Кровь на хеликобактер пилори как подготовиться: Как обнаружить хеликобактер пилори: преимущества дыхательного теста

Содержание

Статьи и новости медцентра Элиса

Полезные статьи /


8 августа, 2019

В появлении гастритов и язв люди привыкли винить вредную еду и стрессы, хотя на самом деле большинство проблем с желудочно-кишечным трактом – «заслуга» коварной бактерии хеликобактер пилори.

Хеликобактер пилори (helicobacter pylori) – спиралевидная бактерия-паразит, которая способна проникать в слизистую оболочку желудка и двенадцатипёрстной кишки. Она производит токсины, которые поражают слизистую оболочку этих органов и вызывают патологические изменения. Особенность хеликобактера пилори в том, что агрессивная кислая желудочная среда для неё весьма комфортное место обитания. И, если большинство бактерий в подобной агрессивной среде погибают, то хеликобактер отлично к ней адаптируется. Согласно статистическим данным, более 80% населения России инфицировано этой бактерий.

Для точной диагностики и назначения лечения проблем ЖКТ пациенту необходимо сдать анализ на наличие в организме бактерии хеликобактер пилори

. Какие методы лабораторной диагностики существуют на сегодняшний день и насколько они точны?

Анализы на хеликобактер пилори. Какой самый эффективный?

В современной лабораторной диагностике, чтобы  выявить наличие хеликобактер пилори в организме, применяют несколько способов: с помощью анализа крови, кала, дыхательного теста или биопсии. Зачем нужен анализ? Простой пример: если у человека клиническая картина гастрита, то нужно в первую очередь понять причину его появления и развития, только после этого назначать лечение.

Основные показания для сдачи анализа на хеликобактер пилори:

  • гастрит;
  • постоянная изжога;
  • боли в желудке после еды;
  • частая диарея и запоры;
  • отсутствие аппетита;
  • метеоризм, урчание в животе.

Иммуноферментный анализ крови на хеликобактер (ИФА)

Чаще всего гастроэнтерологи направляют пациента на сдачу анализа крови. Однако нужно понимать, что бактерии helicobacter в крови нет. С помощью иммуноферментного анализа в крови выявляют антитела к наличию хеликобактера, которые продуцирует иммунитет в ответ на инфекцию.
На 100% точным этот анализ назвать нельзя. Причина в том, что реакция иммунитета у человека в разные моменты жизни может быть изменена. Например, пациент переболел ангиной, пропил курс антибиотиков, иммунитет на фоне болезни понизился, производство антител нарушено… В этом случае анализ будет ложноотрицательным.

Анализ кала на хеликобактер

С помощью этого простого анализа можно обнаружить ДНК хеликобактер пилори в биоматериале человека. Анализ отличается высокой точностью – до 95%. Подойдёт для детей младшего возраста, пожилых людей и тех, кому противопоказана биопсия. Само исследование проводится с помощью метода ПЦР (полимеразной цепной реакции). Исследование в лаборатории проводится следующим образом: из биоматериала выделяют участок ДНК, после чего его дублируют на амплификаторе. Это позволяет установить, есть ли в пробе геномный фрагмент, свойственный бактерии хеликобактер.

 

Урезанный экспресс-тест на хеликобактер

Принцип дыхательного теста в том, что бактерии находятся в подслизистой оболочке желудка и в процессе своей жизнедеятельности выделяют большое количество мочевины. Эта мочевина улавливается дыхательным тестом и даёт положительную реакцию. Перед процедурой пациенту необходимо принять специальный раствор, после чего в течение часа берутся 4 пробы воздуха. Результат теста виден сразу.

Однако тест также не обладает 100% чувствительностью. Стоит отметить, что урезанный тест на хеликобактер в Сочи можно найти только в крупных медицинских учреждениях.

Бакпосев на хеликобактер

Это самый чувствительный метод, дающий точный результат. Однако само исследование довольно сложное, так как материал для биопсии, а это участок слизистой желудка, берётся во время гастроскопии. Необходима оперативная связь между эндоскопистом и БАК лабораторией, чтобы можно было сразу после процедуры отправить биоматериал на исследование.

Решение о назначении той или иной диагностики принимает гастроэнтеролог, в зависимости от клинической картины заболевания и состояния пациента. Иногда для подтверждения наличия бактерии в организме понадобится несколько тестов. Отметим, что чаще всего назначают анализ крови. Реже – бакпосев на хеликобактер. Самым точным будет бакпосев, но с точки зрения сложности процедуры и комфорта для пациента данное исследованием менее предпочтительно.

– По рекомендациям австрийского сообщества гастроэнтерологов, которые занимаются изучением хеликобактера, анализ кала и дыхательный тест назначаются тем пациентам, которые уже были пролечены от хеликобактера с целью контроля, — объясняет Владимир Кадушев, гастроэнтеролог МДЦ «ЭЛИСА». – То есть первичная диагностика проводится с помощью иммуноферментного анализа. Но титры антител бактерии, иными словами их память, могут сохраняться в течение всей жизни. По этой причине для контрольного анализа кровь не используется.


Нужно ли повторно сдавать анализ на хеликобактер пилори?

Да, после курса лечения необходимо сдать повторный анализ на хеликобактер, чтобы оценить эффективность терапии.

Как берут анализ на хеликобактер пилори?

Чтобы результат исследования был максимально точным, необходимо правильно подготовиться к анализу и соблюдать правила при сдаче биоматериала.

  • Подготовка к сдаче кала

Минимум за месяц до сдачи биоматериала нельзя принимать антибиотики. За три дня до похода в лабораторию не употребляйте в пищу так называемые «красящие продукты»: чёрная смородина, свёкла, виноград и другие. Также запрет касается продуктов с грубой клетчаткой: морковь, редис, капуста, отруби. Врач-гастроэнтеролог напомнит о необходимости отказаться от препаратов, стимулирующих перистальтику желудка.

Для сбора биоматериала необходимо приобрести специальный контейнер в аптеке. Постарайтесь доставить биоматериал в лабораторию оперативно, поскольку срок хранения биоматериала не более 10-12 часов. 

  • Подготовка к анализу крови

Накануне сдачи анализа крови исключите из рациона жирную и жареную пищу, не курите, не употребляйте алкоголь, откажитесь от сильных физических нагрузок.

Кровь сдаётся утром натощак. 

  • Подготовка к дыхательному тесту

Нельзя есть перед сдачей дыхательного теста. Если вы сдаёте тест на хеликобактер утром, то последний приём пищи должен быть не позднее 22.00. За 3 дня до исследования уберите из рациона продукты, которые повышают газообразование – яблоки, бобовые, капуста, выпечка.  Исключите жидкости, которые с выдыхаемым воздухом повышают концентрацию СО2, например, газированная вода. Запрет также накладывается на сигареты, алкоголь и жевательную резинку.

  • Подготовка к биопсии

Перед ФГДС с биопсией необходимо отказаться от приёма пищи на 12 часов. Также за 2 часа до исследования нельзя курить и пить. 

Как расшифровывают анализ на хеликобактер?

Если исследование качественное, то результата может быть только два – «положительный» или «отрицательный». Если применяется количественный метод, то нормы анализа будут зависеть от конкретной лаборатории, а интерпретировать их сможет только врач.  

Как можно заразиться хеликобактер пилори?

Бактерию хеликобактер пилори называют внутрисемейной инфекцией и встречается она у 80% населения России. Основные способы передачи: фекально-оральный, орально-оральный, бытовой. Это могут быть поцелуи, использование общей посуды, употребление в пищу недостаточно чистых овощей и фруктов, несоблюдение правил личной гигиены… Чаще всего заражение происходит в детстве при бытовом контакте. Если, например, у родителей в организме есть бактерия хеликобактер пилори, то она передаётся и детям. Другой вопрос в том, в какой период жизни человека она себя проявит. Не стоит забывать о том, что большинство заболеваний верхнего отдела пищеварительного тракта происходит именно из-за этой бактерии. Гастроэнтерологи предупреждают, что у 100% людей с хеликобактером со временем развивается гастрит. Поэтому важно обнаружить её и вовремя пройти курс лечения.

Можно ли избавиться от хеликобактера?

Да, от бактерии хеликобактер пилори можно избавиться.

Лечебный курс как минимум в 80% даёт нужный результат.

– К лечебным мероприятиям имеются строгие показания, — объясняет Владимир Кадушев, гастроэнтеролог МДЦ «ЭЛИСА». – Они бывают относительные и абсолютные (обязательные). К обязательным относятся: язвенная болезнь, опухоли, атрофические гастриты и пациенты первой степени родства больных с раком желудка. Здесь лечение необходимо! Всё остальное – относительные показания. Например, поверхностный гастрит, функциональная диспепсия — они не требует экстренного лечения хеликобактера пилори. Можно выбрать подходящий момент в жизни пациента, когда лечение пройдёт максимально эффективно. Нужно понимать, что антибиотики могут иметь побочные действия или плохо переноситься. Поэтому необходимость лечения определяется индивидуально. Конечно, гастрит, если он у вас есть, от этого не исчезнет. Новый желудок «отрастить» невозможно, перестройка в организме уже произошла.

