоровья!

Острая кишечная непроходимость у беременных

Командой врачей роддома «Лелека» был подготовлен материал на важную тему «Острая кишечная непроходимость у беременных» в раздел «Обмен опытом» газеты «С заботой о женщине», выходящей совместно с «Фондом Медицины Плода, Украина».

Статья была подготовлена ​​главным врачом роддома «Лелека» Шадлун Дмитрием, заведующим отделением анестезиологии и интенсивной терапии Евгением Грижимальським, профессором, доктором медицинских наук. хирургом высшей категории Александром Иоффе, врачом-анестезиологом Андреем Гарга, врачом-анестезиологом Евгением Сулименко.

Случай посвященный проблеме диагностики и лечения острой кишечной непроходимости в сочетании с беременностью.

Трудности диагностики и лечения острой кишечной непроходимости при беременности, высокий процент послеоперацинных осложнений и летальных исходов диктуют необходимость дальнейшего изучения проблемы в целях повышения качества предоставления помощи для снижения репродуктивных потерь при беременности.

Острая кишечная непроходимость (ОКН) — понятие, объединяющее ряд заболеваний, общим для которых является нарушение проходимости в просвете кишки. Частота острой кишечной непроходимости неуклонно растет, особенно спаечной, вследствие высокой хирургической активности. За последние 50 лет частота этого заболевания увеличилась примерно в 25 раз. Во время беременности частота острой кишечной непроходимости увеличилась в 2-3 раза, возникает преимущественно в III триместре.

Кишечная непроходимость у беременных характеризуется трудностями диагностики и неблагоприятным прогнозом для матери и плода. Летальность больных с кишечной непроходимостью составляет 3-18%, у беременных она увеличивается до 35-50%. Прогноз для жизни ребенка еще хуже: прерывание беременности достигает 60%. Особенностью беременных пациенток является то, что они поздно попадают в поле зрения хирурга.

Для кишечной непроходимости у беременных характерны все этиологические факторы, свойственные этому заболеванию и вне беременности: спайки, сращения воспалительного  и послеоперационного характера (поэтому особенно внимательным нужно быть к больным, у которых в анамнезе есть указания на операции),  врожденные патологические карманы, внутренние грыжи, аномалии развития органов желудочно-кишечного тракта, стенок брюшной полости, новообразования. В 6-15% случаев матка с растущим в ней плодом является причиной развития непроходимости кишечника. С этой точки зрения для острой кишечной непроходимости три периода становятся критическими:

1-й — выход матки из полости малого таза вверх (3-4-й месяц беременности),

2-й — опущение головки плода в конце беременности,

3-й — внезапное уменьшение матки после родов с быстрым изменением внутрибрюшного давления. Чаще всего кишечная непроходимость развивается во второй половине беременности и во время родов, причем во время родов она протекает особенно тяжело

Для кишечной непроходимости у беременных характерны все этиологические факторы, свойственные этому заболеванию и вне беременности.

Классификация ОКН:

1) Динамическая (функциональная) ОКН:

a) Спастическая форма.

b) Паралитическая форм

2) Механическая ОКН:

a) Странгуляционная непроходимость (заворот, внутреннее ограничение).

b) Обтурационная непроходимость.

c) Смешанные формы странгуляционной и обтурационной непроходимости (инвагинация, спаечная непроходимость).

Различают динамическую и механическую острую кишечную непроходимость. В 88% больных, страдающих ГКН, определяют механическую непроходимость (чаще странгуляционную форму в виде заворота), а в 12% — динамическую форму.

Динамическая ОКН может быть спастической и паралитической, механическая — обтурационной (при сдавливании опухолью кишки снаружи или закупорки изнутри, при глистной инвазии, желчно-каменной болезни и др.) И странгуляционной (заворот кишок, образование петли, перегиб, внутреннее ограничения). При странгуляционной ОКН одновременно с закрытием просвета кишки сжимаются сосуды и нервы, что приводит к нарушению кровообращения и быстрой гангрены кишечника.

При инвагинации кишечника происходят и обтурация, и странгуляция. Динамическая кишечная непроходимость, обычно паралитическая, развивается вследствие общего или местного перитонита при острых хирургических заболеваниях: аппендиците, холецистите, панкреатите и в послеоперационном периоде, в том числе после кесарева сечения.

Существует вариант динамической кишечной непроходимости, встречается только у беременных, в основе которой лежит полное или почти полное снижение тонуса дистального отдела толстой кишки, в результате чего становится возможным сжатие его в месте перехода в малый таз матки. Такая атония кишечника объясняется гипер-продукцией гестагенов. Ей предшествуют стойкие запоры. Е. К. Айламазян в своих работах описывает такой вариант заболевания острой кишечной непроходимости беременных.

Спастическая кишечная непроходимость возникает вследствие значительного усиления моторной функции кишечника, вызванной лекарственными препаратами, которые ведут к спазму гладкой мускулатуры (физиостигмин, питуитрин, прозерин). Динамическая кишечная непроходимость имеет лучший прогноз, она устраняется с помощью консервативной терапии, реже — хирургическим путем.

При механической ОКН выполняют экстренную операцию, а поэтому прогноз зависит от ранней диагностики, срочной госпитализации и своевременного хирургического лечения. У беременных, как и у небеременных женщин, частой причиной острой кишечной непроходимости является странгуляция — заворот тонкой кишки. Возникает она обычно вследствие повышенной перистальтики и спаечной болезни брюшной полости. Частота развития послеоперационного спаечного процесса достигает за 80%.

Основные симптомы этого варианта кишечной непроходимости следующие: сильные постоянные или схваткообразные боли в мезогастрии, видимая перистальтика, асимметрия живота, метеоризм или выпячивание проксимального отдела кишечника, шум плеска. При повороте верхнего отдела тонкой кишки появляется обильная рвота. При странгуляционной непроходимости общее состояние беременной быстро ухудшается вместе с нарастанием симптомов шока, который развивается вследствие перитонита. Тяжелая форма легче диагностируется, так как на первый план выступают симптомы шока, которые невозможно не заметить. Лабораторные исследования неспецифические.

Многообразие форм, патогенетических особенностей ГКН, обусловливает полиморфизм клинической симптоматики и создает почву для диагностических трудностей и несвоевременного лечения.

Главными задачами в диагностике ОКН являются:

• констатация факта непроходимости;

• классификация (динамическая или механическая)

• причины заболевания;

• выраженность ГКН

Трудности диагностики ОКН у беременных связаны с изменениями топографических соотношений органов в брюшной полости, что не позволяет четко определить некоторые наиболее характерные симптомы (например, асимметрию живота, наличие выраженной перистальтики кишечника). Боли не всегда носят выраженный характер. Другие симптомы тоже могут быть менее острыми. Характерны: ранняя многократная рвота, тахикардия и снижение артериального давления. При постановке диагноза помогает проведение рентгенологического обследования (наличие горизонтальных уровней жидкости в кишечнике, растянутых газами, подтверждает диагноз ОНК).

ГКН у беременных дифференцируют с самопроизвольным абортом, преждевременными родами, перекрут ножки кисты яичника, перитонитом, разрывом матки, парезом кишечника, внутрибрюшным кровотечением. Инструментальные методы диагностики (УЗИ и рентгенография органов брюшной полости) при подозрении на кишечную непроходимость используются как для подтверждения диагноза, так и для уточнения уровня и причины развития ОКН. У беременных для диагностики кишечной непроходимости логичным будет использование УЗИ.

УЗИ-признаками механической кишечной непроходимости являются:

• Расширение просвета кишки> 2 см с феноменом «секвестрации жидкости»;

• утолщение стенки тонкой кишки> 4 мм;

• наличие возвратно-поступательного движения химуса по кишке;

• увеличение высоты складок Керкринга> 5 мм и увеличение расстояния между ни- мы> 5 мм;

• гиперпневматизация кишок в приводном отделе.

УЗИ- признаками динамической кишечной непроходимости являются:

• феномен «секвестрации жидкости» в просвет кишки;

• отсутствие возвратно-поступательного движения химуса по кишке;

• не выражен рельеф складок Керкринга;

• гиперпневматизация кишечника во всех отделах.

При лечении очень тяжелым и ответственным является вопрос о прерывании или сохранении беременности. Если прерывать, то каким методом и когда: до, во время операции или после нее? При этом необходимо учитывать состояние, больной, срок заболевания, срок беременности, состояние плода, число предыдущих беременностей, состояние родовых путей.

Общепринятыми установками являются:

• После того как возникло подозрение на непроходимость при беременности — обязательное и немедленная консультация хирурга.

• Если непроходимость возникает у женщин со сроком до 6 месяцев, искусственное удаление плода не производится.

• При необходимости кесарева сечения он проводится в первую очередь, а вмешательство на кишечнике — во вторую очередь.

• При перитоните боль абдоминальное кесарево сечение противопоказано.

• При сочетании беременности сроком более 6 месяцев и непроходимости, осложненной перитонитом, необходимо сначала провести лапаротомию, а затем решать вопрос о родах через родовые пути индивидуально — в зависимости от состояния беременной, срока беременности.

Желательно консервативное или хирургическое лечение кишечной непроходимости проводить при сохранении беременности. Прерывания ее показано только при динамической кишечной непроходимости, вызванной самой беременностью; в этом случае при сохранении беременности любая терапия окажется бесполезной. При всех других случаях заболевания следует избегать операций на матке в связи с опасностью ее инфицирования.

Одним из важных вопросов остается анестезиологическое обеспечение у пациенток такой категории. Все пациенты с «острым животом» должны рассматриваться, как пациенты с полным желудком. В нашем случае была использована эпидуральная анестезия в сочетании с поверхностной общей анестезией и искусственной вентиляцией легких. Мы использовали быструю последовательную индукцию (краш-индукция) с интубацией трахеи. Содержимое желудка был эвакуировано через зонд. Эвакуация желудочного содержимого позволяет избежать регургитации во время индукции, что может привести к аспирации и развитию тяжелой гипоксии.

Преимущества такого анестезиологического обеспечения:

  • Качественное обезболивание как во время операции, так и послеоперационное
  • Удовлетворенность пациента после операции.
  • Профилактика пареза кишечника.
  • Раннее начало питания.
  • Уменьшение времени госпитализации.
  • Избежать длительной ИВЛ.
  • Снижение риска кардиальных, легочных осложнений и острого повреждения почек.

Мы также убеждены, что к беременным пациенткам с хирургической патологией нужно применять ERAS прото кол — протокол ускоренной реабилитации. Мультимодальная анестезия и послеоперационная анальгезия — его основные компоненты.

Симптомы проявления спаек кишечника и их терапия

Спайки – это патологическое сращение тканей, происходящее в результате воспалительного процесса. В кишечнике после появления спаек между петлями  образуется непроходимость, которая останавливает работу данного органа полностью и является опасной для жизни.

Причины возникновения и симптомы спаек кишечника

Развитие спаечного процесса возможно в результате операции на органах брюшной полости, воспалений, имеющихся в них, а также травм живота. Спайки могут возникнуть даже через несколько лет. И появление их связано с наличием в организме больного специфического фермента, при помощи которого на травмированном месте образуется плотный большой рубец.

Спайки кишечника, симптомы которых мы сегодня рассмотрим, считаются серьезным явлением. Ими ни в коем случае нельзя пренебрегать, дабы не допустить опасной для жизни непроходимости кишечника. Нужно помнить, что появление этой патологии не всегда сопровождается выраженной болью. Чаще она имеет неопределенную форму: болевые ощущения разной степени локализации и тяжести.

Симптомы спаек кишечника

  1. Болезнь может иметь невыраженную симптоматику и обнаружиться только в результате врачебного обследования.
  2. Чаще пациента беспокоят тянущие боли в животе, которые усиливаются при физической нагрузке.
  3. Для данной патологии характерно нарушение функции кишечника: это проблемы со стулом (как правило, запоры).
  4. Нередко болезнь сопровождается появлением геморроидальных узлов, которые возникают из-за нарушения оттока крови по венам, передавленным спайками.
  5. Наблюдается потеря веса больным.
  6. Непроходимость кишечника сопровождается сильной болью, рвотой, скоплением газов и отсутствием стула.

Как подтверждаются симптомы спаек кишечника

Помните, что спайки самостоятельно рассосаться не могут! Поэтому все перечисленные выше симптомы должны быть поводом для обязательного обращения к врачу.

При рентгенологическом обследовании в случае наличия спаек обнаруживается присутствие в тонком кишечнике воздуха, чего не должно быть в норме. Также эффективными методами диагностики данного заболевания являются компьютерная томография и УЗИ брюшной полости.

Спайки кишечника: симптомы и лечение

Почти 80% спаек кишечника лечат консервативным методом. Как правило, в послеоперационный период больному назначают профилактический курс медикаментов и физиотерапии для предотвращения образования данной патологии.

Если в результате обследования было подтверждено наличие спаек, лечение будет длительным. Оно может проходить как в стационаре, так и амбулаторно. Это зависит от того, как протекает заболевание.

При начальной стадии, наряду с медикаментозными средствами, больному предписывают курсы лечения травами, а также назначают специальную диету. При тяжелой форме эти средства неэффективны, поэтому больной должен ложиться на операцию (наиболее приемлемой является лапароскопия), в результате которой спайки рассекаются и восстанавливается проходимость кишечника.

Подведем итоги

Симптомы спаек кишечника, как вы убедились, не могут оставаться незамеченными. Будьте внимательны к различным проявлениям своего организма и не оттягивайте обращение к врачу, тогда ваша болезнь не примет опасную для жизни форму.