Возникает вопрос, а зачем тогда лечить хеликобактер при гастрите? Ответ простой: чтобы избежать перерождение гастрита в более сложные формы. После 40 лет гастрит, если его не лечить, может дать перестройку слизистой оболочки желудка. А это уже риск развития рака желудка в будущем. Ежегодно в России фиксируется от 45 тысяч до 60 тысяч новых случаев рака желудка. Поэтому лучшая профилактика рака – своевременное лечение хеликобактер пилори.

В лаборатории ЭЛИСА в Сочи вы можете сдать анализы на хеликобактер пилори:

Анализ на Helicobacter pilori — ДНК в кале

Анализ на Helicobacter pylori IgA (количественно)

Анализ на Helicobacter pylori IgG (количественно)

Анализ на Helicobacter pylori IgM (качественно)

В нашем медицинском центре вы можете сдать анализ на Helicobacter pilori по направлению вашего лечащего врача. Также вы можете записаться на прием к терапевту или гастроэнтерологу и проконсультироваться относительно беспокоящих вас симптомов. 

Анализы на Антитела к Helicobacter pylori, IgG, цены в лаборатории KDL

Хеликобактер пилори (Helicobacter pylori) —  микроорганизм, инфицирование которым ассоциировано с появлением эрозий в желудке, развитием хронического гастрита, язвенной болезни желудка и двенадцатиперстной кишки. Передаётся хеликобактер пищевым путём, через грязные руки и зараженные предметы обихода. При длительном нахождении Helicobacter pylori в организме возможно развитие атрофического гастрита, который является предраковым состоянием, поэтому своевременная диагностика и лечение, направленное на устранение хеликобактера, имеют важное значение.

Антитела к хеликобактеру (Helicobacter pylori) IgG – белки иммунной защиты, которые вырабатываются через 3-4 недели после контакта с инфекцией, вслед за иммуноглобулинами М (IgM) и А (IgA) и сохраняются длительное время после выздоровления. Являются маркерами инфицирования организма. Исследование будет информативно для первичной диагностики инфекции хеликобактером. Для оценки эффективности проведенной терапии целесообразно использовать методы диагностики, направленные на поиск возбудителя в выдыхаемом воздухе: дыхательный уреазный тест или исследование антигена хеликобактера в кале.

В каких случаях обычно назначают исследование на определение уровня антител к хеликобактеру (Helicobacter pylori), IgG?

  • При язвенной болезни желудка и двенадцатиперстной кишки – в качестве скринингового первичного обследования
  • При симптомах хронического гастрита
  • При обследовании родственников пациентов с выявленной инфекцией Helicobacter pylori

Что означают результаты теста?

Референсные значения:

  • <0,9 МЕ/мл — антитела не обнаружены
  • 0,9-1,1 МЕ/мл — анализ рекомендуется повторить через 1 неделю
  • >1,1 МЕ/мл — антитела обнаружены

Результат  <0,9 — антитела не обнаружены

  • отсутствие инфицирования Helicobacter pylori
  • возможно, исследование сделано в ранний период инфекции, когда ещё не успели выработаться IgG.

Результат –  >1,1 — антитела обнаружены

  • свидетельствует о наличии антител к хеликобактеру, что может быть при текущей инфекции либо еще какое-то время после проведенного лечения

Результат 0,9 – 1,1 — сомнительный результат.

  • рекомендуется повторное исследование через 1- 2 недели, в случае инфицирования в повторном исследовании антитела будут обнаружены (т.е. уровень антител повысится).

Сроки выполнения теста.

1-2 дня

Как подготовиться к анализу?

Кровь можно сдать утром натощак или в течение дня через 3 часа после необильного приёма пищи.

Сдать анализ на хеликобактер (кровь на Helicobacter), антитела IgG

Описание анализа:

Хеликобактер, антитела IgG – анализ, определяющий, есть ли в крови антитела к бактерии Helicobacter pylori и, следовательно, сама бактерия. Этот микроорганизм является одним из факторов, способствующих появлению гастрита, дуоденита, язвенной болезни желудка и двенадцатиперстной кишки.

Хеликобактер с легкостью передается от человека к человеку, быстро заселяет слизистые оболочки желудки и двенадцатиперстной кишки, выделяя в процессе существования вредные для них токсины. Хотя хеликобактер, по статистике, обнаруживается у каждого второго, гастрит развиваются лишь у 15% зараженных, а у остальных не наблюдается каких-либо симптомов. В тоже время, заражение хеликобактером повышает риск развития рака желудка.

Хеликобактер способствует появлению гастрита, дуоденита и язвенной болезни, но он не единственная их причина. Генетическая склонность, частые стрессы, курение, нерациональное питание, злоупотребление алкоголем и прием лекарств, вредящих слизистой гастродуоденальной зоны также играют важную роль.

В ответ на заражение человеческий организм начинает выработку трех типов иммуноглобулинов (антител) против инфекции: IgM, IgA и IgG. В первую очередь, после инфицирования нарастает IgM, а затем, в течение длительного времени IgA и IgG. Ключевую роль в диагностике играют именно IgG-антитела, которые обнаруживаются у 95-100% зараженных. Для сравнения, IgA удается выявить лишь у 70-80%, а IgМ – у 15-20% пациентов с хеликобактером.

Данный метод обследования достаточно чувствителен и не требует проведения гастроскопии для взятия образца на анализ. Но важно учитывать, что тест определяет наличие антител к бактерии, а не самой бактерии. Потому при слабой иммунной реакции (такая возможна, к примеру, у пожилых пациентов или людей с иммуносупрессией), тест может давать ложноотрицательный результат.

Показания к назначению анализа

Исследование обычно назначается гастроэнтерологом, терапевтом, педиатром или инфекционистом в следующих случаях:

  • симптомы гастрита, дуоденита;
  • признаки язвы желудка или двенадцатиперстной кишки;
  • контроль эффективности лечения хеликобактериоза.

Значение результатов

Результаты анализа на хеликобактер измеряются в единицах на миллилитр (Ед/мл или U/ml). При значении менее, чем 0,9 единиц на миллилитр, результат анализа считается отрицательным, при значении 1,1 Ед/мл и более – положительным. Значения от 0,9 до 1,09 Ед/мл относятся к промежуточным и означают сомнительный результат (нельзя достоверно утверждать, что антитела к хеликобактеру присутствуют или отсутствуют).

Если речь идет о контроле эффективности лечения, то об успешности терапии свидетельствует не полное исчезновение антител, уменьшение их количества на 20-25% спустя полгода после лечения.

Подготовка к обследованию: специальной подготовки не требуется.

Материал для исследования: кровь из вены.

Метод исследования: ИХЛА (иммунохемилюминесцентный анализ).

Сроки проведения анализа: 1 рабочий день.

Запись на анализы

Жизнь без хеликобактера в Челябинске

Записаться на прием

Ваш телефон*

Мы вам перезвоним в ближайшее время.

Количество инфицированных Helicobacter pylori (HP) на сегодняшний день составляет более половины населения планеты. Среди россиян распространенность бактерии очень большая – в разных регионах от 70 до 90% людей, что значительно выше показателей Европы и США.

Хеликобактер провоцирует развитие хронического гастрита, язвенной болезни желудка и двенадцатиперстной кишки, MALT-лимфомы желудка, а также рака желудка.

Что такое хеликобактер пилори

Это патогенная бактерия-паразит имеет спиралевидную форм, обитает в слизистой желудка и 12-перстной кишки. Helicobacter pylori производит множество токсинов, и приводит к воспалительным процессам.

В 2005 году ученые Барри Маршал и Робин Уоррен получили Нобелевскую премию в области медицины за доказательство возможности возникновения гастрита после заражения бактерией Helicobacter pylori. Они опровергли ранее существовавшее мнение о роли питания, стресса и повышенной кислотности в причинах язвы желудка.

Проблема с лечением хеликобактер пилори связана с жизнеспособностью бактерии к кислой агрессивной среде.

 

Причины заражения

Хеликобактерии передаются в основном через слизь и слюну человека. Существует три основных механизма передачи: 

  • орально-оральный (через посуду, поцелуи, пользование общими предметами гигиены)

  • орально-фекальный (грязные руки, загрязненные продукты питания и вода) 

  • ятрогенный (эндоскопические исследования, зондирования, стоматологические мероприятия и др.) 

Нередко инфекция носит «семейный» характер – если Helicobacter pylori обнаружена у одного из представителей семьи, то с очень большой вероятностью инфицируются и остальные.