Спаечная болезнь — причины, симптомы, диагностика и лечение

Спаечная болезнь – заболевание, вызванное образованием соединительнотканных тяжей между внутренними органами и брюшиной. Патология чаще всего связана с предшествующей операцией. Симптомы зависят от локализации спаек и их распространенности. Для острого периода характерны абдоминальные боли, поносы или запоры, рвота, падение давления, повышение температуры, слабость. Диагностика заключается в тщательном сборе анамнеза и жалоб, а также проведении рентгенографии органов брюшной полости, УЗИ, МРТ, лапароскопии. Лечение направлено на купирование симптомов, предотвращение прогрессирования патологии, при частых обострениях и рецидивах показано проведение операции.

Общие сведения

Спаечная болезнь — патологическое состояние, обусловленное формированием соединительнотканных сращений (спаек) в брюшной полости. Организм человека уникально устроен, в определенный момент времени он включает защитные механизмы, которые могут предотвратить развитие тяжелых осложнений, но это отражается на общем состоянии. С целью ограждения здоровых органов от поврежденных структур вокруг патологического очага формируется соединительная ткань. Она не может восполнить функции утраченной, но позволяет заполнить пустоту и оградить окружающие ткани от патологии. Вначале эта ткань рыхлая, затем она уплотняется и иногда окостеневает. Так и образуются спайки.

Спайки в брюшной полости представляют собой соединительнотканные тяжи, которые соединяют брюшину и внутренние органы. Сращения перетягивают органы и ограничивают их подвижность, создают условия для нарушения их функций, поэтому нередко становятся причиной серьезных заболеваний, например, непроходимости кишечника или женского бесплодия.

Спаечная болезнь

Причины

Провоцирующими факторами, инициирующими механизм спаечной болезни, могут быть заболевания внутренних органов в сочетании с оперативной травмой (в 98% случаев). Если к травме присоединяются инфекция, кровь, пересыхание брюшины, то риск появления спаек возрастает.

Запустить развитие спаечной болезни могут ушибы и травмы живота. Тупые механические повреждения нередко сопровождаются внутренними кровотечениями, образованием гематом, нарушением лимфооттока и обмена веществ в пораженных тканях. Это ведет к расстройству кровотока в брюшине и началу воспаления со всеми вытекающими последствиями. Спаечную болезнь могут также вызывать врожденные аномалии и пороки развития, химические вещества, лекарственные препараты и инородные тела.

Патогенез

Внутренние органы брюшной полости покрыты тонкими листками брюшины. В норме они имеют гладкую поверхность и секретируют небольшое количество жидкости, чтобы обеспечить свободное перемещение органов брюшной полости относительно друг друга. Различные провоцирующие факторы приводят к отеку тканей и появлению фибринового налета на брюшине. Фибрин – это клейкое вещество, которое способствует соединению близлежащих тканей. Если в это время не провести адекватную терапию, то после стихания патологических процессов на месте склеивания образуются спайки.

Процесс формирования сращений проходит в несколько этапов: вначале выпадает фибрин, затем через 2-3 суток на нем появляются специальные клетки (фибробласты), которые секретируют коллагеновые волокна. Выраженное замещение воспаленных тканей соединительными начинается на 7 день и заканчивается на 21. За этот период сращения превращаются в плотные спайки, в них прорастают капилляры и нервы.

Симптомы спаечной болезни

Клинические признаки спаечной болезни зависят от локализации спаек и распространенности патологии. Заболевание может протекать бессимптомно или появляться внезапно и остро с необходимостью срочной госпитализации в отделение хирургии.

Неотложные состояния при спаечной болезни чаще всего связаны с непроходимостью кишечника. В подобных ситуациях пациенты предъявляют жалобы на интенсивную боль, тошноту, рвоту, повышение температуры тела. Пальпация живота вызывает резкие болевые ощущения, к тому же пациент не может определить их точную локализацию. Заболевание оказывает сильное влияние на перистальтику кишечника: возможно ее усиление с развитием поноса или, наоборот, ослабевание до полного исчезновения, что приводит к появлению запоров. Многократная рвота резко ухудшает состояние пациентов и вызывает обезвоживание, это сочетается с падением артериального давления, резкой слабостью и усталостью.

Иногда симптомы спаечной болезни имеют периодический характер, то появляясь, то внезапно исчезая. В этом случае пациента беспокоят боли в области живота, запор или диарея. Если клинические проявления слабо выражены, изредка возникает ноющая боль и незначительные расстройства кишечника, тогда говорят о развитии хронической спаечной болезни. Чаще всего с подобными состояниями сталкиваются гинекологи, поскольку спаечный процесс может поражать внутренние половые органы, оказывая негативное влияние на менструальную функцию и способность к деторождению.

Диагностика

Хирург может заподозрить спаечную болезнь во время первичного осмотра пациента при наличии характерных жалоб, предшествующих воспалительных заболеваний органов брюшной полости, оперативных процедур и инфекционной патологии. Диагностические мероприятия подразумевают проведение лапароскопии, УЗИ и МСКТ органов брюшной полости, рентгенографии, электрогастроэнтерографии.

КТ ОБП. Множественные спайки кишечника/сальника с брюшной стенкой.

  • Лапароскопическое исследование – наиболее информативный метод диагностики спаечной болезни. Это по своей сути микрооперация, заключающаяся в выполнении небольших разрезов, введении в них специальных инструментов с камерой, которая позволяет провести видеовизуализацию внутренних органов. Это не только диагностическая процедура: после обнаружения проблемы можно сразу осуществить оперативное вмешательство для лечения спаечной болезни.
  • Обзорная рентгенография ОБП играет большую роль в постановке диагноза спаечной болезни. Метод позволяет обнаружить воспалительный экссудат в брюшной полости, повышенное газообразование в кишечнике и его вздутие. Часто исследование проводят с использованием контрастного вещества для определения непроходимости кишечника.
  • Электрогастроэнтерография подразумевает измерение электрических сигналов от разных отделов пищеварительного тракта во время его сокращения.
  • УЗИ и КТ органов брюшной полости – точные методы, позволяющие определить расположение спаек и их распространенность.

Множественные спайки в брюшной полости (межкишечные/с брюшной стенкой/сальником), у этого же пациента.

Лечение спаечной болезни

Лечение спаечной болезни заключается в проведении консервативных и хирургических процедур. Консервативные терапевтические мероприятия направлены на предотвращение образования спаек и их негативных последствий, а также купирование симптомов. Оперативное вмешательство проводится при острых неотложных состояниях, постоянных рецидивах патологии и частых обострениях.

Консервативная терапия

В начале консервативного лечения спаечной болезни в первую очередь купируют болевые ощущения. Этого можно добиться путем проведения очистительной клизмы (если боль связана с запорами и задержкой газов), наложением тепла на живот, приемом спазмолитиков. Решить проблему запоров можно назначением специальной диеты, обогащенной продуктами, которые усиливают перистальтику (любые погрешности в питании могут вызвать резкое обострение патологии). Если это не помогает, назначают легкие слабительные препараты и физиопроцедуры: диатермию, парафиновые аппликации, ионофорез, грязелечение.

Пациентам рекомендуют исключить физические нагрузки, чтобы предотвратить спазмы мускулатуры, которые вызывают усиление боли. Для устранения рвоты назначают противорвотные препараты, а также используют внутривенные растворы для снятия симптомов обезвоживания.

Хирургическое лечение

Хирургические вмешательства при спаечной болезни довольно сложны, к тому же они подразумевают серьезную предоперационную подготовку. Очень часто операции делают по поводу неотложных состояний: подготовка таких пациентов скоротечна, но всегда полноценна. Больным переливают плазму, раствор хлорида натрия, Рингера-Локка, гидрокарбоната натрия для устранения симптомов обезвоживания и нормализации кислотно-основного состояния крови. С целью детоксикации вводят солевые растворы, реополиглюкин с преднизолоном или гидрокортизоном.

Старые рубцы на коже от предшествующей операции не иссекают, так как это может привести к осложнениям, поскольку петли кишечника припаяны к рубцу. Спайки удаляют, разделяют, раздвигают. Выбор метода зависит от конкретной ситуации. Если обнаружены участки некроза кишечника, то поврежденную область резецируют, а проходимость восстанавливают или накладывают стому. При спайках, деформирующих кишечник, формируют обходной анастомоз. Подобные манипуляции показаны при наличии плотного конгломерата петель, но иногда этот участок резецируют.

Во время операции соблюдают основные меры по профилактике рецидива заболевания: делают широкие разрезы, предотвращают пересыхание листков брюшины, проводят полноценную остановку кровотечений и своевременно удаляют кровь, исключают попадание в рану инородных предметов; в рану не вносят сухие антисептики и антибиотики, для сшивания используют полимерные нити.

После операции показано внутрибрюшинное введение протеолитических ферментов, назначение противовоспалительных и антигистаминных препаратов, проведение стимуляции перистальтики. Следует отметить, что хирургические манипуляции в 15-20% случаев приводят к повторному образованию спаек, поэтому к вопросу терапии стоит подходить обдуманно.

Прогноз и профилактика

Прогноз при единичных спайках благоприятный, но множественные поражения вызывают негативные последствия. Предотвратить развитие спаечной болезни можно, выполняя ряд несложных действий: следует вести правильный образ жизни, полноценно и рационально питаться, заниматься спортом. Нельзя допускать периоды длительного голодания, чередующиеся с приступами переедания. Важно следить за регулярностью стула, а также обеспечить полноценное пищеварение, проводя профилактику заболеваний желудочно-кишечного тракта и проходя регулярные осмотры у гастроэнтеролога. Во многом профилактика спаечной болезни зависит от компетентности врачей, соблюдения ими техники и правил операции, назначения адекватной терапии.

от чего они появляются и как их лечить? — Sibmeda

Спайки в брюшной полости могут доставить неприятности людям, перенёсшим операции на брюшной полости или воспалительные заболевания органов брюшной полости. Проявления варьируются от незначительных редких болей до неотложных хирургических состояний. Эксперт портала «Сибмеда» – Геннадий Николаевич Толстых, к.м.н, Заслуженный врач РФ, заведующий отделением хирургии ГНОКБ.  

Почему образуются спайки?
  
В хирургической практике под спаечной болезнью брюшной полости подразумевают состояние, когда между внутренними органами, расположенными в брюшной полости, образуются разного вида и строения перемычки или тяжи из соединительной ткани, которые и называются спайками.

Изначально это защитный процесс, потому как посредством образования спаек организм стремится ограничить патологический очаг, блокируя его. При нормальном течении заболевания, по прошествии определённого времени, спайки исчезают, а если и остаются, то не дают о себе знать, и пациенты могут не подозревать об их существовании.
Но в некоторых случаях процесс спайкообразования становится избыточным. Образовавшиеся спайки из соединительной ткани начинают влиять на функцию органов, с которыми соприкасаются, и появляются симптомы болезни.  Если спаечный процесс затрагивает тот или иной отдел кишечника, будут симптомы нарушения его работы, иногда вплоть до нарушения проходимости. Локализация спаечного процесса в малом тазу у женщин может быть причиной деформации и непроходимости маточных труб с бесплодием.

Причины спаечной болезни

Спаечная болезнь может развиться в любом возрасте. Собственно, спаечный процесс в брюшной полости после оперативных вмешательств развивается у 20-80 % больных. Из них в 2-8 % случаев впоследствии развивается спаечная болезнь с характерными признаками. Чаще встречается у женщин – соотношение 2:1 по отношению к мужчинам. Однако в зависимости от причинной патологии соотношение изменяется. Например, спаечная болезнь после удаления аппендикса чаще бывает у женщин – 3:1.

К сожалению, спаечная болезнь нередко сопутствует хирургическим методам лечения, так как каждая операция – это травма. Врач, спасая пациента от одного смертельного заболевания, невольно способствует появлению нового заболевания. Надежду в этом плане даёт развитие лапароскопической и транслюминальной хирургии. 
  
Основным причинным фактором в образовании спаек выступает то или иное воздействие на брюшину – покров, выстилающий брюшную полость и покрывающий органы.

Геннадий Толстых рассказал: «Скорее, надо вести речь не об операциях, а о заболеваниях, которые чаще приводят к спаечной болезни брюшной полости. Основные причины – это травмы брюшной полости, когда в неё попадает кровь. Затем идут заболевания брюшной полости, сопровождающиеся воспалением брюшины, то есть перитонитом. Часто это гинекологические воспалительные заболевания. Аутоиммунные заболевания также способствуют появлению спаечной болезни брюшной полости. Также резко увеличивает риск развития спаечной болезни нагноение послеоперационной раны.

Если говорить о последствиях операций на брюшной полости, то чаще спаечная болезнь возникает после обширных вмешательств, а также после повторных операций. Раньше использовался метод процентов, согласно которому, после второго оперативного вмешательства риск появления спаечной болезни составляет примерно 20%, после трёх операций – 30%, после пяти – уже 50%.

Главная причина – это реакция организма на травмирующие факторы, кровь в брюшной полости и т.д. Конечно, влияет и бережное отношение к тканям во время операции, максимально малая травматичность её выполнения, тщательная остановка даже малейшего кровотечения. Влияют также такие факторы как наличие пареза кишечника в послеоперационном периоде или значительного повышение внутрибрюшного давления. Прогнозировать появление спаечной болезни у того или иного пациента очень трудно».

Любое вмешательство в брюшной полости, сопровождающееся её вскрытием, в той или иной степени ведёт к травмированию брюшины. Технические приёмы в ходе хирургической операции, тем более выполненные грубо, могут стать пусковым механизмом в спайкообразовании.
  
Когда же к механическому травмирующему воздействию добавляется наличие инфекции, присутствие, особенно длительное, крови в брюшной полости, воздействие воздуха на брюшину, риск появления спаек значительное возрастает. Инфекционный фактор играет большую роль, особенно неблагоприятно, если брюшина инфицируется из просвета кишечника, допустим, при его перфорации.

Кровь, попавшая в брюшную полость при операциях, травмах, и вовремя не собранная, свёртывается, образуются кровяные свёртки, которые в последствии уплотняются, подвергаются организации и становятся причиной появления спаек. Если в брюшную полость попадают те или иные инородные тела, например, во время операции, травмы, они провоцируют воспаление с образованием гранулём и спаечных соединительнотканных сращений.