 

Когда следует пройти обследование

Насторожить вас должны следующие симптомы:

  • частая изжога и отрыжка

  • дискомфорт, тяжесть и давления в области желудка после приема еды

  • тошнота

  • боли в эпигастральной области (верхняя и средняя часть живота)

  • вздутие живота и повышенное газообразование

  • нарушение стула

Кроме перечисленного, обязательно необходимо пройти диагностику, если хеликобактер был обнаружен у кого-то из членов вашей семьи, а также при таких заболеваниях, как гастрит, язвенная болезнь, гастродуоденит.

 

Методы диагностики

  1. Исследовании биоптата слизистой желудка при проведении гастроскопии. Этот метод диагностики позволяет не только выявить хеликобактер, но и найти изменения слизистой оболочки желудка (атрофия, метаплазия, дисплазия), обусловленные воздействием хеликобактера и приводящие к возникновению рака желудка.

  2. ИФА – иммуноферментный анализ крови на выявление антител на хеликобактер пилори. Организм человека вызывает ответную реакцию иммунной системы на бактерию (антитела). Но стоит иметь в виду, что такой анализ показывает факт попадания HP в организм, но не отражает его присутствие в организме на момент исследования.

  3. Анализ кала методом полимеразной цепной реакции (ПЦР). Он является самым простым видом диагностики. Его рекомендуют детям, пожилым людям и тяжелобольным пациентам.

  4. Дыхательный уреазный тест на Хеликобактер пилори. Он основан на способности HP синтезировать уреазу – особый фермент, который расщепляет находящуюся в кишечнике мочевину до углекислого газа и аммиака. Углекислый газ выделяется при дыхании из легких пациента, и при проведении теста оценивают его концентрацию до приема мочевины и после. Это наиболее простой и быстрый тест на наличие инфекции.

Выбор метода исследования зависит от многих факторов. Однако все описанные виды лабораторных анализов отличаются точностью и позволяют врачу представить клиническую картину.

Подготовка к дыхательному тесту

  1. Исследование выполняется строго натощак и утром. Накануне возможен легкий ужин, не позднее 22:00. Возможно употребление воды, не позже чем за 1 час до исследования и не более 100 мл.

  2. Тест не проводится, если пациент принимает антибиотики, антисекреторные, противовоспалительные препараты, антациды и анальгетики. Выполнить исследование можно по прошествии 2-х недель после завершения приема антисекреторных препаратов и антибиотиков. После приема остальных указанных препаратов перерыв должен быть не менее 5 дней.

  3. За три дня до исследования исключите алкоголь.

  4. В течении 24 часов убрать из рациона бобовые продукты.

  5. В день исследования исключить жевательную резинку.

  6. Отказаться от курения в день обследования.

  7. Перед процедурой тщательно почистить зубы и прополоскать рот водой.

 

Лечение

Обнаружив в организме НР, решение о её эрадикации (уничтожении) специалист принимает исходя из анамнеза пациента. Бактерия эффективно уничтожается с помощью антибиотиков (кларитромицин, амоксициллин). Эрадикация необходима, если у больного диагностированы язва или гастрит.

При отсутствии должного лечения патологии будут развиваться, наихудший прогноз — рак желудка.

 

Профилактика заражения

  • Мойте руки перед едой.

  • Не пейте и не ешьте из чужой посуды.

  • Не откусывайте от чужого яблока или бутерброда, когда вам предлагают его попробовать. Донесите эту информацию до своих детей.

  • Не используйте чужую зубную щетку.

  • Избегайте приветственных поцелуев с не очень близкими людьми


 Если Вы не уверены в своём здоровье – пройдите дыхательный экспресс-тест на Helicobacter pylori, защитите себя от его неприятных последствий.

Цены

Уважаемые пациенты!
Обращаем Ваше внимание, что стоимость визита к врачу не всегда совпадает с указанной ценой приёма. Окончательная стоимость приема может включать стоимость дополнительных услуг. Необходимость оказания таких услуг определяется врачом в зависимости от медицинских показаний непосредственно во время приёма.

Наименование

Стоимость

Диагностика Хеликобактер Пилори в Запорожье в МЦ «ШЕКИ»

Хеликобактер Пилори – патогенные бактерии, которые поражают желудок и двенадцатиперстную кишку. Именно эти коварные маленькие паразиты провоцируют различные недомогания со стороны желудка, вплоть до серьезных болезней – язвы желудка и двенадцатиперстной кишки. Микроорганизмы отличаются выработкой сильнодействующих токсинов, вызывающих воспалительные процессы в слизистой оболочки ЖКТ.
За открытие данной бактерии, как причины развития патологий желудочно-кишечного тракта, австралийские ученые в 2005 году были удостоены Нобелевской премии. Сдать анализ на Хеликобактер Пилори в Запорожье можно в лаборатории медицинского центра «ШЕКИ». Результат будет готов уже на следующий день! Важно знать, как правильно подготовиться к сдаче анализа!

Как можно заразиться Хеликобактер Пилори?

Заразиться данной инфекцией очень просто, если в круг вашего общения входит инфицированный  человек. Многие не знают о том, что являются источником заражения Хеликобактер Пилори, так как все свои недомогания желудочно-кишечного тракта объясняют погрешностями питания, гастритом, генетической предрасположенностью, стрессами  и т.д. Поэтому, лабораторная диагностика имеет столь огромное значение для выявления данных микроорганизмов. Как правило, при длительном течении болезней ЖКТ, врач назначает анализ на Хеликобактер Пилори.
Инфицирование происходит бытовым путем и воздушно-капельным от больного человека. Часто, если один из членов семьи имеет язву желудка, гастрит или другие болезни ЖКТ, вызванные данной бактерией, то и все члены семьи инфицируются данной бактерией. По статистике, около 70% населения являются носителями данной бактерии.
Кислая среда желудка, которая разрушает многие препараты, помогает переваривать пищу, является благоприятной средой для развития этих микроорганизмов.  Разрушенная слизистая желудка токсинами бактерии, становится уязвимой для воздействия желудочного сока. Образуются эрозии и язвы желудка и двенадцатиперстной кишки.

Кому врачи могут назначить анализ на Хеликобактер Пилори?

Достаточно долгий период времени, причины возникновения заболеваний желудка и двенадцатиперстной кишки вращались вокруг особенностей жизни, привычек человека и стрессовых ситуаций с которыми сталкивается человек ежедневно. Сегодня, часто причиной болезней оказывается Хеликобактер Пилори. Поэтому, врачи гастроэнтерологи могут назначить исследование в следующих случаях:

  • При установленной язве желудка или двенадцатиперстной кишки
  • При хроническом гастрите
  • При постоянных болях в животе, метеоризме, спазмах
  • При неприятном запахе изо рта, отрыжке
  • При нарушении микрофлоры кишечника
  • При частых запорах
  • При частой диареи и др.

Анализ назначается врачом и в соответствии с результатом назначается лечение. Ведь, сложно вылечить, например, гастрит или язву, если причина их возникновения ни хронический стресс, а бактерия!

ИФА

Иммуноферментная диагностика Хеликобактер Пилори позволяет выявить антитела к ней и дает возможность врачу установить причину возникновения заболевания. В лаборатории медицинского центра «ШЕКИ» проводится анализ кала на выявление антигена к бактерии и анализ крови на предмет выявления иммуноглобулинов группы G. Положительный результат анализа до начала лечения, говорит о том, что пациент инфицирован и требует лечения. Положительный результат после окончания лечения через неделю, говорит о том, что лечение было неэффективно.  Отрицательный результат через месяц после окончания терапии говорит об эффективности лечения.

Сдать анализ кала на Хеликобактер Пилори в Москве

Тип бактерий хеликобактер пилори способен вызывать многие из заболеваний, поражающих органы пищеварения, в том числе и язвенную болезнь.

До недавнего времени существование данного микроорганизма и его влияние на здоровье человека вызывало у многих медиков большие сомнения. Теперь то, что язвенная болезнь может возникнуть, как и любое инфекционное заболевание, является доказанным фактом.

Helicobacter pylori (H. pylori)– это бактерия, которая обитает в покрывающей слизистую оболочку желудка субстанции-слизи. Инфицирование H. pylori является широко распространенным явлением. Согласно данным эпидемиологов, обнаружить наличие в желудке этой бактерии можно приблизительно у половины людей на планете, а в ряде регионов у 80–100% населения.

Инфицирование, как правило, происходит еще в детском возрасте и сохраняется на протяжении все жизни. По большей части присутствие H. pylori не создает каких-либо проблем, но у ряда лиц в качестве реакции на инфицирование формируются локальные воспалительные процессы, проявляющиеся через дуоденит, гастрит.