Спайки как результат воспаления
  
Спаечный процесс может развиваться в результате острых или хронических воспалительных заболеваний тех или иных органов брюшной полости. Такой процесс воспалительного происхождения называется перивисцерит. В его развитии играет значение инфекционный фактор и неадекватно проводящееся лечение, в том числе нерациональная антибиотикотерапия.

Например, при хроническом воспалении желчного пузыря процесс может распространяться на сам пузырь, двенадцатиперстную кишку, деформируя их и вызывая дисфункцию, застой желчи, хроническую дуоденальную непроходимость.

Спаечный процесс в области малого таза часто возникает в связи с хроническими воспалительными заболеваниями внутренних половых органов у женщин. Это является результатом перехода острого воспаления в хроническое, что бывает в 17–20% случаев. Согласно международной классификации болезней, спаечная болезнь в области малого таза у женщин вынесена в отдельный раздел, что говорит о значимости проблемы.

Отмечается повышенная склонность к спайкообразованию у отдельных пациентов. Причину видят в присутствии аутоиммунного компонента при воспалении брюшины. В условиях повреждения брюшины тем или иным фактором в сочетании с аутоиммунным или аллергическим компонентом, воспаление затягивается дольше обычного, происходят более глубокие дистрофические изменения, нарушается равновесие ферментных систем эпителия брюшины, что замедляет процесс дезорганизации начавших образовываться спаек. Они продолжают развиваться, уплотняются, занимают большую площадь. Если у человека имеется склонность к образованию келоидных рубцов на коже после каких-то операций, травм, вероятность избыточного спайкообразования возрастает.

Проявления спаечной болезни
  
Спаечная болезнь может проявляться различными симптомами: от умеренных периодических болей в животе – до явлений острой непроходимости кишечника на разных его уровнях, когда появляется угроза жизни пациента.
  
Геннадий Толстых уточнил: «В отношении сроков появления спаечная болезнь делится на раннюю, если спайки и соответствующая клиника появляются на 3-7 день после операции и позднюю, если прошло больше месяца. Ранняя – это острая спаечная кишечная непроходимость, которая требует экстренных мер».

Часто ведущей жалобой является разнообразные боли в брюшной полости. Боль может быть постоянная или приступообразная, схваткообразная, часто без определённой локализации. Боли обусловлены наличием в самих спайках нервных элементов, а также растяжением полых органов.

При нарушении проходимости по тонкому или толстому кишечнику ощущается чувство желудочно-кишечного дискомфорта, появляются вздутие живота, урчание, потом тошнота и рвота. Задерживается отхождения газов, стула. Для спаечной болезни брюшной полости характерны повторяющиеся приступы частичной или полной кишечной непроходимости, сменяющиеся периодами нормализации состояния (ремиссии).

Периоды благополучия могут быть разными по продолжительности, иногда месяцы, а иногда и годы, если нет провоцирующих факторов, пациент соблюдает рекомендации. Провоцировать появление спаечной непроходимости могут неблагоприятные факторы, а особенно их сочетание: значительные физические усилия, погрешности в питании (значительное переедание, употребление запрещённых продуктов), кишечные инфекции, например, гастроэнтерит.

При длительном и тяжёлом течении спаечной болезни могут возникать соматогенные неврозы, которые дополнительно отягчают течение болезни и служат причиной раздражительности, неуравновешенности. Углубляются расстройства моторно-эвакуаторной функции желудочно-кишечного тракта, что приводит к тягостным симптомам, которые заставляют таких пациентов ограничивать себя в пище.

Происходит значительная потеря массы тела, иногда даже истощение. Могут обнаруживаться функциональные нарушения нервной и сердечно-сосудистой систем. Изменяются показатели обмена веществ: понижается количество в крови альбумина, общего белка, что говорит об их недостатке, ухудшается минеральный обмен.

Диагностика: методом исключения
  
Для диагностики спаечной болезни врач обязательно собирает информацию о предшествовавших операциях, заболеваниях органов брюшной полости, выясняет, были или нет послеоперационные осложнения.

«Основной способ диагностики спаечной болезни – это метод исключения. Проводится ряд обследований, которые позволяют исключить патологические состояния и заболевания, схожие со спаечной болезнью брюшной полости. В первую очередь, сюда входят заболевания, дающие похожий болевой синдром в брюшной полости – патология желчного пузыря, почек, гинекологические заболевания, хронические заболевания тонкой и толстой кишки и т.д.

Для этого выполняется комплекс обследований: УЗИ органов брюшной полости, почек, органов малого таза, колоноскопия, осмотр гинеколога, при необходимости и других смежных специалистов и т.д. Для подтверждения спаечной болезни наиболее достоверным уже более 100 лет остается рентгенологическое исследование кишечника с пассажем по нему бариевой взвеси. Определяют скорость прохождения (медленное, нормальное, ускоренное), места задержки и т.д.

Лечение спаечной болезни – консервативное: физиолечение, в первую очередь электрофорез, грязелечение, а также массаж передней брюшной стенки, регуляция стула, лечение дисбактериоза кишечника. Операция выполняется только после длительного безуспешного консервативного лечения при установленном факте тяжёлого длительного страдания больного», – рассказал эксперт.

Профилактика спайкообразования и рецидивов спаечной болезни
  
Профилактика спайкообразования должна проводиться врачами в течение операции и после неё. Но до определённой степени и сам пациент может способствовать профилактике образования спаек. Для этого необходимо выполнять назначения врача, в числе которых могут быть физиотерапевтическое лечение. Важное значение имеет массаж живота и лечебная физкультура для укрепления мышц брюшной стенки и улучшения экскурсий диафрагмы.
  
Ниже приведены упражнения с простыми приёмами самомассажа:

1. В положении лёжа на спине с руками, расположенными на животе, выполнять брюшно-диафрагмальное дыхание: при вдохе сильно выпячивать живот, при выдохе втягивать, прижимая сверху кистями рук.

2. В положении сидя с выпрямленной спиной выполнять брюшно-диафрагмальное дыхание: при вдохе – выпячивать живот, при выдохе –втягивать, производя массирующие движения руками справа налево по ходу толстого кишечника.

Людям с уже имеющимися проблемами следует строго соблюдать диетические предписания. Питаться малыми порциями, дробно, не употреблять пищу, провоцирующую газообразование в кишечнике.  Полезно периодически проводить курсами физиотерапевтические процедуры. Они должны обязательно сочетаться с режимом питания, иначе эффект будет далеко не очевидным. Следует избегать тяжелой физической работы. Запрещено применение слабительных средств. Несоблюдение рекомендаций чревато развитием спаечной кишечной непроходимости с тяжёлыми последствиями. 

Послеоперационные спайки запускаются кальциево-зависимыми мембранными мостиками между мезотелиальными поверхностями

Культура клеток

Клетки Met-5A культивировали в 10% FBS (Sigma Aldrich, # F9665), F199 (Sigma Aldrich, # M4530), 18 нг / мл EGF (R&D systems, # 236-EG), 400 нМ гидрокортизон (Sigma Aldrich, # h5001), 16 нг / мл инсулин-трансферрин-селен (Gibco, # 41400045), 10 мМ HEPES (Gibco, # 15630080) , 2,5 мг / л амфотерицин (Gibco, # 5000980), микроэлементы B (Corning, # 15343641), 50 единиц Penstrep (Gibco, # 15070063).После шока обезвоживания клетки культивировали в «аналитической среде»: 2% FBS, 10 мМ HEPES, микроэлементы B и 50 единиц Penstrep. Клетки культивировали на чашках, покрытых 2% желатином (Sigma Aldrich, # G1393). Клетки пассировали с использованием PBS и трипсин-EDTA (Sigma Aldrich, # T4049).

Стабильные клеточные линии

Клетки трансфицировали соответствующими плазмидами PiggyBac- и Helper с использованием Lipofectamine 2000 (Invitrogen, # 11668) в соответствии с инструкциями производителя. Через 48 ч среду заменяли средой, содержащей 10 нг / мл пуромицина (Tebu-Bio, # BIA-P1230).Среду через день заменяли до 2 недель отбора, после чего трансгены стабильно экспрессировались.

Первичное выделение и культивирование клеток

5 мл предварительно подогретой среды для диссоциации (среда Игла, модифицированная Дульбекко (DMEM, Life Technologies, # 10565-042), коллагеназа IV (50 мг / мл, Worthington Biochemical) и 20 мкМ CaCl 2 вводили в брюшную полость свежезабитых мышей C57BL / 6JIV дикого типа. Через 5 мин полученную суспензию клеток собирали, фильтровали через фильтр 100 мкм, центрифугировали и промывали 2% фетальной бычьей сывороткой (FBS, Sigma Aldrich. , # F9665) в PBS.Затем клетки сортировали с использованием MACS® Technology (Miltenyi Biotec). Клетки PDPN + LYVE1- CD31- CD45- культивировали в среде DMEM с добавлением 10% FBS и 50 единиц Penstrep (Gibco, # 15070063).

Измерение люциферазы и нанолюциферазы

Клетки инкубировали с ледяным буфером для лизиса люциферазы (25 мМ Tris-HCL pH 7,8, 1% Triton X-100, 15 мМ MgSO 4 , 4 мМ EGTA, 1 мМ DTT) в течение 20 мин. Оба анализа были выполнены в формате 96-луночного планшета. Субстрат люциферазы светлячков был растворен в PBS и состоял из 20 мМ Tricine, 2.67 мМ MgSO 4 , 0,1 мМ EDTA, 33,3 мМ DTT, 0,52 мМ АТФ, 0,27 мМ ацетил-КоА, 5 мМ NaOH, 50 мМ MgCO 3 и 0,47 мМ d-люциферин (Carl Roth, # CN24.3 ). Для нанолюциферазы раствор субстрата включал 47,2 мкМ целентеразина (Carl Roth, # 4094.4). Люминесценцию детектировали через 5 мин совместной инкубации субстрата и лизата с использованием модульного многомодового ридера для микропланшетов TriStar² LB 942 (Berthold Technologies).

Высокопроизводительный анализ адгезии носитель-носитель

Клетки Met-5A были засеяны вместе с микроносителями Cytodex® 3 (Sigma Aldrich, # C3275) в соотношении 500: 1 и оставлены для прилипания и роста в течение 5 дней.Затем покрытые клетками гранулы элюировали из чашки для культивирования с помощью стриптиза на 25 мл. Полученный раствор фильтровали через сетчатый фильтр для клеток 100 мкм (Corning, # 352360). Шок десикации вызывали помещением содержащего гранулы клеточного фильтра в вытяжной шкаф для работающей культуры клеток на 15 мин. После этого шарики элюировали средой для анализа и помещали в чашку для культивирования, покрытую раствором силиката НЕМА (Sigma Aldrich, # P3932), чтобы предотвратить прикрепление клеток. По истечении указанного времени комплексы носителей собирали путем их фильтрации через клеточный фильтр с размером ячеек 200 мкм, который позволяет отдельным носителям проходить, улавливая комплексы носителей.Адгезии измеряли высокопроизводительным способом с использованием клеток Met-5A, стабильно экспрессирующих люциферазу (AF23) или нанолюциферазу (AF1), с использованием пипеток Integra Viaflo.

Высокопроизводительный анализ адгезии носителя к монослою

Клетки Met-5A высевали на чашки, покрытые желатином (Sigma Aldrich, # G1393). После образования сливающегося монослоя на монослой засевали гранулы, покрытые стрессовыми клетками. Для экспериментов по ингибированию, если не указано иное, клетки предварительно обрабатывали указанным соединением в течение 30 мин в культуральной среде.После этого был проведен анализ адгезии, как описано выше.

Маркировка микроносителя

Микроноситель Cytodex3 окрашен либо эфиром Alexa Fluor 488 NHS (Thermo; A20000), либо сложным эфиром NHS Alexa Fluor 568 (Thermo; A20003) в соответствии с инструкциями производителя. Меченые микроносители интенсивно промывали полной средой и использовали, как описано выше.

Анализ передачи Cre-exchange

Клетки Met-5A, стабильно экспрессирующие Cre-рекомбиназу (AF32), высевали на гранулы микроносителя Cytodex® 3 (Sigma Aldrich, # C3275) и подвергали шоку обезвоживания, как описано, и помещали в Met- 5A монослой, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34).Люминесценцию нанолюциферазы измеряли через 48 ч. Это представляет собой начальную передачу, зависящую от напряжения.

Клетки Met-5A дикого типа затем высевали на монослой, подвергали шоку иссушения и помещали вместе с покрытыми нестрессовыми клетками гранулами, которые стабильно экспрессируют рекомбиназу Cre (AF32) в течение 3 часов. Затем носители отделяли от монослоя и помещали на нестрессированный монослой Met-5A, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34). Люминесценцию нанолюциферазы измеряли через 48 ч.Это первая трансмиссия, не зависящая от напряжений.

Гранулы, покрытые клетками дикого типа, затем подвергали шоку иссушению и высевали на нестрессированный монослой Met-5A дикого типа в течение 3 часов. Затем носители отделяли от монослоя и помещали на покрытые ненапряженными клетками гранулы, стабильно экспрессирующие Cre-рекомбиназу (AF32), в течение 3 часов. Затем носители снова выделяли и помещали на нестрессированный монослой Met-5A, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34).Люминесценцию нанолюциферазы измеряли через 48 ч. Это вторая передача, независимая от напряжений.

Эта процедура была продолжена аналогично для третьей и четвертой передачи подряд.

Анализ распространения адгезии

Клетки Met-5A, стабильно экспрессирующие нанолюциферазу (AF1), высевали на гранулы микроносителя Cytodex® 3 (Sigma Aldrich, # C3275) и подвергали шоку высыхания, как описано, и помещали на Met- 5А монослой. Через 24 ч несвязанные носители смывали и измеряли люминесценцию нанолюциферазы.Это представляет собой начальную передаваемую адгезию, зависящую от напряжения.

Клетки Met-5A дикого типа затем высевали на монослой, подвергали шоку обезвоживания и помещали вместе с покрытыми ненапряженными клетками гранулами, которые стабильно экспрессируют нанолюциферазу (AF1) в течение 3 часов. Затем носители отделяли от монослоя и помещали на ненапряженный монослой Met-5A дикого типа. Через 24 ч несвязанные шарики смывали и измеряли люминесценцию нанолюциферазы. Это первая переданная адгезия, не зависящая от напряжения.

Гранулы, покрытые клетками дикого типа, затем подвергали шоку иссушению и высевали на нестрессированный монослой Met-5A дикого типа в течение 3 часов. Затем носители отделяли от монослоя и помещали на покрытые ненапряженными клетками гранулы, стабильно экспрессирующие нанолюциферазу (AF1), на 3 часа. Затем носители снова выделяли и помещали на нестрессированный монослой Met-5A, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34). Затем несвязанные шарики смывали и через 24 часа измеряли люминесценцию нанолюциферазы.Это представляет собой вторую передающуюся адгезию, не зависящую от напряжения.

Эта процедура была продолжена аналогично для третьей и четвертой передачи подряд.

Анализ силы отделения клеток вращающимся диском

Протокол, используемый для измерения сил отделения клеток, был адаптирован из 36 . Вкратце, клетки Met-5A, стабильно экспрессирующие нанолюциферазу, высевали на стеклянные предметные стекла, покрытые желатином (Sigma Aldrich, # G1393). Через 2 дня клетки подвергали стрессу, как описано выше, и затем выращивали еще 24 часа.Затем слайды вращали, лизировали и измеряли активность нанолюциферазы. Для исходных значений силы отслоения клеток выражали относительно значений нанолюциферазы, полученных из лизированного невращающегося предметного стекла, на котором клетки выращивали до слияния. Для отделения носителя от монослоя тот же протокол выполняли с монослоем клеток Met-5A, засеянным на покрытые желатином стеклянные предметные стекла, на которые были добавлены шарики микроносителя Cytodex® 3, покрытые Met-5A (Sigma Aldrich, # C3275), стабильно экспрессирующие нанолюциферазу.Чтобы получить значимые значения с точки зрения генерируемых сил, использовались значения, как описано в таблице 1.1 36 , которая описывает взаимосвязь между скоростью вращения и напряжением сдвига стенки для ряда радиальных положений поперек вращающегося диска (от оси вращения).

siRNA-опосредованный нокдаун

RNAi-опосредованный нокдаун выполняли в соответствии с протоколом трансфекции малой интерферирующей РНК (siRNA) производителя (Santa Cruz). Вкратце, мезотелиальные клетки трансфицировали указанными миРНК на 3-й день при совместном культивировании с микроносителями.Анализ адгезии in vitro проводили, как описано выше.

Препарат ткани мыши для визуализации

После иссечения органов органы фиксировали в течение ночи при 4 ° C в 2% формальдегиде. На следующий день фиксированные ткани промывали трижды в фосфатно-солевом буфере Дульбекко (PBS) (DPBS, GIBCO, # 14190-094) и, в зависимости от цели, погружали, замораживали в соединении OCT (Sakura, # 4583) и хранили. при -20 ° C или хранить при 4 ° C в PBS, содержащем 0,2% желатина (Sigma Aldrich, # G1393), 0.5% Тритон X-100 (Sigma Aldrich, # X100) и 0,01% тимеросал (Sigma Aldrich, # T8784) (PBS-GT).

Трехмерная визуализация образцов ткани целиком

Образцы целиком окрашивали и очищали с помощью модифицированного протокола 3DISCO 37 . Короче говоря, образцы, хранящиеся в PBS-GT, инкубировали с первичными антителами в PBS-GT при встряхивании в течение 36 часов при комнатной температуре. Избыток антител удаляли путем тщательной промывки в PBS-GT в течение 6–12 часов и обновления раствора каждые 1–2 часа. Инкубация с вторичными антителами, связанными с флуорофором (молекулярные зонды) в PBS-GT в течение 36 часов, сопровождалась тщательной промывкой в ​​PBS-GT, как описано выше.При необходимости образцы дегидратировали в восходящей серии тетрагидрофурана (Sigma, # 186562) (50%, 70%, 3 × 100%; 60 минут каждый), а затем очищали дихлорметаном (Sigma, # 270997) в течение 30 минут, а затем погружают в бензиловый эфир (Sigma, # 108014). Непрозрачные образцы получали в 35-миллиметровых чашках со стеклянным дном (Ibidi, # 81218) с использованием лазерного сканирующего конфокального микроскопа (Zeiss LSM710) или многофотонного микроскопа SP8 (Leica). Очищенные образцы визуализировали при погружении в бензиловый эфир с помощью светового флуоресцентного микроскопа (LaVision BioTec).

3D многофотонная визуализация

Для многофотонной визуализации образцы были залиты 4% -ным раствором агарозы NuSieve GTG (Lonza, # 50080). Визуализацию выполняли с помощью объектива с 25-кратным погружением в воду (HC IRAPO L 25 × / 1,00 Вт), соединенного с настраиваемым импульсным лазером (Spectra Physics, Insight DS +). Изображения с многофотонным возбуждением регистрировались внешними нерассканированными гибридными фотодетекторами (HyD). Для обнаружения использовались следующие полосовые (BP) фильтры: HC 405/150 BP для DAPI / Hoechst и генерации второй гармоники (SHG), ET 525/50 BP для зеленого канала, 585/40 BP для красного канала и 650 / 50 BP (пурпурный) для дальнего красного.Плитки были объединены с использованием пакета приложений Leica Application Suite X (v3.3.0, Leica) с плавным перекрытием, а данные были визуализированы с помощью программного обеспечения Imaris (v9.1, Bitplane).

Трехмерная визуализация светового листа

При погружении в бензиловый эфир образцы освещались с двух сторон плоским световым листом с использованием лазера белого света (SuperK Extreme EXW-9; NKT Photonics). EdU и PDPN возбуждали при 640/30 и 576/23 нм соответственно, а испускаемый свет детектировали с использованием фильтров 690/50 и 620/31 нм.Оптические срезы регистрировались перемещением камеры образца вертикально с шагом 5 мм через лазерный световой лист. Трехмерные реконструкции были получены с использованием программного обеспечения Imaris imaging (v9.1, Bitplane).

Сканирующая электронная микроскопия

Клетки Met-5A высевали на гранулы микроносителя Cytodex® 3 (Sigma Aldrich, # C3275) и подвергали воздействию высыхания, как описано. Затем покрытые клетками шарики добавляли к клеткам Met-5A, засеянным на стеклянных предметных стеклах, покрытых желатином (Sigma Aldrich, # G1393), и через указанные временные точки стеклянные предметные стекла фиксировали O / N при 4 ° C с использованием 3% глутаральдегида и 0.1% буфер какодилата натрия, pH 7,4 (Электронная микроскопия, № 16538). Для тканей животных спайки индуцировали у мышей, как описано, и умерщвляли через 16 часов. Затем брюшину фиксировали таким же образом, как и на предметных стеклах. Образцы были обезвожены в последовательном разбавлении этанола и высушены методом критической точки с использованием CO 2 в качестве переходной жидкости (Polaron Critical-Point Dryer CPC E3000; Quorum Technologies, Ringmer, UK). Образцы покрывали напылением слоем платины 7 нм с помощью устройства для распыления (Emitech K575; Quorum Technologies) и наблюдали с помощью сканирующей электронной микроскопии (JSM 6300F; JEOL, Eching, Германия).

Конфокальная 3D-визуализация с коэффициентом отражения

Изображения с отражательной микроскопии были записаны с помощью микроскопа Leica SP8 с использованием зеленого твердотельного лазера (552 нм). Конфокальные изображения были получены с отверстием размером 44,7 мкм, а сигнал отражения был получен от 547 до 555 нм с использованием ФЭУ (Hamamatsu R 9624). Z -стаки (интервалы 1 мкм) регистрировались каждые 5 мин. Изображения обрабатывались с помощью LAS X (Leica; v3.6.0) и Imaris (Bitplane; v9.3.0), а яркость и контраст были отрегулированы для оптимальной визуализации.

2D-визуализация срезов тканей мыши и человека

Фиксированные ткани были встроены в оптимальную температуру резки (OCT) и разрезаны с помощью Microm HM 525 (Thermo Scientific). Для анализа использовались сагиттальные сечения 7 мкм. Короче говоря, срезы фиксировали в ледяном ацетоне в течение 5 минут при -20 ° C, а затем промывали PBS. Затем срезы блокировали для неспецифического связывания 1% BSA и 5% козьей сыворотки в PBS в течение 60 мин при комнатной температуре, а затем инкубировали с первичными антителами в 1% BSA и 5% козьей сыворотке в PBS, O / N при 4 ° С.На следующий день после промывания срезы инкубировали в PBS с флуоресцентным вторичным антителом в течение 120 мин при комнатной температуре. Наконец, срезы промывали и инкубировали с красителем нуклеиновой кислоты Hoechst 33342 (Invitrogen, # h2399), промывали в ddH 2 O, устанавливали с Fluoromount-G® (Southern Biotech, # 0100-01) и хранили при 4 ° C. во тьме.

Окрашивание трихромом по Массону

Для визуализации отложенного матрикса было выполнено окрашивание трихромом по Массону (Sigma Aldrich, # HT15). Вкратце, образцы фиксировали в течение 10 минут в ледяном ацетоне при -20 ° C, а затем промывали в dH 2 O в течение 5 минут.Затем образцы инкубировали в течение ночи в растворе Буэна (Sigma Aldrich, # HT10132) при комнатной температуре и на следующий день промывали проточной водопроводной водой в течение 5 минут. Затем образцы погружали в раствор гематоксилина железа Вейгерта (Sigma Aldrich, # HT1079) на 3 минуты и снова промывали проточной водопроводной водой в течение 5 минут. Образцы инкубировали с раствором фуксина алой кислоты Брибриха в течение 5 минут, промывали в dH 2 O и инкубировали с раствором фосфорновольфрамовой / фосфомолибденовой кислоты в течение 5 минут.Наконец, образцы погружали в раствор анилинового синего на 10 мин, промывали 1% уксусной кислотой в течение 2 мин и затем промывали dH 2 O, а затем дегидратировали в градиенте этанола. Затем образцы погружали 8-10 раз и очищали в Roti®-Histol (Carl Roth, # 6640) и закрепляли с помощью Roti®-Histokitt (Carl Roth, # 6638).

Визуализация покрытых Met-5A комплексов носитель-носитель

Комплексы носитель-носитель фиксировали в 4% PFA в PBS в течение 20 минут при комнатной температуре. После этого комплексы дважды промывали PBS.Клетки пермеабилизировали в течение 10 минут в 0,1% Triton X-100 (Sigma Aldrich, # X100) в PBS при 4 ° C, после чего их дважды промывали 0,02% Tween-20 (Sigma Aldrich, # 9416) в PBS. Затем носители блокировали для неспецифического связывания 5% BSA и 0,02% Tween-20 в PBS в течение 60 мин при 4 ° C на качающейся платформе, а затем инкубировали с первичным антителом в 0,02% Tween-20 в PBS O / N. при 4 ° C. На следующий день после отмывки носители инкубировали в PBS с флуоресцентным вторичным антителом в течение 120 мин при 4 ° C на качающейся платформе.Наконец, носители промывали и инкубировали с окрашиванием нуклеиновой кислоты Hoechst 33342 (Invitrogen, # h2399).

Визуализация образцов Met-5A от носителя к монослою

Для образцов от носителя к монослою Клетки Met-5A, высеянные на предметные стекла, покрытые желатином (Sigma Aldrich, # G1393). Образцы фиксировали 4% PFA в PBS в течение 20 мин при комнатной температуре. Клетки пермеабилизировали в течение 10 минут в 0,1% Triton X-100 (Sigma Aldrich, # X100) в PBS при 4 ° C, после чего их дважды промывали 0,02% Tween-20 (Sigma Aldrich, # 9416) в PBS.Затем предметные стекла блокировали для неспецифического связывания 5% BSA и 0,02% Tween-20 в PBS в течение 60 мин при 4 ° C, а затем инкубировали с первичным антителом в 0,02% Tween-20 в PBS O / N при 4 ° C. . На следующий день после отмывки носители инкубировали в PBS с флуоресцентным вторичным антителом в течение 120 мин при 4 ° C. Наконец, предметные стекла промывали и инкубировали с окрашиванием нуклеиновой кислотой Hoechst 33342 (Invitrogen, # h2399).

Мечение мембранным красителем микроносителей и монослойных культур

Клетки Met-5A метили окрашивающим раствором DiO (Invitrogen, # V22886) в соответствии с инструкциями производителя и высевали в виде монослоя на стекло, покрытое желатином (Sigma Aldrich, # G1393). камеры (Там же, №80287).После 3 дней культивирования отдельную популяцию клеток засевали вместе с микроносителями Cytodex® 3 (Sigma Aldrich, # C3275) и метили с использованием набора PKh36 Red Fluorescent Cell Linker kit (Sigma Aldrich, # MINI26-1KT). Затем покрытые клетками гранулы подвергали шоку иссушению, как описано, и добавляли к монослойной культуре.

Мечение микроносителей первичными мезотелиальными клетками

Микроносители Cytodex3 окрашивали либо эфиром Alexa Fluor 488 NHS (Thermo Scientific, # A20000), либо эфиром Alexa Fluor 568 NHS (Thermo Scientific, # A20003) в соответствии с инструкциями производителя.

Предварительная обработка изображений

Вся обработка изображений и анализ выполнялись с экспортированными изображениями Tif с использованием Fiji (ImageJ 2.0.0 /1.52c, США). Флуоресцентные каналы были разделены, а яркость и контраст были отрегулированы для уменьшения фона, чтобы предотвратить неправильную интерпретацию фона как клеточные структуры на этапе сегментации.