Приблизительно у 5% инфицированных лиц бактерией Н. pylori, развиваются язвенные процессы двенадцатиперстной кишки, желудка. Реже формируются хронические воспаления, связанные с бактерией H. pylori, что приводит к атрофическим явлениям в слизистой оболочке (атрофическому гастриту) – патологии, связанной с вероятностью формирования онкологических процессов в желудке. Риск развития такого рода опасных состояний во многом зависит от штамма H. pylori и вирулентных факторов, индивидуальных особенностей и характерных реактивных явлений на наличие H. pylori, воздействия жизненных условий жизни, в том числе, диет. Изучаемая инфекция эффективно элиминируют (эрадикация H. pylori), но данная ситуация не исключает вероятность последующего инфицирования в будущем. Вопрос о важности эрадикации H. pylori должен решаться в индивидуальном порядке. Тактические действия лечащего врача в основном зависит от клинических проявлений наличия инфекции и, что не менее важно, присутствия патологических изменений в слизистой оболочке двенадцатиперстной кишки и желудка.

Бактерия хеликобактер пилори устойчива ко многим видам воздействия, хорошо сохраняется при неблагоприятных условиях окружающей среды, что позволяет ей активно размножаться на слизистой желудка.

Что показывает анализ

Анализ на хеликобактер пилори помогает выявить присутствие патогенного микроорганизма в организме, так как она может в течение долгого времени никак не проявлять себя.

Появление первых симптомов патологии начинается после снижения уровня иммунитета. После ее выделения и посева появляется возможность подобрать препараты, способные остановить рост и развитие данного микроорганизма.

Как проводится анализ

Анализ имеет смысл проводить в течение недели после появления первых симптомов заболевания, дальше концентрация микроорганизмов в кале значительно уменьшиться и обнаружить их будет сложно.

Необходимый результат, выявить хеликобактером можно одним из трех способов:

  • ПЦР.
  • Бакпосев.
  • ИФА (проводится параллельно, изучается кровь).

В анализе кала ищут антиген к хеликобактер пилори или остатки частей ДНК. Для этого в лаборатории имеется контрольный образец генетического кода бактерии, специальный прибор ищет подобные частицы в предоставленном для исследования материале.

Helicobacter pylori, IgG (количественно): исследования в лаборатории KDLmed

Выявление иммуноглобулинов класса G (IgG) к Helicobacter pylori в сыворотке крови, используемое для диагностики антрального и фундального гастрита, язвы желудка и двенадцатиперстной кишки, а также для контроля за их лечением.

Синонимы русские

Хеликобактер, иммуноглобулины класса G, IgG-антитела.

Синонимы английские

Helicobacter pylori Antibody, IgG; Anti-Helicobacter pylori antibody, IgG (quantitative).

Метод исследования

Твердофазный хемилюминесцентный иммуноферментный анализ («сэндвич»-метод).

Какой биоматериал можно использовать для исследования?

Венозную кровь.

Как правильно подготовиться к исследованию?

Не курить в течение 30 минут до сдачи крови.

Общая информация об исследовании

Инфицирование H. pylori сопровождается развитием местного и системного иммунного ответа. Вслед за транзиторным увеличением титра иммуноглобулинов класса М (IgM) следует продолжительное и значительное нарастание IgG-, а также IgA-антител в сыворотке крови. Определение концентрации иммуноглобулинов (серологическое исследование) применяют в диагностике хеликобактериоза. IgG обнаруживаются в 95-100 % случаев инфицирования H. pylori, IgA – в 68-80 %, а IgM – лишь в 15-20 %. Поэтому для подтверждения инфицирования H. pylori определяют концентрацию IgG в сыворотке крови. Этот анализ имеет ряд преимуществ перед другими лабораторными методами выявления хеликобактера.

Определение IgG в крови не требует эндоскопического исследования, поэтому является более безопасным способом диагностики. Так как чувствительность теста сопоставима с чувствительностью большинства инвазивных анализов (быстрый уреазный тест, гистологическое исследование), он оказывается особенно полезным, когда выполнение эндоскопии не планируется. Следует, однако, отметить, что тест не выявляет непосредственно микроорганизм и зависит от особенностей иммунного ответа пациента. Так, например, иммунный ответ пожилых людей характеризуется пониженной выработкой специфических антител (любых, в том числе к H. pylori), что необходимо учитывать, если получен отрицательный результат анализа при клинических признаках диспепсии. Кроме того, иммунный ответ подавляется при приеме некоторых цитостатических препаратов.

Анализ на IgG может быть с максимальным успехом применен для диагностики первичного инфицирования H. pylori (например, при обследовании молодого пациента с впервые возникшими признаками диспепсии). В этой ситуации высокий титр IgG позволяет заподозрить активную инфекцию. Также положительный результат анализа у пациента (с признаками диспепсии в анамнезе или без них), не получавшего терапию, будет указывать на хеликобактериоз.

Интерпретация положительного результата анализа в случае, если была проведена терапия (или если антибиотики, обладающие активностью против H. pylori, были применены в других целях), имеет некоторые особенности. Уровень IgG остается высоким в течение длительного времени после полной гибели микроорганизма (около половины пациентов, вылечившихся от H. pylori, будут иметь высокие титры IgG еще 1-1,5 года). В результате положительный результат анализа у пациента, принимавшего антибиотики, не позволяет дифференцировать активную инфекцию и инфекцию в анамнезе и требует проведения дополнительных лабораторных исследований.

По этой же причине, исследование на IgG не является основным тестом для диагностики эффективности терапии. Однако оно может быть применено с этой целью, если титр антител на момент начала болезни сравнивается с титром после окончания лечения. Считается, что снижение концентрации IgG на 20-25 % в течение 6 месяцев косвенно указывает на гибель микроорганизма. В то же время, если эта концентрация не снижается, это не означает неэффективность терапии. Отсутствие IgG-антител при повторном анализе свидетельствует об успешности лечения и избавлении от микроорганизма.

Количество IgG к H. pylori также является одним из компонентов, по которому судят о состоянии слизистой оболочки желудка (это так называемая серологическая биопсия).

Для чего используется исследование?

Для диагностики заболеваний, вызванных H. pylori, и контроля за их лечением:

  • антрального и фундального гастрита;
  • язвы двенадцатиперстной кишки или желудка.

Когда назначается исследование?

  • При обследовании пациента с впервые возникшими признаками диспепсии (первичное инфицирование H. pylori), особенно если эндоскопия не планируется.
  • При обследовании пациента с указанием на диспепсию в анамнезе, если не назначалась терапия H. pylori (или если антибиотики, активные против H. pylori, не использовались по другому поводу).
  • При первичной диагностике хеликобактериоза и через 6 месяцев после окончания курса его терапии.

Что означают результаты?

Референсные значения

Результат: отрицательно.

Концентрация: 0 — 0,9.

Причины положительного результата

  • Активная инфекция H. pylori:

a) снижение титра антител на 20-25 % в течение в течение 6 месяцев после окончания антибактериальной терапии косвенно указывает на гибель микроорганизма;

b) отсутствие тенденции к снижению IgG не говорит о неэффективности терапии.

  • инфекция H. pylori в анамнезе.

Причины отрицательного результата:

  • отсутствие инфекции H. pylori;
  • гибель микроорганизма после курса антибиотикотерапии;
  • неправильное взятие биоматериала для исследования.

Что может влиять на результат?

Иммунный ответ пожилых людей, а также пациентов, получающих иммуносупрессивную терапию, характеризуется пониженной выработкой специфических антител, в том числе к H. pylori, что приводит к большему числу ложноотрицательных реакций теста в этой группе пациентов.

Важные замечания

  • Положительный результат исследования следует интерпретировать с учетом дополнительных данных (в частности, нужно учитывать эрадикационную терапию или прием антибиотиков, активных в отношении H. pylori, в других целях).

Также рекомендуется

Кто назначает исследование?

Гастроэнтеролог, педиатр, врач общей практики, инфекционист.

Литература

  • Glupczynski Y. Microbiological and serological diagnostic tests for Helicobacter pylori: an overview. Br Med Bull. 1998;54(1):175-86.
  • Mark Feldman, MD; Byron Cryer, MD; Edward Lee, MD; Walter L. Peterson, MD. Role of Seroconversion in Confirming Cure ofHelicobacter pylori Infection. JAMA. 1998;280(4):363-365. doi:10.1001/jama.280.4.363
  • Athanasios Makristathis, Alexander M. Hirschl, Philippe Lehours, Francis Mégraud,. Diagnosis of Helicobacter pylori Infection. Helicobacter. Volume 9, Issue Supplement s1, pages 7–14, August 2004.
  • Chernecky C. C. Laboratory Tests and Diagnostic Procedures / С.С. Chernecky, В.J. Berger; 5th ed. – Saunder Elsevier, 2008.

тестов на Helicobacter Pylori | Мичиган Медицина

Обзор теста

Helicobacter pylori Тесты используются для выявления инфекции Helicobacter pylori ( H. pylori ) в желудке и верхней части тонкой кишки (двенадцатиперстной кишке). H. pylori может вызывать пептические язвы. Но у большинства людей с H. pylori в пищеварительной системе язвы не развиваются.

Четыре теста используются для обнаружения H.pylori :

  • Анализ крови на антитела. Анализ крови проверяет, вырабатывает ли ваш организм антитела к бактериям H. pylori . Если у вас есть антитела к H. pylori в вашей крови, это означает, что вы либо инфицированы в настоящее время, либо были инфицированы в прошлом.
  • Дыхательный тест на мочевину. Дыхательный тест на мочевину проверяет наличие в желудке бактерий H. pylori .Этот тест может показать, есть ли у вас инфекция H. pylori . Его также можно использовать, чтобы узнать, помогло ли лечение избавиться от H. pylori .
  • Тест стула на антиген. Тест на антиген стула проверяет, присутствуют ли в ваших фекалиях (стуле) вещества, которые запускают иммунную систему для борьбы с инфекцией H. pylori ( антигенов H. pylori ). Для подтверждения диагноза H.pylori или чтобы узнать, было ли успешным лечение инфекции H. pylori .
  • Биопсия желудка. Небольшой образец (биопсия) берется из слизистой оболочки желудка и тонкой кишки во время эндоскопии. С образцом биопсии можно провести несколько различных тестов.

Почему это сделано

H. pylori сдаются анализы по:

  • Узнайте, есть ли инфекция H.pylori могут вызывать язву или раздражение слизистой оболочки желудка (гастрит).
  • Узнайте, сработало ли лечение инфекции.

Как подготовить

Анализ крови на антитела

В общем, вам ничего не нужно делать перед этим тестом, если только ваш врач не скажет вам об этом.

Анализ стула на антиген

Лекарства могут изменить результаты этого теста. Обязательно сообщите врачу обо всех лекарствах, отпускаемых по рецепту и без рецепта.Ваш врач может порекомендовать вам прекратить прием некоторых из ваших лекарств.

  • Не принимайте антибиотики или лекарства, содержащие висмут (например, пепто-бисмол) в течение 1 месяца до исследования.
  • Не принимайте ингибиторы протонной помпы (такие как Нексиум или Прилосек) за 2 недели до теста.

Биопсия желудка или дыхательный тест с мочевиной

Вам будет предложено ничего не есть и не пить в течение определенного времени перед проведением проверки дыхания или биопсии желудка.Следуйте инструкциям врача о том, как долго вам нужно избегать еды и питья до обследования.

Многие лекарства могут изменить результаты этого теста. Обязательно сообщите врачу обо всех лекарствах, отпускаемых по рецепту и без рецепта. Ваш врач может порекомендовать вам прекратить прием некоторых из ваших лекарств.

  • Не принимайте антибиотики или лекарства, содержащие висмут (например, пепто-бисмол) в течение 1 месяца до исследования.
  • Не принимайте ингибиторы протонной помпы за 2 недели до исследования.
  • Не принимайте блокаторы h3, такие как Пепцид или Тагамет, за 24 часа до теста.

Как это делается

Анализ крови на антитела

Медицинский работник использует иглу для взятия пробы крови, обычно из руки.

Дыхательный тест на мочевину

Образец дыхания собирается, когда вы надуваете воздушный шар или надуваете пузыри в бутылку с жидкостью. Медицинский работник:

  • Перед началом теста возьмите образец своего дыхания.
  • Дайте вам капсулу или немного воды для проглатывания, которая содержит меченый или радиоактивный материал.
  • Соберите больше образцов своего дыхания. Образцы будут проверены на предмет наличия в них материала, образующегося при контакте H. pylori с меченым или радиоактивным материалом.

Анализ стула на антиген

Для этого теста вас могут попросить собрать образец стула дома. Для сбора пробы необходимо:

  • Перенести стул в сухой контейнер.Можно собирать как твердый, так и жидкий стул. Будьте осторожны, не допускайте попадания мочи или туалетной бумаги вместе с образцом стула.
  • Закройте крышку емкости. Наклейте на контейнер свое имя, имя врача и дату взятия пробы.
  • Тщательно вымойте руки после взятия пробы.
  • Отнесите запечатанный контейнер в кабинет врача или в лабораторию как можно скорее.

Биопсия желудка

Процедура, называемая эндоскопией, используется для сбора образцов ткани желудка и первой части тонкой кишки.Образцы тканей проверяются в лаборатории, чтобы определить, содержат ли они H. pylori .

Каково это

Анализ крови на антитела

При взятии пробы крови игла может вообще ничего не чувствовать. Или вы можете почувствовать укол или ущипнуть.

Дыхательный тест на мочевину

Этот тест обычно не вызывает боли или дискомфорта.

Анализ стула на антиген

Этот тест обычно не вызывает боли или дискомфорта.

Если ваш врач собирает образец во время ректального исследования, вы можете почувствовать некоторое давление или дискомфорт, когда ватный тампон вводится в вашу прямую кишку.

Биопсия желудка

Вы можете заметить кратковременную острую боль, когда игла для внутривенного введения вводится в вену на руке. Местный анестетик, впрыскиваемый вам в горло, обычно имеет немного горький привкус и вызывает онемение и опухание языка и горла. Некоторые люди сообщают, что иногда им кажется, что они не могут дышать из-за трубки в горле, но это ложное ощущение, вызванное анестетиком.Вокруг трубки во рту и в горле всегда остается достаточно места для дыхания. Не забывайте расслабляться и делать медленные глубокие вдохи.

При перемещении трубки у вас может возникнуть рвота, тошнота, вздутие живота или легкие спазмы в животе. Даже если вы не сможете разговаривать во время процедуры из-за трубки в горле, вы все равно можете общаться. Если дискомфорт серьезный, предупредите врача согласованным сигналом или похлопыванием по руке.

Лекарства, вводимые внутривенно, вызывают сонливость.Другие побочные эффекты, такие как тяжелые веки, проблемы с речью, сухость во рту или помутнение зрения, могут длиться в течение нескольких часов после теста. Лекарства также могут заставить вас не вспомнить многое из того, что происходит во время теста.

Риски

Анализ крови на антитела

В этом тесте очень малая вероятность возникновения проблемы. При заборе крови на месте может образоваться небольшой синяк.

Дыхательный тест на мочевину

Нет известных рисков или осложнений при проведении дыхательного теста на мочевину.Если используется радиоактивный углерод, степень воздействия радиоактивности чрезвычайно мала — меньше, чем вы обычно получаете, находясь на улице в течение дня.

Анализ стула на антиген

Нет никаких рисков или осложнений с анализом стула. Но если вы не вымойте руки после сбора образца, вы можете распространить микробы.

Биопсия желудка

Существует небольшой риск (1 из 10 000) прокола стенки пищевода, желудка или двенадцатиперстной кишки во время эндоскопии для взятия образцов биопсии желудка.Биопсия может также вызвать кровотечение в том месте, где собираются образцы. Но кровотечение обычно останавливается без лечения.

Результаты

Результаты дыхательного теста на мочевину или анализа стула на антиген обычно доступны в течение нескольких часов. Результаты анализа крови на антитела обычно доступны в течение 24 часов. Результаты биопсии, взятой при эндоскопии, обычно доступны в течение 48 часов. На получение результатов посевной биопсии может уйти до 10 дней.

Анализ крови на антитела

Нормальный:

Образец крови не содержит антител H. pylori .

Ненормально:

В пробе крови содержится H.pylori .

Дыхательный тест на мочевину

Нормальный:

Образец выдыхаемого воздуха не содержит меченый углекислый газ.

Ненормально:

Образец выдыхаемого воздуха содержит меченый углекислый газ.

Анализ стула на антиген

Нормальный:

Образец кала не содержит антигенов H. pylori .

Ненормально:

Образец стула содержит H.pylori .

Биопсия желудка

Нормальный:

Образец биопсии не содержит бактерий H. pylori .

Бактерии H. pylori не растут в культуре образцов биопсии ткани.

Ненормально:

Образец биопсии содержит бактерий H.pylori бактерий.

H. pylori бактерий растет в культуре образцов биопсии ткани.

Кредиты

Текущий по состоянию на: 15 апреля 2020 г.

Автор: Healthwise Staff
Медицинский обзор:
Э. Грегори Томпсон, врач внутренних болезней
Адам Хусни, доктор медицины, семейная медицина

По состоянию на: 15 апреля 2020 г.