Предварительная обработка изображения: сегментация

Анализ протрузии мезотелия был выполнен с использованием плагина Advanced weka segmentation Fiji 38 .Он использует набор алгоритмов машинного обучения для сегментации. В частности, сегментация на основе пикселей основана на функциях изображения, аннотированных для разных классов. Образцы пикселей были нарисованы бесплатно и отнесены к соответствующим классам, например, «филоподии», «тело клетки» или «фон». Последующие раунды обучения были выполнены, чтобы выделить соответствующие пиксели и структуры в соответствующие классы для улучшения сегментации. Функции обучения, такие как «Размытие по Гауссу», «фильтр Собеля», «Гессиан», «Разница гауссианов» и «Мембранные проекции», были применены вместе с классификатором по умолчанию «Быстрый случайный лес».Остальные настройки оставлены по умолчанию (толщина мембраны 1, размер участка мембраны 19, минимальная сигма 1,0 и максимальная сигма 16,0). Обученный классификатор и данные были сохранены для анализа других наборов данных «стресс» и «стресс» мезотелия. Был написан макрос для автоматизации вышеуказанных шагов для других наборов данных с паузой на 5 секунд (функция ожидания (5000)) после каждого шага для плавной обработки. Изображения из сегментированных классов были извлечены и подвергнуты постобработке.

Постобработка изображения: общая площадь поверхности филоподий

Для количественной оценки общей площади поверхности филоподий были получены сегменты филоподий, как описано в разделе «Сегментация».Яркость и контраст были отрегулированы по этим изображениям и преобразованы в двоичные изображения. Затем вычисляли среднюю интенсивность флуоресценции.

Постобработка изображения: длина и ширина филоподий

Длина и ширина филоподий рассчитывались с помощью плагина ImageJ «Ridge detection» 39 . Короче говоря, филоподиальные сегменты были получены, как описано в разделе «Сегментация». Были выбраны параметры «Правильное положение», «оценка ширины», «удлинение линии», «отображение результатов» и «добавить в менеджер».Используемые параметры включали необязательные параметры (ширина линии: 10, высокая контрастность: 230, низкая контрастность: 87) и обязательные параметры (сигма: 3,39, нижний порог: 0,51, верхний порог: 1,19, минимальная длина строки: 15,00). Параметры были оптимизированы с использованием функции предварительного просмотра для одного набора данных, а аналогичные значения и настройки были применены для других наборов данных. Значения длины и ширины были извлечены из сводной вкладки и экспортированы в виде файла Excel.

Мечение EdU in vivo

Животных вводили внутрибрюшинно 1 мкг EdU (Invitrogen, # A10044), растворенного в 100 мкл PBS, в день операции и умерщвляли на 5 день.После удаления органа и фиксации в течение ночи в 2% формальдегиде EdU визуализировали с помощью набора для визуализации Click-iT ™ EdU Alexa Fluor ™ 647 (Invitrogen, # C10340) в соответствии с инструкциями производителя. Реакционный коктейль Click-iT® инкубировали с образцами в течение 36 часов при комнатной температуре, чтобы обеспечить достаточное проникновение в ткань. Затем ткани подвергались дальнейшей обработке в соответствии с протоколом визуализации всего образца (см. «Трехмерное изображение образцов ткани целого образца»).

Локальное лечение местной целлюлозой

Низкомолекулярные ингибиторы солюбилизировали в стерильной 2% гидроксиэтилцеллюлозе (Sigma Aldrich, № 09368).Соединения добавляли непосредственно перед операцией и получали из 100–150 мМ исходного раствора для минимизации конечного содержания ДМСО. Конечный раствор (200 мкл на 30 г веса тела) помещали между висцеральным и париетальным слоями поврежденной слепой кишки и брюшины соответственно.

Животные

Все эксперименты на животных проводились в соответствии со строгими правительственными и европейскими директивами и были одобрены местным правительством административного региона Верхняя Бавария под лицензией № 55.2-1-54-2532-150-2015. Свободные от патогенов самцы и самки мышей C57BL / 6 (в возрасте 6–10 недель) были получены из Charles River и помещены в группы в помещениях с контролируемым климатом с циклом 12 часов / 12 часов свет / темнота. Животным давали пищу и воду ad libitum.

Rosa26 mTmG или Rosa26 tm1 (DTA) Lky , скрещенные с мышами Procr CreERT2-IRES-tdTomato , использовались в этом исследовании (Jackson Laboratories). Для экспериментов по отслеживанию клонов, проведенных у взрослых мышей в течение 6-8 недель, животные получали три внутрибрюшинных инъекции (Z) -4-гидротамоксифена (Sigma Aldrich, # H7904, 2 мг на 25 г веса тела, разведенного в 100 мкл кукурузного масла (Sigma Aldrich, # C8267)) через день, чтобы вызвать активацию рекомбиназы Cre.Для селективного удаления мезотелиальных клеток PROCR + животным однократно вводили (Z) -4-гидротамоксифен (Sigma Aldrich, # H7904, 2 мг на 25 г веса тела, разведенный в 100 мкл кукурузного масла (Sigma Aldrich, # C8267)). сразу после операции перед закрытием живота.

Модель адгезии мышей

Мышей анестезировали внутрибрюшинной инъекцией коктейля медетомидина (500 мкг / кг), мидазолама (5 мг / кг) и фентанила (50 мкг / кг), далее называемого MMF. Глубина анестезии оценивалась по рефлексу пальцев стопы.Глаза были покрыты бепантеном, чтобы избежать обезвоживания, а брюшная полость была выбрита и продезинфицирована бетадином и стерильным PBS. Животных держали на спине на нагревательной пластине при 37 ° C. Лапаротомия по средней линии (1–1,5 см) выполнялась через кожу и брюшину. Четыре крючка, расположенные вокруг разреза и прикрепленные к ретрактору и магнитной опорной пластине, обеспечивали свободный доступ в брюшную полость. С помощью небольшой хирургической щетки аккуратно очистили поверхность брюшины и приложили поверхность слепой кишки.Затем через серозную поверхность брюшины накладывали два хирургических узла с использованием шелковых швов 4-0 (Ethicon). С помощью ватного тампона осторожно нанесли немного талька (Sigma Aldrich, № 243604) на поврежденные поверхности. Перед закрытием разреза пипеткой в ​​брюшную полость вводили бупренорфин (0,1 мг / кг), чтобы обеспечить начальную послеоперационную анальгезию. Для длительного обезболивания ежедневно вводили метамизол (новалгин, 200 мг / кг). Брюшину и кожу закрывали двумя отдельными шелковыми нитями 4-0 (Ethicon).После закрытия разреза мышей разбудили антагонистическим воздействием на раствор MMF путем подкожной коктейльной инъекции атипамезола (1 мг / кг) и флумазенила (0,25 мг / кг). Мышам давали возможность восстановиться на грелке, после чего их помещали вместе (самки) или по отдельности (самцы) и наблюдали в течение 1–5 дней. Спайки оценивали с использованием общих морфологических признаков, указывающих на развитие спаек. Оценивали пять индивидуальных характеристик адгезии (см. Дополнительную таблицу 1), которые вместе давали совокупное значение, определяющее общую оценку адгезии.В этой системе полное отсутствие спаек было оценено как 0, тогда как максимальная оценка адгезии составила 15.

Ткань человека

Все образцы человека были взяты во время хирургического вмешательства в отделении хирургии, Klinikum rechts der Isar, Технический университет Мюнхена. , после одобрения местного этического комитета Технического университета Мюнхена, Германия (№ 173/18 S). Спайки были диагностированы во время операции, иссечение соответствующих органов было подготовлено для дальнейшего анализа.Информированное согласие было получено от всех субъектов после операции.

Секвенирование одноклеточной РНК (Drop-seq)

Клетки Met-5A выращивали в культуре и подвергали стрессу в течение 15 мин путем высушивания. Затем в указанные моменты времени образцы инкубировали в течение 5 минут в растворе трипсин-ЭДТА при 37 ° C. Трипсин инактивировали ледяной средой для анализа, и клетки дважды промывали ледяным PBS. Эксперименты drop-seq выполняли, как описано ранее 20,21 , с небольшими изменениями во время подготовки одноклеточной библиотеки.Вкратце, отдельные клетки разбавляли PBS с добавлением 0,04% бычьего сывороточного альбумина до конечной концентрации 100 клеток / мкл. Используя микрожидкостное устройство PDMS (Nanoshift), отдельные клетки совместно инкапсулировали в капли с гранулами со штрих-кодом (Chemgenes Corporation, Wilmington, MA) до конечной концентрации 120 гранул / мкл. Капли собирали в течение 15 мин / образец. После разрушения капель гранулы собирали, промывали и готовили для обратной транскрипции мРНК на гранулах (Maxima RT, Thermo Fisher).После обработки экзонуклеазой I (New England Biolabs) для удаления неиспользованных праймеров гранулы были подсчитаны, разделены на аликвоты (2000 шариков на реакцию, что составляет ~ 100 клеток на реакцию) и предварительно амплифицированы с помощью 13 циклов ПЦР (праймеры, химия и условия цикла идентичны ранее описанным в Macosko et al., 20 ). Продукты ПЦР объединяли и дважды очищали с использованием 0,6x очищающих гранул (CleanNA). Перед тегированием образцы кДНК загружали на высокочувствительный чип ДНК на биоанализаторе 2100 (Agilent), чтобы гарантировать целостность, чистоту и количество транскрипта.Для каждого образца 1 нг предварительно амплифицированной кДНК из примерно 1000 клеток был помечен Nextera XT (Illumina) с помощью специального праймера P5 (Integrated DNA Technologies). Одноклеточные библиотеки секвенировали в прогоне с парными концами 100 п.н. на Illumina HiSeq4000 с использованием денатурированного образца 0,2 нМ и 5% -ного добавочного PhiX. Для праймирования чтения 1 использовали 0,5 мкМ Read1CustSeqB (последовательность праймера: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC).

Биоинформатическая обработка данных секвенирования одноклеточной РНК

Основной вычислительный конвейер Drop-seq использовался для обработки считывания секвенирования следующего поколения данных scRNA-seq, как описано ранее 20 .Вкратце, STAR (версия 2.5.2a) использовался для отображения 40 . Считывания были сопоставлены с эталоном генома hg19 (предоставленным Drop-seq group, GSE63269). Для фильтрации штрих-кодов мы исключили штрих-коды, в которых обнаружено менее 200 генов. Высокая доля (> 10%) количества транскриптов, полученных из генов, кодируемых митохондриями, может указывать на низкое качество клеток, и мы удалили эти неквалифицированные клетки из последующего анализа. После получения матрицы данных DGE мы использовали Сера для уменьшения размерности, кластеризации и анализа дифференциальной экспрессии генов 20 .

Анализ главных компонентов

Используя только вариабельные гены, был проведен анализ главных компонентов (PCA). 15 основных компонентов использовались в качестве входных данных для функции Seurat FindClusters с разрешением 0,5. Этот метод выполняет кластеризацию ячеек, встраивая их в графоподобную структуру. Используется граф ближайших соседей k , в котором любые две ячейки (представленные как узлы), соединенные ребром, имеют вес ребра, который находится среди наименьших расстояний k от первого узла до любого другого.Таким образом, между клетками с похожими паттернами экспрессии генов проводятся границы. Методы оптимизации модульности, такие как алгоритм Лувена, пытаются выявить части графа с различной связностью и, следовательно, разделить граф на отдельные взаимосвязанные модули.

Метод абстракции графа на основе разделов

Для визуализации результата кластеризации многомерных данных с одной ячейкой был использован алгоритм Фрухтермана-Рейнгольда из набора инструментов Python Scanpy 41 .Кроме того, для отображения связи между группами ячеек был использован метод абстракции графа на основе разделов (PAGA) 41 . Клетки были сгруппированы в соответствии с моментом извлечения. На графике эти группы представлены как узлы, а ребра между узлами показывают взаимосвязь или родство этих групп, таким образом оценивая их сходство в отношении различий в экспрессии генов.

Анализ путей с временным разрешением

Для прогнозирования активности путей и клеточных функций на основе наблюдаемых изменений экспрессии генов мы использовали платформу анализа путей Ingenuity® (IPA®, QIAGEN Redwood City, www.qiagen.com/ingenuity), как описано ранее 42 . В анализе используется набор алгоритмов и инструментов, встроенных в IPA, для вывода и оценки сетей регуляторов перед данными об экспрессии генов на основе крупномасштабной причинно-следственной сети, полученной из базы знаний Ingenuity Knowledge Base. Используя «Анализ нижестоящих эффектов» 43 , встроенный в IPA, мы стремились идентифицировать те биологические процессы и функции, которые, вероятно, могут быть причинно затронуты усиленными и пониженными генами в наборе данных транскриптомики одиночных клеток.В нашем анализе мы рассматривали гены с перекрывающимся значением P > 7 (log10), которые имели оценку активации Z > 2, как активированные, а гены с оценкой активации Z <-2 как ингибированные.

Статистика и воспроизводимость

Все данные представляют собой среднее значение ± SEM. Тест Шапиро-Уилка ( p > 0,05), а также визуальная проверка соответствующих гистограмм, нормальных графиков Q – Q и коробчатых диаграмм были использованы для проверки того, были ли образцы распределены нормально (приблизительно), с использованием IBM SPSS Statistics версии 23.Сравнение двух групп проводилось с использованием непарного теста Стьюдента t для нормально распределенных данных или теста Манна-Уитни U в качестве непараметрического эквивалента. Сравнение между тремя или более группами проводилось с использованием одностороннего дисперсионного анализа с последующим апостериорным тестом Тьюки для нормально распределенных данных или с тестом Краскела – Уоллиса H для ненормально распределенных данных. Статистически значимым считалось значение p <0,05, где * p <0.05, ** p <0,01 и *** p <0,001. Анализы выполняли с помощью GraphPad Prism версии 6 (GraphPad Software, Inc.). График направленности / полярных координат был выполнен с использованием библиотеки «ggplot2» № 1234 в R # 5678, версия 3.4.1, 2 44,45 . Все эксперименты были повторены не менее трех раз независимо с аналогичными результатами.