Helicobacter pylori (H.pylori) Анализы крови

H Pylori Тест на H. pylori, также известный как тест на хеликобактер пилори, используется для определения наличия у человека инфекции H. pylori. H. pylori — это микроаэрофильная бактерия, связанная с желудочно-кишечными проблемами, такими как острый или хронический гастрит, язва желудка и рак желудка. H. pylori можно обнаружить в желудке и в верхней части кишечника. Он выживает в кислых условиях желудка, проникая в слизистую оболочку желудка, где условия менее интенсивны.H. pylori присутствует более чем у 50 процентов населения, но более 80 процентов инфицированных не имеют никаких признаков или симптомов. Симптомы H. pylori Хотя у большинства людей нет никаких внешних признаков или симптомов, симптомы могут быть довольно серьезными. Признаки и симптомы инфекции H. pylori могут включать боль в животе, чувство жжения в животе, снижение интереса к пище, рвоту, потерю веса, вздутие живота и учащение отрыжки. Следует немедленно вызвать врача, если рвота или стул черные, или если у вас сильная или постоянная боль в животе.Люди, у которых инфекция протекает бессимптомно, могут передать инфекцию другому человеку, у которого появятся симптомы. Если у кого-то есть основания полагать, что у него или нее инфекция, симптоматическая или нет, ему следует подумать о сдаче анализов. Что вызывает H. pylori? Врачи и медицинские исследователи не уверены, что вызывает инфекцию пилори. Как получить H. pylori? Врачи считают, что он передается от человека к человеку через контакт со слюной, рвотой или фекалиями другого человека.Зараженная посуда или зараженная еда или напитки также могут распространять инфекцию. Таким образом, одним из основных факторов риска заражения hpylori является проживание с кем-то, кто уже инфицирован. Возраст также является фактором риска, поскольку у детей гораздо больше шансов заразиться H. pylori. Жизнь в многолюдной среде обитания увеличивает риск распространения заболевания. В западных странах наблюдается снижение распространенности случаев инфицирования hylori, тогда как люди, живущие в развивающихся странах, или люди, не имеющие постоянного доступа к чистой воде, подвергаются большему риску.Как работает анализ крови Анализ крови на хеликобактер пилори работает, проверяя кровь на антитела к хеликобактерной инфекции. Антитела — это тип белка, высвобождаемого иммунной системой в ответ на присутствие чужеродных веществ, таких как инфекция. Антитела H. pylori созданы специально для противодействия негативным последствиям инфекции H. pylori. Антитела, созданные в ответ на H. pylori, выглядят иначе, чем антитела, созданные для других целей. Если эти антитела присутствуют в крови, это означает, что человек либо в настоящее время инфицирован, либо инфицирован H. pylori.После того, как человек прошел курс лечения от h pylori, анализ крови на h pylori по-прежнему будет положительным. Подготовка к тесту на антитела к H.pylori не требуется, и результаты обычно можно обработать в течение одного дня после забора крови. Лечение H. pylori Инфекции H. pylori обычно лечат одновременно двумя видами антибиотиков, чтобы предотвратить развитие устойчивости бактерий к одному конкретному антибиотику. Ваш врач также пропишет вам препарат, подавляющий кислоту, чтобы помочь заживлению слизистой оболочки желудка.Благодарим вас за просмотр нашей подборки анализов крови и панелей H Pylori Test. Покупайте дополнительные тесты на инфекционные заболевания конфиденциально и заказывайте онлайн без страховки или справки от врача.

Выберите одну лабораторию: LABCORP (LC) или QUEST (QD) или ВСЕ

Walk-In Lab заключила контракт с LabCorp (LC) и Quest Diagnostics (QD) на проведение рутинных лабораторных испытаний. Для завершения заказа выберите LC или QD. Если вы предпочитаете получать набор для сбора образцов по почте, ознакомьтесь с нашими наборами для домашних тестов.Тесты LC и QD необходимо заказывать отдельно.

LabCorp: Онлайн-лабораторное тестирование запрещено в Массачусетсе, Мэриленд, Нью-Йорке, Нью-Джерси и Род-Айленде.

Quest Diagnostics: Онлайн-лабораторное тестирование запрещено в штатах Нью-Йорк, Нью-Джерси и Род-Айленд.

H Pylori — Что вам нужно знать

Что вам нужно знать о H. pylori

Helicobacter pylori (HEL-ik-oh BAK-ter pie-LOR-ee) — это инфекция, которая, как известно, при обнаружении в желудке вызывает некоторые проблемы с желудком, включая язву желудка.Фактически, хотя острая пища может ухудшить самочувствие язвы, они не являются причиной язвы желудка, как когда-то считалось — большинство язв вызывается инфекцией H. pylori.

Еще одна важная вещь, которую нужно знать о H. pylori, — это то, что она считается чем-то, что вызывает рак у людей. Хотя большинство людей с H. pylori не болеют раком, большинство людей с раком желудка заболевают им в результате инфекции H. pylori.


Кто заражается H. pylori?

Любой человек может заразиться H. pylori.Он есть примерно у половины людей в мире. В Соединенных Штатах этим заболеванием страдает примерно каждый третий человек, хотя он чаще встречается среди неиспаноязычных чернокожих и испаноязычных американцев и наиболее распространен среди людей из Юго-Восточной Азии.


Как вас тошнит от H. pylori?

Инфекция H. pylori представляет собой насекомое в форме спирали — вот что означает хеликобактер — «гелико» для «спирали» или «спираль» и «бактерия» для «бактерии». Жук по спирали проникает в защитную оболочку желудка, повреждая его и позволяя желудочным кислотам проникать к стенке желудка.Жук также может раздражать клетки желудка и вызывать слишком много кислоты в желудке.

Во многих случаях H. pylori не активизируется и вызывает заболевание. Когда это происходит, проблемы могут включать «изжогу», расположенную ниже груди и выше живота (область, называемую верхней частью живота), которая длится или продолжается.


Как распространяется? Считается, что

H. pylori передается через зараженную пищу и воду, а также при прямом контакте со слюной. В большинстве случаев заражение происходит в детстве, особенно у детей, живущих в бедных, многолюдных районах с плохим вывозом мусора.


H. pylori: Вы 1 из 3?

Примерно треть людей в Соединенных Штатах страдает инфекцией желудка, вызванной H. pylori. В большинстве случаев эта инфекция не становится проблемой. Но если вы страдаете от несварения желудка, которое либо не проходит, либо продолжает возвращаться, поговорите со своим врачом о тестировании на H. pylori. Это просто и может только помочь.


Как узнать, есть ли у меня H. pylori?

Для многих людей в возрасте 55 лет и младше медицинские руководства рекомендуют два типа тестирования, чтобы узнать, инфицированы ли вы H. pylori:

  • Дыхательный тест.Для этого теста вы делаете вдох в мешок для сбора, чтобы получить образец первого вдоха. Затем вы выпиваете безвредный раствор и после короткого ожидания дышите во второй мешок для сбора. Лаборатория проверяет наличие изменений между первым и вторым образцами, которые говорят о том, есть ли у вас H. pylori. Запросите тестирование у своего врача или посетите www.MyLabReQuest.com , чтобы узнать, как сделать заказ без назначения врача.

  • Тест стула. Для этого теста требуется образец стула; лаборатория проверяет его на наличие
    H. pylori.

Оба теста обладают высокой точностью, одобрены FDA и рекомендованы Американской гастроэнтерологической ассоциацией (AGA) и Американским колледжем гастроэнтерологии (ACG). Оба теста могут быть покрыты страховкой. Важно: хотя может быть доступен анализ крови на H. pylori, он не так точен, как два других теста, и больше не рекомендуется. По этим причинам некоторые страховщики больше не будут оплачивать анализ крови на H. pylori.


Третий вариант: тест «объема»

Если вам больше 55 лет или у вас есть то, что врачи называют «тревожными симптомами», например желудочное кровотечение, медицинские эксперты рекомендуют пройти тест на H. pylori с помощью процедуры, называемой анэндоскопией (en-DOSS-ko-pee).Этот тест проводится в больнице. Он включает в себя продвижение трубки с камерой к желудку и тонкому кишечнику для исследования обоих органов. Через трубку можно провести крошечный инструмент, чтобы удалить часть ткани, чтобы врачи проверили ее на H. pylori. Этот тест считается очень точным, но используется только в определенных случаях.


Как лечить H. pylori?

После диагностики активной инфекции H. pylori лечение может включать следующее:

  • Комбинация препаратов, убивающих бактерии, называемых антибиотиками
  • Лекарство, такое как Пепто-Бисмол
  • Другое лекарство для снижения кислотности в желудке

По крайней мере, через две недели после окончания лечения вам следует снова пройти обследование, чтобы убедиться, что H. pylori нет.AGA рекомендует это. Просто вспомните тест-лечение-тест.


Предотвращает ли лечение рак желудка?

Есть некоторые доказательства того, что раннее лечение H. pylori может снизить риск рака желудка, хотя для уверенности врачей необходимы дополнительные доказательства. К счастью, лишь очень небольшое количество пациентов с H. pylori — менее 1 из 1000 — заболеет раком желудка, поэтому это очень редко.


Заболевание, связанное с Helicobacter pylori: Руководство по тестированию и лечению | Гастроэнтерология | JAMA Internal Medicine

Объектив Разработать практические рекомендации по лечению пациентов с подозреваемыми и задокументированными гастродуоденальными заболеваниями, связанными с Helicobacter pylori .