Сводка отчетов

Дополнительная информация о дизайне исследований доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Что такое кишечная непроходимость | Johns Hopkins Medicine

Непроходимость кишечника означает, что что-то блокирует ваш кишечник. Пища и стул могут не двигаться свободно.

Когда кишечник работает нормально, переваренная пища перемещается из желудка в прямую кишку. Постепенно ваше тело расщепляет пищу на части, которые можно использовать, а остальную часть превращает в фекалии (кал). В конечном итоге вы устраняете его через дефекацию.

Кишечная непроходимость может частично или полностью блокировать этот естественный процесс.Полная закупорка требует немедленной медицинской помощи.

Среди множества возможных причин кишечной непроходимости:

  • Спайки брюшной полости. Это разрастания тканей в виде полос, которые могут сдвинуть кишечник с места.

  • Грыжа. Грыжа — это трещина в мышечной стенке живота. Грыжи могут вызвать выпуклости и карманы. Они могут заблокировать ваш кишечник.

  • Заворот .Заворот возникает, когда часть вашего кишечника скручивается вокруг себя. Это создает засор.

  • Инвагинация. Это состояние означает, что сегмент вашего кишечника переходит в другой сегмент. Это сужает, но может не блокировать ваш кишечник.

  • Рубцевание. Когда ваше тело заживает небольшие порезы (раны), образуется рубцовая ткань. Это может произойти и в кишечнике. Эти шрамы могут накапливаться и вызывать частичную или полную закупорку кишечника.Рубцы могут возникнуть в результате разрыва стенки кишечника, живота (брюшной полости) или хирургии органов малого таза, а также инфекций.

  • Воспалительное заболевание кишечника. Болезнь Крона и язвенный колит — два примера.

  • Дивертикулит . Крошечные мешочки (дивертикулы) могут расти на слизистой оболочке толстой кишки. Они могут воспалиться.

  • Опухоли. Наросты могут быть злокачественными или безвредными (доброкачественными).В любом случае они могут полностью или частично заблокировать ваш кишечник.

  • Посторонние предметы. Непищевые предметы, которые вы случайно или намеренно проглатываете, могут вызвать частичную или полную кишечную непроходимость.

  • Дивертикул Меккеля. Около 2 из 100 человек рождаются с этим дополнительным мешочком внутри кишечника.

Симптомы

Симптомы кишечной непроходимости:

  • Сильная боль в животе

  • Сильные спазмы в животе

  • Рвота

  • Чувство распирания или вздутия в животе

  • Громкие звуки из живота

  • Ощущение газообразования, но неспособность пропускать газ

  • Запор (невозможность дефекации)

Кто в группе риска

Вы можете подвергнуться риску кишечной непроходимости, если у вас есть:

  • Абдоминальная хирургия.Это может увеличить риск образования рубцовой ткани или других новообразований. Они также увеличивают риск возникновения грыж.

  • Дивертикулез. Это состояние означает, что что-то раздражает слизистую оболочку кишечника. Это может вызвать воспаление, инфекцию и рубцевание, что может привести к закупорке.

  • Рак

  • Воспалительное заболевание кишечника

  • Проглоченные посторонние предметы

  • Хронический запор

Диагностика

Чтобы диагностировать ваше состояние, ваш лечащий врач рассмотрит ваше общее состояние здоровья и историю болезни.Он или она спросит вас о ваших симптомах. Сообщите своему врачу, где ваша боль и насколько она сильна. Также сообщите своему врачу, если у вас были изменения в дефекации или аппетите. Сообщите своему врачу, если у вас есть другие необычные симптомы, такие как звуки пищеварения или ощущение вздутия живота.

Ваш врач проведет медицинский осмотр. Вам также могут потребоваться определенные тесты. Сюда могут входить:

  • Рентген брюшной полости

  • Исследование с контрастированием с барием

  • КТ

  • МРТ

  • Контрастная рентгеноскопия

Лечение

Лечение, рекомендованное вашим лечащим врачом, будет зависеть от того, что вызывает закупорку.Для простой закупорки вам может потребоваться только жидкость и никаких твердых веществ. Ваш врач будет работать, чтобы исправить любые проблемы с обменом веществ. У вас может быть кишечная декомпрессия. Обычно это делается с помощью назогастрального зонда. Вы также можете отдохнуть от кишечника.

Если у вас более сложная кишечная непроходимость, вам немедленно понадобится операция. Это может быть из-за разрыва (перфорации) кишечника или проблем с кровотоком. Вам также может потребоваться операция, если другие методы лечения не устранят закупорку.Цель состоит в том, чтобы удалить закупорку и восстановить ваши органы.

Ваш врач также может порекомендовать использовать небольшую гибкую трубку, чтобы кишечник оставался открытым, вместо более инвазивной хирургии.

Осложнения

Осложнения — это проблемы, вызванные вашим состоянием. Осложнения кишечной непроходимости включают:

Профилактика

Спайки брюшной полости, возникающие после операции, можно предотвратить, если ваша медицинская бригада примет определенные меры. Сюда входит поддержание места разреза влажным, а не сухим.Заранее обсудите, какие шаги ваша медицинская бригада может предпринять, чтобы снизить риск спаек после операции.

Когда звонить врачу

Немедленно обратитесь за медицинской помощью, если у вас есть симптомы кишечной непроходимости. К ним относятся сильная боль в животе, рвота и невозможность дефекации.

Как справиться с этим состоянием или жить с ним

Следуйте инструкциям врача. Если он или она посоветовали вам изменить диету в рамках лечения, придерживайтесь нового плана.Цель диеты — уменьшить нагрузку на пищеварительный тракт, но при этом обеспечить вам необходимое питание.

Новое диагностическое средство для обнаружения внутрибрюшных спаек с передней брюшной стенкой с помощью динамической магнитно-резонансной томографии

Введение . Спайки брюшной полости могут вызвать серьезные осложнения и осложнить последующие операции. Их диагноз часто исключается из-за отсутствия надежной неинвазивной диагностической техники.Ниже описывается разработка и тестирование подходящей методики. Метод . Во время дыхания происходит плавное висцеральное скольжение между содержимым брюшной полости и стенками брюшной полости. Мы описываем метод, включающий сегментацию изображения и регистрацию для расчета сдвига в качестве аналога висцерального слайда, основанного на отслеживании структур на протяжении дыхательного цикла. Наличие адгезии объясняется сопротивлением висцеральному скольжению, что приводит к заметному снижению сдвига.Движение живота из-за дыхания фиксируется на сагиттальных динамических МРТ-изображениях. Результатов . Для анализа были выбраны клинические изображения, в том числе пациента с хирургически подтвержденной адгезией. Заметное уменьшение сдвига наблюдалось в месте адгезии, в то время как у здоровых добровольцев наблюдался постоянный, постепенно изменяющийся сдвиг. Заключение . Этот метод и его валидация показывают обнадеживающие результаты для обнаружения адгезии, но теперь требуется более крупное исследование, чтобы подтвердить его потенциал.

1. Введение

Спайки брюшной полости — это патологические образования фиброзной рубцовой ткани, которые связывают или сращивают структуры брюшной полости. Как осложнение абдоминальной хирургии они могут быть причиной серьезных заболеваний и осложнять последующие операции. Сочетание неспецифических симптомов и отвращения к ненужному хирургическому вмешательству приводит к консервативной стратегии ведения пациента, которая часто не помогает справиться с основным заболеванием. Хирургические процедуры (лапароскопия, лапаротомия) в настоящее время являются единственным надежным способом определить, есть ли у пациента спайки, но такое вмешательство может вызвать дальнейшие спайки.Таким образом, неинвазивный диагностический метод будет неоценимым для эффективного ведения пациентов и уменьшения хирургических осложнений.

Во время дыхательного цикла содержимое брюшной полости плавно скользит по границам брюшной полости (брюшная стенка и т. Д.) — процесс, называемый висцеральным скольжением. Хотя отсутствие или нарушение висцерального скольжения считается показателем спаек, в литературе очень мало количественных попыток измерения висцерального скольжения [1–3].Использование динамического МРТ для обнаружения спаек было успешным, но исследование изображений с достаточной детализацией для обнаружения аномального слайда оказалось трудоемким, и результаты могут быть сильно изменчивы между операторами [4–6]. Ранее мы представили методику математического анализа движения в брюшной полости, чтобы помочь сделать вывод о наличии грубых аномалий (обширных спаек) [6]. В данной статье описывается усовершенствование этой техники с использованием сегментации и регистрации изображений для исследования исключительно более тонких аномалий на брюшной стенке путем исследования висцерального слайда.

Регистрация изображения — это математический процесс, целью которого является искажение точек на одном изображении, чтобы они совпадали с соответствующими точками на другом. Он доказал свою ценность в отслеживании функций или структур между постепенно изменяющимися изображениями. Однако известно, что скользящая геометрия (например, в брюшной полости) бросает вызов алгоритмам регистрации [7–11]. Для решения этой проблемы в литературе основное внимание уделяется разработке очень сложных, индивидуальных алгоритмов регистрации для точного учета скольжения [7–11].В этой статье мы сфокусированы на другом: мы намерены оценить само скользящее движение. Мы считаем, что есть преимущества в использовании «готовой» технологии регистрации в сочетании с протоколом, оптимизированным для обнаружения сдвига, и для этой цели мы продвигаем метод сегментации-регистрации. Такой прагматичный подход делает методику более прозрачной, а технологию более доступной, что, как мы надеемся, будет способствовать ее клиническому внедрению.

Насколько известно авторам, никто не выполнил количественную характеристику / измерение скользящего движения в брюшной полости, и не был разработан надежный метод неинвазивного определения спаек брюшной полости.Имея это в виду, данный документ является «незавершенным», в котором дается обзор разработанной методологии и представлены предварительные результаты.

2. Метод

Наш протокол сканирования был разработан независимо, что привело к протоколу, который перекликается с протоколом Lienemann et al. (2000) [4]. Динамические МР-изображения получают с использованием последовательности МР-визуализации True FISP (истинно быстрая визуализация с установившейся прецессией). Изображения получают в сагиттальной плоскости от середины восходящей до середины нисходящей ободочной кишки, которая полностью покрывает содержимое брюшной полости.Параметры сканирования включают размер матрицы 256 × 256, толщину среза 7 мм и 10-миллиметровые промежутки между срезами. 30 кадров получают в каждом месте сагиттального среза с приблизительным временем между кадрами 0,4 секунды. Пациентов сканируют в положении лежа на спине и просят прижаться и нормально дышать во время получения каждого сагиттального среза (в течение ~ 12 секунд), захватывая примерно 3 дыхательных цикла.

Основное внимание в нашем методе уделяется конкретной системе скользящего движения, характеризующейся тем, что две смежные конструкции в контакте скользят независимо друг от друга.Схема типа движения, наблюдаемого в брюшной полости во время дыхания, показана на рисунке 1.


Эти типы систем предполагают прерывистость в движении вдоль границы, разделяющей два движущихся объекта. Метод направлен на определение степени скольжения путем количественной оценки сдвига как аналога скользящего движения, имеющего место на неоднородности. Величина сдвига относится к разнице в относительном смещении двух объектов по обе стороны от неоднородности движения вдоль границы.

Метод основан на этапе сегментации, который требует, чтобы граница между двумя областями движения была определена, как показано на этапе 1 на рисунке 2. Это делается полуавтоматически путем определения границы вручную на одном кадре, после чего положение границы отслеживается для всех последующих кадров. Движение внутри двух областей теперь можно математически исследовать отдельно, без взаимного вмешательства. Отдельные регистрации количественно определяют движение в каждой области, которые затем повторно комбинируются для восстановления полного описания движения по всему изображению.Движение изображено в виде стрелок (векторов) на этапе 2 на фиг. 2. Затем вычисляются относительные движения вдоль границы по всей последовательности динамических изображений для определения величины сдвига. Результатом является «диаграмма сдвига»: цветная полоса на этапе 3 на рисунке 2, отображающая общий сдвиг вдоль границы приблизительно за 3 дыхательных цикла.


3. Результаты

Для целей этого упражнения мы получили выборку подходящих МРТ-изображений, на которых было доступно дополнительное хирургическое подтверждение для уточнения степени спаечной патологии.Особый интерес вызвала пациентка с хирургически подтвержденной адгезией к передней брюшной стенке после герниопластики. Результат сдвига, суммированный приблизительно за 3 дыхательных цикла для этого пациента, сравнивается с двумя здоровыми добровольцами без спаек на Рисунке 3.


Наблюдается очевидное уменьшение сдвига в месте хирургически подтвержденного спаечного процесса (выделено стрелкой. ), что контрастирует с относительно однородным, постепенно меняющимся сдвигом, наблюдаемым вдоль брюшной стенки у двух здоровых добровольцев.

4. Проверка

Критическая оценка нашего метода требует доказательств того, что метод является надежным и лишенным артефактов. В отсутствие клинических испытаний или пилотных исследований в этом разделе обсуждаются два примера проверочных тестов с интерпретацией результатов и их значения для клинического использования. Проверочные тесты, которые были выполнены для оценки надежности метода, включают: (1) в высшей степени идеализированное компьютерное растяжение прямоугольной области МР-изображения (2) визуализацию физической системы, включающую сжатие губки в шприце. для создания скольжения по стенке шприца.

4.1. Тест 1

Прямоугольный участок МР-изображения брюшной полости был искусственно растянут относительно окружающего МР-изображения (показано на Рисунке 4 (а)), чтобы создать фильм прерывистого скольжения с известным, зависящим от времени сдвигом на границе. Сдвиг по границе был рассчитан с шагом сегментации и без него и по сравнению с известным сдвигом по границе на Рисунке 4 (b).


Сдвиг, вычисленный при включении сегментации движения, близко соответствовал известному сдвигу на границе растянутого участка.Наибольшее расхождение произошло в верхней части изображения (см. Рис. 4 (b)) и связано с тем, что детали были растянуты за пределы пространства изображения. Даже с относительно небольшими сдвигами, присутствующими в этом примере, измеренный сдвиг находится в пределах примерно 5% от фактического сдвига. Простой характер деформации (равномерное растяжение) не ставит под сомнение алгоритм регистрации, но демонстрирует присущую процедуре точность при отсутствии «реальных» сложностей.

4.2. Тест 2

Второй проверочный тест был скорее физическим, чем компьютерным моделированием, и включал сжатие текстурированной губки внутри шприца (рис. 5). Плунжер использовался для постепенного сжатия губки при съемке изображений стандартной камерой DSLR (Cannon EOS 1100D). Были сделаны два отдельных набора снимков: в первом позволяли свободно сжимать губку; для второго, липкий кусок двусторонней липкой ленты был добавлен внутрь шприца, чтобы создать локальное сопротивление «движению» губки, тем самым нарушив скольжение (аналог адгезии).Изображения на рисунках 5 (a) и 5 ​​(b) показывают несжатую и сжатую губку, в то время как изображения на рисунках 5 (c) и 5 ​​(d) использовали наш протокол регистрации-сегментации, чтобы изобразить сдвиг, суммированный по всему сжатию с без наличия скотча. Этот тест представляет собой более реалистичную задачу для алгоритма, поскольку он включает в себя неравномерную деформацию и локализованные вариации скользящего движения. Он не только оценивает способность метода количественно определять сдвиг, но и его способность обнаруживать адгезионную область вдоль границы — доказательство принципа определения адгезии.


При качественном наблюдении за движением губки без помощи диаграммы сдвига определение местоположения адгезии было чрезвычайно сложной задачей. В сочетании с изображениями на рисунках 5 (c) и 5 ​​(d) наблюдалось достаточное уменьшение сдвига вокруг места адгезии, чтобы точно повысить осведомленность о его присутствии.

5. Обсуждение

Внутрибрюшные спайки могут образовываться в любом месте брюшной полости, различаться по форме и размеру и, следовательно, вызывать спектр симптомов: незначительные или отсутствующие с одной стороны до сильной частой боли с другой.Часть пациентов со спаечными заболеваниями вынуждены неоднократно обращаться за медицинской помощью из-за необъяснимой боли в животе. В современной клинической практике пациенту с сильной болью в животе и подозрением на непроходимость кишечника проводят неинвазивную визуализацию [12–15]. Планарный рентген, рентгеноскопия, КТ или МРТ могут использоваться в попытке обнаружить проксимальную область растянутого кишечника с резким уменьшением диаметра кишечника до коллапса дистальной области [13]. Важно отметить, что рентгенологические особенности определяют место обструкции, но не обязательно причину: адгезия может быть вероятной, но не доказанной.Единственным окончательным методом доказательства наличия спаек является хирургическое вмешательство (лапаротомия или лапароскопия), которое само по себе часто является основной причиной спаек [16]. В результате они ложатся тяжелым бременем на здравоохранение во всем мире [16–18], а отсутствие надежных неинвазивных диагностических методов приводит к консервативному ведению пациентов и длительному дискомфорту пациентов [12].

Признано, что необходимы улучшенные методы диагностики для надежного информирования о стратегиях ведения пациентов с спаечной непроходимостью кишечника [12], но дополнительно мы предлагаем требование для диагностики спаек у пациентов с симптомами без кишечной непроходимости.Потенциальным методом диагностики является рентгенологическое исследование кинематографической МРТ для наблюдения за движением содержимого брюшной полости. Впервые это было описано Lienemann et al. в 2000 г. [4] и привел к нескольким дальнейшим публикациям [5, 19, 20] той же группы. Получение кинематографической МРТ позволяет получить срезы в поперечной и сагиттальной плоскостях и требует от радиолога определения областей отсутствия движения, которые могут соответствовать адгезивной патологии. Методика показала себя многообещающей и продемонстрировала впечатляющую точность, выявляя до 89% хирургически подтвержденных спаек [19].

Однако, по нашему опыту, радиологическая оценка изображений кинематографической МРТ ограничена из-за ее сложности, высокой вариабельности между операторами и чрезмерного времени для составления отчетов. Эти факторы привели к нашей предыдущей публикации, в которой описывалось математическое картирование и изображение движения брюшной полости в помощь радиологу [6]. Эта текущая статья предлагает уточнение нашего предыдущего подхода, представляя измерения сдвига в качестве диагностического показателя наличия и локализации более тонких спаек по периметру брюшной полости.Измерение сдвига можно использовать, чтобы повлиять на решение об операции, облегчить более эффективную операцию за счет улучшенной локализации спаек и снизить риск серьезных хирургических осложнений, таких как перфорация кишечника во время разрезов.

5.1. Доклиническая проверка

Проверочные тесты были идеализированными и неклиническими, но позволили проверить метод анализа, что является доказательством принципа обнаружения спаек. Результат теста 1 (растянутая область МРТ) показал близкое соответствие между результатами компьютерного анализа и фактическим сдвигом, что указывает на правильность расчета сдвига.Это также хорошо отражено в менее идеализированном эксперименте Теста 2 (текстурированная губка). Хотя в месте склеивания наблюдался небольшой сдвиг (см. Рис. 5), это явно объяснялось слабым сцеплением между лентой и губкой из-за небольшого проскальзывания. Более тонкое наблюдение — это уменьшение сдвига на противоположной стенке приклеенной области на Рисунке 5 (d) по сравнению с получением без адгезии на Рисунке 5 (c). Тщательное изучение изображений и регистрации поля деформации подтверждает, что это не недостаток анализа сдвига, а, скорее, адгезия повлияла на деформацию как на правой, так и на левой границе.Когда область под адгезией остается в значительной степени несжатой, часть губки перемещается в это пространство сбоку, а не скользит вертикально вниз по стенке шприца.

Результаты обоих тестов подтверждают методику, показывающую, что она точно фиксирует сдвиг и что ее можно использовать для обнаружения области, нарушенной адгезивным воздействием.

5.2. Клинический тест

Применение к небольшому количеству клинических примеров до сих пор продолжает давать многообещающие результаты.В описанном здесь случае наблюдалось уменьшение сдвига в месте хирургически подтвержденной адгезии, в то время как в образце сканированных изображений здоровой брюшной полости () наблюдалось более плавное, более постепенное изменение сдвига. Комбинированные доказательства клинического исхода и валидационных тестов подтверждают достоинства этого метода. Разработка нашей системы для клинического использования требует двух основных шагов: ретроспективного применения к более широкой когорте пациентов с хирургическим подтверждением и перспективной программы.

Клинические результаты на рисунке 3 также показывают области пониженного сдвига, которые не соответствуют подтвержденной адгезии (например,g., верхний левый рисунок 3 (а) и в самом основании живота на всех изображениях). Проверка движения в этих областях показывает, что это не недостаток техники для правильного измерения сдвига, а скорее подтверждает, что скольжение действительно снижается в этих областях. На данном этапе разработки цель этого метода состоит не в том, чтобы обеспечить отдельный диагностический результат, а в том, чтобы привлечь внимание радиолога к конкретным подозрительным областям, которые в сочетании с другой диагностической информацией могут позволить принять обоснованное решение.Эти первоначальные дополнительные вложения радиолога потенциально более чем компенсируются повышением точности диагноза и сокращением времени обследования. Вероятно, что будут общие места уменьшения сдвига, которые с опытом можно будет легко идентифицировать и соответствующим образом интерпретировать. В планах на будущее — создание «атласа» сдвига, чтобы предоставить типичную карту сдвига в состоянии здоровья и болезней, чтобы помочь прояснить такие вопросы.

5.3. Проблемы и будущая работа

В этом документе сообщается о незавершенной работе и остаются проблемы, которые необходимо решить, прежде чем предлагаемый протокол диагностики спаек передней стенки можно будет считать надежным.Основные проблемы связаны с (i) чувствительностью результатов к положению границы между движущимися областями и (ii) возможными артефактами, вносимыми структурами, движущимися через плоскость 2D-изображения. Что касается (i), наш опыт подтверждает, что размещение границы относительно стабильно из-за анатомии с высоким контрастом; следовательно, достижимы воспроизводимые результаты. Что касается (ii), движение через плоскость в 2D наиболее эффективно решается с помощью 3D-изображения. Однако преимущества, полученные от реализации 2D, заключаются в высоком временном разрешении, недоступном при построении 3D-изображений, а также в простоте и скорости реализации.Кроме того, примечательно, что движение в брюшной полости в основном верхнее-нижнее; поэтому объекты в основном остаются в сагиттальной плоскости изображения. Именно по этим причинам проводится дополнительный двухмерный и трехмерный анализ.

В заключение отметим, что протокол специально разработан для поддержки использования различных стандартных алгоритмов регистрации. В настоящее время большая часть работы выполняется с использованием набора инструментов Sheffield Image Registration Toolkit (ShIRT), но также успешно внедрены и используются ANT (Advanced Normalization Toolkit, алгоритм регистрации с открытым исходным кодом).

6. Заключение

Была предложена, исследована и утверждена методика измерения сдвига для определения величины висцерального скольжения вдоль конечностей брюшной полости. Несмотря на общепризнанные ограничения текущей реализации, предварительные результаты показали, что принятая методология является успешной в определении и обнаружении мест спаек. Клиническое применение в настоящее время ограничено небольшим количеством обследованных пациентов, но проводится дополнительное исследование с большей группой пациентов для дальнейшей оценки.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов в отношении публикации этой статьи.

Благодарности

Авторы хотели бы поблагодарить Bardhan Research and Education Trust of Rotherham (BRET) за поддержку этой работы. Они также благодарны Фрэнку Йустену (Рейнстейт Зикенхейс, отделение радиологии) и Гарри ван Гору (Медицинский центр Университета Радбауд, отделение хирургии) за их поддержку в этой работе.

Кокон живота, вызывающий хроническую боль в животе и кишечную непроходимость; серия случаев

https://doi.org/10.1016/j.amsu.2019.10.003Получить права и контент

Основные моменты

Кокон живота — редкое заболевание, при котором толстая оболочка покрывает кишечник.

Это первичное (идиопатическое) или вторичное по отношению к предыдущим операциям на брюшной полости.

Большинство пациентов жалуются на боль в животе и кишечную непроходимость, которая обычно диагностируется во время операции.

Abstract

Кокон брюшной полости — редкое заболевание, при котором толстая перитонеальная мембрана обволакивает кишечник, заставляя петли кишечника слипаться друг с другом. Он может быть первичным (идиопатическим) или вторичным по отношению к другим причинам, таким как предыдущая абдоминальная операция. Большинство пациентов жалуются на боли в животе и кишечную непроходимость. Состояние обычно диагностируется во время операции.

Случай 1

Больной 30-ти лет обратился с жалобами на боли в животе и рвоту желчью.У пациента были аналогичные приступы в прошлом. Обследование показало вздутие живота с болезненностью в центре. Рентген брюшной полости показал несколько уровней жидкости в воздухе. Во время операции большая часть подвздошной кишки была покрыта тонкой перепонкой с расширенной проксимальной частью тощей кишки. Выпустили петли кишечника. Пациент хорошо себя чувствовал после операции и был выписан без послеоперационных осложнений.

Случай 2

35-летний мужчина обратился с жалобой на хроническую боль в правом нижнем квадранте живота, предыдущие медицинские и хирургические истории не имели отношения к делу.Абдоминальное обследование показало болезненность при глубокой пальпации в правой подвздошной ямке, УЗИ и рентгенография брюшной полости в норме. При диагностической лапароскопии терминальный отдел подвздошной кишки был покрыт толстой беловатой оболочкой с расширенной проксимальной частью подвздошной кишки. Освобождение спаек было сделано. Пациент в послеоперационном периоде чувствовал себя хорошо, выписан домой без послеоперационных осложнений.

В обоих случаях биопсия оболочек показала признаки хронического воспалительного процесса.

Кокон брюшной полости — одна из редких причин непроходимости тонкой кишки. Спайки кишечника следует вскрыть и удалить нежизнеспособные сегменты. Большинство пациентов имеют хорошие долгосрочные результаты.

Ключевые слова

Брюшная полость кокона

Кишечная непроходимость

Склерозирующий инкапсулирующий перитонит

Перитонеальная инкапсуляция

Рекомендуемые статьиЦитирующие статьи (0)

© 2019 Автор (ы). Опубликовано Elsevier Ltd от имени IJS Publishing Group Ltd.

Рекомендуемые статьи

Ссылки на статьи

Непроходимость тонкого кишечника | Гастроэнтерология | JAMA

A Непроходимость тонкого кишечника — это закупорка тонкого кишечника.

Непроходимость тонкого кишечника обычно вызывается рубцовой тканью, грыжей или раком. В Соединенных Штатах большинство препятствий возникает в результате ранее проведенных операций. Кишечник часто образует полосы шрамов (так называемые спайки , ) после того, как с ним обращаются во время операции.Чем больше операций на кишечнике, тем больше вероятность образования рубцов. Если кишечник застревает в спайках, это может привести к непроходимости тонкого кишечника. В тяжелых случаях может нарушиться кровоснабжение, и ткани кишечника могут погибнуть. Это опасная для жизни ситуация.

Тонкая кишка постоянно перемещает переваренную пищу и желудочные соки из желудка в толстую кишку.

  • Непроходимость тонкой кишки, вызванная спаечным процессом, может возникнуть уже через несколько недель или через несколько лет после операции без каких-либо явных побуждающих факторов.