Методы Группа врачей, обладающих опытом в области H pylori , проанализировала, критически оценила и синтезировала литературу по заданным темам и представила свои обзоры группе. Консенсус был достигнут в спорных областях путем обсуждения.

Результаты и выводы Группа рекомендовала тестирование на H pylori у пациентов с активными язвами, язвенными заболеваниями в анамнезе или лимфомами лимфоидной ткани, связанными со слизистой оболочкой желудка.Молодые, в остальном здоровые пациенты с язвенной диспепсией, а также пациенты с семейным анамнезом или опасением рака желудка также могут пройти тестирование H pylori . Для диагностики H. pylori предпочтительны неэндоскопические методы. Для терапии не следует использовать двойные схемы приема лекарств; Тройная терапия два раза в день с ингибитором протонной помпы или цитратом висмута ранитидина, кларитромицином и амоксициллином в течение 10–14 дней является подходящей терапией. У пациентов с задокументированным анамнезом язвенной болезни или со стойкими симптомами следует рассмотреть возможность оценки статуса H pylori после лечения с помощью дыхательного теста на мочевину.

ПО ОЦЕНКЕ от 30% до 40% населения США инфицировано Helicobacter pylori . 1 Инфекция этим спиралевидным, продуцирующим уреазу организмом вызывает гистологический гастрит у всех инфицированных, является основной причиной язвенной болезни и важным фактором риска развития аденокарциномы и лимфомы желудка. 2 , 3

Helicobacter pylori гастрит обнаруживается у 95% пациентов с язвой двенадцатиперстной кишки и у 80% пациентов с язвой желудка в некоторых частях мира. 4 В Соединенных Штатах этот процент приближается к 75%, что, возможно, отражает большую роль язвенной болезни, вызванной нестероидными противовоспалительными препаратами. 5 У людей с инфекцией H. pylori расчетный риск развития язвенной болезни в течение жизни составляет примерно 15%. 4 , 6

Инфекция H pylori увеличивает риск аденокарциномы желудка до 9 раз, как определено метаанализом 3 вложенных исследований случай-контроль. 7 -9 С учетом этих выводов Международное агентство по изучению рака 10 классифицировало H pylori как канцероген группы 1 (определенная причина рака у людей).

Язвенная болезнь, связанная с Helicobacter pylori , значительно влияет на качество жизни и функциональное состояние пациентов. По данным Национального опроса 1989 года по вопросам здоровья, 11 из 41 457 человек, до 25% из тех, у кого недавно была язва, сообщили о плохом здоровье, неспособности к основной деятельности, ограниченности в повседневной активности, неспособности выполнять работу или прикованы к постели в течение более 7 дней в течение предыдущих 12 месяцев.

Общие экономические последствия инфекции H. pylori ошеломляют. По оценкам, прямые затраты на лечение заболеваний, связанных с H. pylori , и связанных с ними осложнений, а также потери производительности составляют от 3,0 до 5,6 млрд долларов в год. 11 -13

Исследования 14 , 15 документально подтвердили, что излечение от инфекции H. pylori у пациентов с язвенной болезнью связано со снижением частоты рецидивов язвы и, у многих пациентов, с отказом от поддерживающей антисекреторной терапии.Кроме того, излечение от инфекции H pylori может привести к регрессу или разрешению лимфомы лимфоидной ткани, ассоциированной со слизистой оболочкой желудка низкой степени злокачественности. 16 Учитывая потенциальные преимущества эрадикации H pylori , группа гастроэнтерологов и врачей первичного звена встретилась, чтобы критически оценить и обобщить текущую литературу по инфекции H pylori , чтобы разработать практические рекомендации по диагностике и лечению пациентов с Заболевания, связанные с H. pylori .

КТО СЛЕДУЕТ ИСПЫТАТЬ НА H PYLORI ?

Тесты, предназначенные для обнаружения H. pylori , следует проводить только в том случае, если результат повлияет на лечение пациента. В частности, диагностическое тестирование H pylori следует заказывать только в том случае, если было принято решение о лечении пациентов с положительным результатом.

Клиническое превосходство и экономическая выгода тестирования H pylori у пациентов с впервые диагностированной (с помощью эндоскопии или рентгенографии) язвой желудка или двенадцатиперстной кишки хорошо изучены. 12 , 17 -19 Учитывая тесную связь между инфекцией H. pylori и язвенной болезнью, пациенты с язвенной болезнью в анамнезе, которые в настоящее время получают поддерживающую антисекреторную терапию, также должны быть проверены на инфекцию H. pylori . 20 Кроме того, анализ решения и анализа затрат и выгод поддерживает неэндоскопическое диагностическое тестирование молодых, в остальном здоровых пациентов с симптомами язвенной диспепсии. 21 -23 Наконец, пациенты с лимфомой лимфоидной ткани, ассоциированной со слизистой оболочкой, должны пройти обследование и лечение. 7 , 10 , 24 -30 Роль тестирования на инфекцию H pylori у лиц, получающих нестероидные противовоспалительные средства, является спорной.

Анализ решений 31 , 32 предполагает, что скрининг на H. pylori для предотвращения рака желудка также может быть рентабельным. В исследовании, проведенном Парсоннетом и его коллегами, 31 , если эрадикация H. pylori предотвратила только 30% случаев рака, скрининг всего населения США в возрасте 50 лет будет стоить 1 миллиард долларов — сумма, аналогичная расчетным затратам на колоректальный скрининг — и обеспечить соотношение затрат и выгод в размере 25 000 долларов на год спасенной жизни.Если бы скрининг проводился среди групп высокого риска, таких как американцы японского происхождения, лекарство H pylori должно было бы снизить риск рака желудка только на 5%, чтобы быть рентабельным при ориентире в 50 000 долларов на год сохраненной жизни. Хотя эти данные убедительны, контролируемых клинических испытаний не проводилось, и ни одно исследование не подтвердило, что эрадикация H pylori снизит риск развития рака желудка. 31 Таким образом, в настоящее время нельзя рекомендовать рутинный популяционный скрининг на H. pylori .С другой стороны, рациональным клиническим поведением является обследование людей, которые обращаются к врачу со страхом или сильным семейным анамнезом аденокарциномы желудка.

МЕТОДЫ ОБНАРУЖЕНИЯ H PYLORI

Методы, используемые для обнаружения H. pylori , обычно называют эндоскопическими и неэндоскопическими, каждый из которых имеет свои преимущества и недостатки, основанные на истории болезни пациента и его текущем состоянии.

Эндоскопические методы включают оценку нескольких образцов биопсии желудка на наличие H. pylori путем гистологического исследования, активности уреазы или посева. 33 Из этих методов оценки эталонным стандартом считается гистологическое исследование. Использование специальных красителей, таких как краситель Гимза или «Гента», может облегчить идентификацию микроорганизма при гистологическом исследовании. 34 Оценка биоптата на уреазную активность (экспресс-тест на уреазу) — это высокочувствительный (приблизительно 90%) и специфический (приближающийся к 100%) метод обнаружения H. pylori . 35 Ограничение на использование уреазного тестирования — у пациентов, получающих ингибиторы протонной помпы (ИПП) или высокие дозы антагонистов рецепторов гистамина 2 (h3RA), которые могут снижать плотность H pylori и, следовательно, активность уреазы, тем самым производя ложноотрицательный результат. 36 -40 Культивирование H. pylori обычно не используется для установления первичного диагноза из-за возможности получения ложноотрицательных результатов из-за ошибок при сборе, хранении или транспортировке образцов и его длительного характера (т. Е. , требуется до 2 недель для роста). 41 Посев полезен для определения устойчивости к антибиотикам, особенно у пациентов, которые продолжают оставаться положительными на H pylori после начальной схемы лечения.

Helicobacter pylori Обнаружение неэндоскопическими методами, такими как тесты на выявление антител в крови, дыхательные тесты на мочевину (UBT) и недавно одобренный анализ для обнаружения антигена H pylori в образцах стула 42 показан в клинических ситуациях, в которых эндоскопия не показана.В отличие от методов обнаружения антител в крови, UBT и обнаружение фекального антигена указывают на активную инфекцию H pylori .

Тесты на антитела

для выявления антител IgG к H. pylori менее дороги и более удобны в использовании, чем тесты UBT, но несколько менее точны. 43 -45 Тесты на антитела теперь можно проводить в офисе на образцах цельной крови, взятых из пальца, с получением результатов в течение 10 минут. Тесты на антитела обычно используются при обследовании пациентов с диспепсией до или вместо эндоскопии.Поскольку титрам антител часто требуется много месяцев, чтобы снизиться после успешного лечения и оставаться положительными у многих пациентов в течение многих лет, тестирование на антитела в крови (например, серологическое тестирование) менее полезно для мониторинга статуса H pylori после лечения.