  • Непроходимость может привести к тому, что материал внутри кишечника снова попадет в желудок. Это вызывает тошноту и рвоту темно-зеленой желчью ( рвота желчью, ).

  • Кишечник, предшествующий обструкции, становится большим, расширенным и наполненным жидкостью и воздухом, которые в противном случае продвинулись бы вперед. Это вызывает вздутие живота ( вздутие живота, ).

  • Когда кишечник сжимается, чтобы протолкнуть предметы вперед, преодолевая препятствие, это вызывает спазмы и дискомфорт.

  • Если жидкость и воздух не могут выйти за пределы препятствия, пациенты больше не могут выводить газ или опорожнять кишечник ( запор ).

Важно знать историю операций, грыжи или рака. Осмотр врача, сопровождаемый анализом крови и рентгеновским снимком или компьютерной томографией (КТ), может подтвердить диагноз.

Большинство обструкций разрешается, когда тонкая кишка отдыхает и сокращается до своего нормального размера, тем самым делая спайки менее проблематичными.Это достигается путем введения назогастральной ( NG ) трубки (тонкая пластиковая трубка, которая проходит через ноздрю в желудок), которая всасывает жидкость из желудка. Кроме того, пациентам не разрешается есть или пить в это время, вместо этого им вводят жидкости для гидратации. Обычно непроходимость тонкого кишечника проходит через несколько дней. Когда у пациента становится меньше вздутие живота, начинает выделяться газ и появляется дефекация, трубка удаляется, и пациенту разрешают есть и пить.

Если пациенту не стало лучше, то может потребоваться оперативное вмешательство. Операция называется лизис спайки , что означает разрезание рубцовой ткани и освобождение застрявшего кишечника. Если какая-либо часть кишечника выглядит нездоровой или мертвой, ее отрезают, а здоровые концы сшивают.

Любая грыжа также может ущемлять кишечник и вызывать аналогичные симптомы. Грыжу обычно можно обнаружить во время осмотра врача; в некоторых случаях может потребоваться визуализация, чтобы убедиться, что грыжа не является причиной непроходимости.

  • Сильная боль или жар могут быть признаком того, что кишечник не получает достаточно крови или что он мертв.

  • Пациентам без хирургических вмешательств на кишечнике или без грыжи, обнаруженной при обследовании, следует пройти компьютерную томографию, чтобы исключить рак как возможную причину непроходимости.

Идентификационный номер прямоугольного сечения

Раскрытие информации о конфликте интересов: Все авторы заполнили и отправили ICMJE Форму раскрытия информации о потенциальных конфликтах интересов, и ни о чем не сообщалось.

Источники: Greenfield LJ, Mulholland MW, Oldham KT, et al. Хирургия Гринфилда: научные принципы и практика . 5-е изд. Филадельфия, Пенсильвания: Липпинкотт Уильямс и Уилкинс; 2006.

Schlicke C, Bargen A, Dixon C. Управление кишечной непроходимостью: оценка консервативной терапии. ЯМА . 1940; 115 (17): 1411-1416.

Кишечная непроходимость у восьмидесятилетнего возраста — фото-викторина

Am Fam Physician. 1 октября 2004 г .; 70 (7): 1337-1338.

Женщина 80 лет поступила с болями в животе, рвотой и общей слабостью в течение пяти дней. В анамнезе у пациента не было травм брюшной полости или хирургических вмешательств. Она принимала варфарин по поводу хронической фибрилляции предсердий. При осмотре ее живот был болезненным и вздутым. Уровень калия в ее сыворотке составлял 2,4 мЭкв на л (2,4 ммоль на л), а международное нормализованное отношение (МНО) составляло 3,17. Все остальные лабораторные показатели были в пределах нормы. Рентгенограмма брюшной полости показала несколько уровней жидкости в тонкой кишке.Была получена компьютерная томография (КТ) брюшной полости (рис. 1). Нормализация сывороточного калия не привела к значительному клиническому улучшению. Впоследствии ей сделали лапаротомию и резекцию кишечника. Макропатологический образец резецированной кишки показан на рисунке 2.


Рисунок 1.


Рисунок 2.

Вопрос

На основании клинической картины и предоставленных рентгенологических и патологических данных, что такое наиболее вероятная этиология непроходимости тонкого кишечника?

А.Ущемленная грыжа.

Б. Внутримуральная гематома.

C. Заворот.

D. Спайки.

E. Эмболия брыжеечной артерии.

Обсуждение

Ответ Б: интрамуральная гематома. Непроходимость тонкого кишечника, вызванная интрамуральной гематомой, — редкое, но хорошо известное заболевание. У взрослых примерно две трети этих случаев предшествуют травмам живота. Оставшаяся треть вызвана множеством проблем, в том числе нарушениями свертывания крови, заболеваниями поджелудочной железы, алкоголизмом, осложнениями биопсии тощей кишки и пурпурой Геноха-Шенлейна.1 Самопроизвольное возникновение интрамуральной гематомы (рис. 1, стрелка) обычно вызвано токсичностью варфарина.2 На сегодняшний день в медицинской литературе зарегистрировано более 100 таких случаев интрамуральной гематомы.3 Наиболее часто поражаются двенадцатиперстная кишка и проксимальной части тощей кишки, которые были приписаны относительной неподвижности этих частей тонкой кишки.3 У детей тупая травма живота, случайная или нанесенная (жестокое обращение с детьми), является наиболее частой причиной.4 Типичные симптомы включают боль в животе, тошноту и т. рвота и запор.Лабораторные тесты должны включать измерение МНО у любого пациента, получающего антикоагулянтную терапию. КТ брюшной полости и таза с контрастным усилением может выявить утолщение стенки кишечника. Пациенты с интрамуральной гематомой, стабильные с медицинской точки зрения, обычно лечатся консервативно с покоем кишечника. Пациентам, получающим антикоагулянтную терапию, следует, по возможности, нормализовать параметры свертывания крови.3,5 Если состояние пациента не улучшается или ухудшается, может потребоваться хирургическое вмешательство.2–5 В случаях, связанных с травмой, быстрое оперативное вмешательство типично.6

Удушение грыжи приводит к нарушению кровоснабжения содержимого мешка (например, сальника или кишечника). Бедренные грыжи чаще всего осложняются удушением, которое требует неотложного хирургического вмешательства.

Заворот кишечника возникает в результате вращения петель кишечника вокруг фиксированной точки, что приводит к частичной или полной непроходимости просвета кишечника. Часто это следствие врожденных аномалий или приобретенных спаек.Заворот чаще всего затрагивает сигмовидную кишку, хотя может быть задействована и слепая кишка. В большинстве случаев заворот сигмовидной кишки можно лечить консервативно с помощью бариевой клизмы или эндоскопии, чтобы освободить заворот. Возвращение газов и фекалий указывает на то, что скручивание прекратилось. Заворот слепой кишки лучше всего лечить лапаротомией и правой гемиколэктомией.

Кишечная непроходимость, вторичная по отношению к спайкам, является наиболее частой причиной непроходимости тонкой кишки у взрослых. Спайки обычно возникают в результате абдоминальной хирургии или вследствие воспалительных состояний, таких как болезнь Крона и эндометриоз.Врожденные повязки могут быть причинным фактором у детей. Кишечная непроходимость обычно лечится консервативно, но может потребоваться хирургическое вмешательство. Внутримуральная гематома не будет видна из-за простой механической преграды.

Эмболия брыжеечной артерии чаще всего вызывается смещением тромба из левого предсердия, левого желудочка или сердечных клапанов. Анатомически наиболее подвержена эмболической окклюзии верхняя брыжеечная артерия. Быстрая диагностика важна для предотвращения инфаркта кишечника и его сопутствующих последствий.К сожалению, ранние признаки и симптомы эмболии брыжеечной артерии могут быть неспецифическими, и окончательный диагноз может быть невозможен без инвазивного тестирования. Доступные методы лечения включают в себя методы сохранения кишечника, такие как хирургическая лапаротомия с эмболэктомией или местная инфузия тромболитических агентов через катетер брюшной аорты. Хотя симптомы этого пациента и преклонный возраст могут указывать на ишемию брыжейки, интрамуральная гематома, видимая на КТ, не соответствует.

Просмотр / печать таблицы

Выборочная дифференциальная диагностика кишечной непроходимости у восьмидесятилетнего ребенка
Состояние Характеристики

Удушенная грыжа кишечника, которая также может быть повреждена в грыже

кровоснабжение

Внутримуральная гематома

Самопроизвольное кровотечение в стенку кишечника, обычно вызванное чрезмерной антикоагулянтной терапией

Заворот

Заворот толстой кишки чаще всего включает в себя искривление толстой кишки; обычно лечат эндоскопией или бариевой клизмой

Спайки

Рубцовая ткань, вызывающая «перегибы», обычно приобретенная в результате абдоминальной хирургии или внутрибрюшного воспаления

63

004 эмболия мезентериальной артерии

верхняя брыжеечная артерия, вызывающая массивный отек или инфаркт кишечника; часто у пациента с ранее существовавшим сердечным тромбом

Избранная дифференциальная диагностика кишечной непроходимости у восьмидесятилетнего ребенка
Состояние Характеристики

004 Грыжа в грыже кишечника

605 мешочек, который также может нарушить кровоснабжение

Внутримуральная гематома

Самопроизвольное кровотечение в стенку кишечника, обычно вызванное чрезмерной антикоагулянтной терапией

Заворот

Заворот кишечника наиболее часто включает перекрученный кишечник

; обычно лечат эндоскопией или бариевой клизмой

Спайки

Рубцовая ткань, вызывающая «перекручивание», обычно приобретается в результате абдоминальной хирургии или внутрибрюшного воспаления

63

004 Мезентериальная артериальная эмболия верхняя брыжеечная артерия, вызывающая массивный отек или инфаркт кишечника; часто у пациентов с уже существующим сердечным тромбом

Непроходимость тонкого кишечника | MUSC Health

Что такое непроходимость тонкого кишечника?

С того момента, как вы проглотили пищу, до того момента, как вы выпустите остатки еды во время дефекации, весь пищеварительный тракт совершает удивительный подвиг, перемещая пищу через органы с помощью специального набора мышц, которые сокращаются и расширяются.Фактически, звук, который вы слышите, когда ваш живот урчит, является результатом сокращений, которые происходят во время переваривания пищи.

Непроходимость тонкого кишечника — потенциально опасное состояние. Существует ряд условий, при которых сокращения мышц кишечника очень замедляют процесс перемещения пищи. Это может раздражать и влиять на качество жизни.

Есть два типа непроходимости тонкой кишки:

  • функциональная — нет физической закупорки, однако кишечник не перемещает пищу через пищеварительный тракт
  • механический — есть засор, препятствующий перемещению пищи.

Функциональные причины могут включать:

  • Повреждение мышц или нервов, которое может быть результатом абдоминальной хирургии или таких заболеваний, как болезнь Паркинсона
  • Инфекции
  • Некоторые лекарства, парализующие схватки. Так действуют сильнодействующие наркотики.

Существуют также серьезные состояния, при которых может потребоваться немедленное вмешательство:

  • Грыжи — вероятно, наиболее частое заболевание у детей и взрослых, при котором небольшая часть кишечника выступает через другую часть тела.Причиной также могут быть спайки. Может образоваться рубцовая ткань, которая блокирует кишечный канал.
  • Воспалительное заболевание кишечника — состояние, при котором воспаляются стенки кишечника
  • Опухоли кишечника, затрудняющие отток крови
  • Заворот или заворот кишечника
  • Инвагинация, состояние, при котором сегмент кишечника разрушается сам в себя

Симптомы непроходимости тонкой кишки

  • Прерывистая боль вследствие перстальтики
  • вздутие живота в зависимости от того, где находится преграда
  • рвота
  • запор
  • лихорадка и учащенное сердцебиение

Почему вам нужно обратиться к врачу, если вы подозреваете, что у вас непроходимость тонкого кишечника?

Если часть кишечника перекручивается, кровоток в этой части может уменьшиться, и заблокированная часть может погибнуть.Это очень серьезное состояние. Другое серьезное заболевание может возникать при разрыве кишечника, при котором содержимое попадает в полость кишечника. Это вызывает инфекцию, известную как перитонит.

Ваш врач может задать вам следующие вопросы о вашем состоянии:

  • Как давно вы столкнулись с этой проблемой
  • Было ли у вас это состояние раньше? Это прояснилось?
  • Боль возникла быстро?
  • Боль постоянная?
  • Вам когда-нибудь делали операцию на брюшной полости?

Диагностика непроходимости тонкого кишечника

Обычно все, что требуется для диагностики непроходимости тонкой кишки, — это рентген брюшной полости.

  • Люминальное контрастное исследование
  • компьютерная томография (КТ)
  • УЗИ (США)

После постановки диагноза кишечной непроходимости необходимо определить место, серьезность и этиологию. Наиболее важно различать простую и сложную обструкцию.

Лечение непроходимости тонкой кишки

  • Противорвотные средства — это лекарства от рвоты
  • Анальгетики — слабые болеутоляющие
  • Антибиотики атакуют любую инфекцию, которая может быть у вас
  • Декомпрессия кишечника — это процедура, при которой трубка вводится в пораженную область в попытке снизить давление и устранить спайки.
  • Хирургия

Осложнения непроходимости тонкой кишки

  • Абсцессы брюшной полости — это очаги инфицированного гноя в брюшной полости
  • Сепсис, состояние, при котором кровь заражается
  • Синдром короткой кишки — это состояние, которое приводит к нарушению всасывания питательных веществ

Быстрое вмешательство — лучшее лекарство от непроходимости тонкого кишечника. Осложнения возникают быстро и требуют сложной операции.Раннее вмешательство приводит к благоприятным результатам с небольшим количеством осложнений. Обратитесь к врачу, если считаете, что у вас возникла проблема.

.
Leave a Reply

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2021 © Все права защищены.