UBT — это мера текущей инфекции H pylori , основанная на уреазе H. pylori для гидролиза мочевины, меченной радиоактивным углеродом ( 13 C или 14 C), и выработки изотопно-меченого углекислого газа в выдыхаемом воздухе.Как и в случае быстрых тестов на уреазу на основе биопсии, существует вероятность ложноотрицательных результатов теста UBT у лиц, получающих антисекреторные агенты, такие как ИПП или высокие дозы h3RA, антимикробные агенты или висмутсодержащие соединения, которые снижают плотность H. pylori . . 37 -39,46 , 47 Следовательно, UBT следует избегать тем, кто получал висмут или антибиотики в течение предыдущих 4 недель или антисекреторные препараты в течение предыдущих 2 недель.

Определение антигена в кале стало быстрым неэндоскопическим методом обнаружения H. pylori . Недавно опубликованное исследование 42 показало, что анализ стула на антиген очень чувствителен и специфичен при обнаружении H. pylori у пациентов с диспепсией и у тех, кто прошел курс эрадикации H. pylori . При диагностике инфекции H pylori метод обнаружения антигена в стуле был высокочувствительным (80–100%) и сопоставим с методом UBT (84–100%).Обнаружение антигена в кале, проведенное через 4 недели после завершения режима эрадикации H pylori , имело чувствительность 90%, специфичность 95% и отрицательную прогностическую ценность 98%, показатели, которые были сопоставимы с показателями, полученными с 13 C UBT. 42 Хотя высокие показатели чувствительности и специфичности теста на антиген стула у пациентов, включенных в исследование Vaira et al. 42 , являются многообещающими, несколько других исследователей обнаружили высокий уровень ложноположительных результатов у пациентов, прошедших тестирование через 4 недели после этого. завершение лечения против H. pylori . 48 -50

ВЫБОР МЕТОДА ОБНАРУЖЕНИЯ H PYLORI ПО КЛИНИЧЕСКОЙ СИТУАЦИИ

Пациенты с недавно установленным диагнозом язвенной болезни, поставленным с помощью эндоскопии или рентгенографии, должны иметь в качестве первоначального диагностического теста экспресс-тест на уреазу или тест на сывороточные антитела, соответственно.Если результаты положительные, пациента следует лечить с помощью эффективной схемы эрадикации H pylori (т. Е. Антимикробными средствами плюс антисекреторными средствами). Если первоначальные результаты теста отрицательны, статус H pylori должен быть подтвержден другим тестом, учитывая важность этих знаний для будущей терапии. В случае эндоскопически задокументированной язвы это подтверждение может быть получено с помощью гистологического исследования, определения антител в крови, UBT или анализа стула на антиген.У пациентов, у которых язва обнаружена рентгенологически, следует провести UBT или тест на антиген стула, чтобы подтвердить статус пациента H pylori . В любом случае, если результат подтверждающего теста также отрицательный, язву пациента следует лечить стандартным способом (например, с помощью ИПП или h3RA) и следует учитывать другие причины язвенной болезни. Если результат подтверждающего теста положительный, что позволяет предположить, что первоначальный тест был ложноотрицательным, пациента следует лечить с помощью эффективной схемы лечения против H pylori .

История язвенной болезни

Все пациенты, которые в настоящее время получают антисекреторные агенты, у которых в анамнезе имеется неосложненная язвенная болезнь, подтвержденная эндоскопией или рентгенографией, или у которых есть язвенная болезнь, о которой сообщается самостоятельно, следует обследовать на инфекцию H pylori с использованием неэндоскопических методов обнаружения.Если результаты отрицательные, прием поддерживающего антисекреторного препарата можно прекратить, если единственным показанием к его применению была язвенная болезнь в анамнезе. Отрицательный статус H pylori может быть подтвержден UBT не менее чем через 2 недели после прекращения терапии или обнаружением антигена в кале не менее чем через 4 недели после прекращения терапии у пациентов с объективным диагнозом и при рецидиве симптомов у пациентов с клиническим диагнозом. Обоснование различия в подходах связано с большей вероятностью того, что пациенты с объективно диагностированным заболеванием будут инфицированы, чем пациенты без такой документации.

Пациенты в возрасте 50 лет и младше с впервые возникшей диспепсией, у которых нет тревожных симптомов, указывающих на злокачественные новообразования (например, кровотечение, потеря веса, анемия или преждевременное насыщение), следует пройти тестирование на антитела к H. pylori . В качестве альтернативы, эти пациенты могут быть обследованы с использованием UBT или определения антигена в стуле. Пациенты, проходящие тестирование H pylori с помощью UBT, не должны принимать внутрь ИПП или высокие дозы h3RA в течение предыдущих 2 недель или противомикробные препараты в течение предыдущих 4 недель.Если результаты теста положительны, этим пациентам следует предложить эрадикационную терапию H pylori , мотивируя это тем, что у некоторых из этих людей будет активная язвенная болезнь и лечение будет полезно. Часть тех, у кого нет язвы (например, функциональной диспепсии), также может извлечь выгоду из эрадикации H pylori , и они также должны иметь более низкий риск развития аденокарциномы желудка.

Пациентам старше 50 лет с впервые возникшей диспепсией или лицам любого возраста, у которых наблюдаются тревожные симптомы, следует пройти верхнюю эндоскопию.Если во время эндоскопии обнаруживается объективное заболевание (например, злокачественная опухоль или язвенная болезнь), инфекция H pylori должна быть обнаружена с помощью экспресс-теста на уреазу биоптатов. Пациентам с положительным результатом на H pylori следует лечить инфекцию в контексте клинического диагноза. Если результаты экспресс-теста на уреазу отрицательны, статус H pylori можно подтвердить с помощью теста на антитела или гистологического исследования. В качестве альтернативы можно использовать UBT для подтверждения статуса H pylori .

ЛЕЧЕНИЕ ИНФЕКЦИИ H PYLORI

Многочисленные схемы, разработанные для лечения инфекции H. pylori , были оценены и описаны в литературе. В большинстве схем сочетаются 1, 2 или 3 антибиотических агента (включая соединения висмута) с антисекреторным агентом. Использование антисекреторных агентов в сочетании с противомикробными препаратами увеличивает скорость эрадикации H pylori (вероятно, потому, что повышение pH желудка увеличивает эффективность некоторых противомикробных агентов). 51 , 52 Кроме того, было обнаружено, что ИПП 40 обладают внутренней ингибирующей активностью in vitro в отношении H. pylori . Использование антисекреторной терапии также ускоряет облегчение симптомов язвы. 53 , 54

Никакая терапия не является 100% эффективной для инфекции H. pylori . Тем не менее, было разработано несколько схем лечения, обеспечивающих эффективность от 80% до 90%. Эти схемы состоят из тройной терапии два раза в день с ИПП или цитратом висмута ранитидина вместе с двумя противомикробными препаратами, такими как кларитромицин и амоксициллин или метронидазол. 55 -60 Классическая тройная терапия на основе висмута (субсалицилат висмута, метронидазол и тетрациклин, принимаемые 4 раза в день) позволяет достичь уровня эрадикации примерно 80% в США. 61 ; скорость эрадикации потенциально может быть увеличена путем добавления ИПП. 62 , 63 Основное беспокойство относительно тройной терапии на основе висмута связано с соблюдением пациентом режима лечения из-за сложности схемы. Доступные в настоящее время двойные методы лечения не рекомендуются для лечения инфекции H pylori .

Факторами, которые существенно влияют на частоту излечения H pylori , являются соблюдение пациентом режима, продолжительность терапии и наличие устойчивости к противомикробным препаратам. Независимо от схемы, выбранной для лечения инфекции H pylori , пациенты должны быть проинформированы о том, что полное соблюдение режима лечения необходимо для максимального увеличения их потенциала для излечения от инфекции. Несмотря на результаты многочисленных европейских исследований 62 , 64 , 65 , которые предполагают, что 7 дней тройной терапии достаточно, клинические испытания 55 -57 , проведенные в Соединенных Штатах, показали, что самые высокие показатели Излечение связано с продолжительностью лечения от 10 до 14 дней.Поэтому мы рекомендуем назначать тройную терапию на основе ИПП или ранитидина цитрата висмута в течение 10–14 дней.

Первичная резистентность к терапии метронидазолом является обычным явлением, от 28% до 39% в США. 66 Частота резистентных к кларитромицину штаммов H pylori составляет примерно 11%, а резистентные к амоксициллину или тетрациклину штаммы сообщаются лишь в редких случаях. 66 -69 Однако после неудачного лечения метронидазолом или кларитромицином следует предполагать устойчивость к этим агентам, если тестирование на чувствительность недоступно.

ПОСЛЕДУЮЩИЕ ДЕЙСТВИЯ ПО ТЕРАПИИ H PYLORI

Обследование пациентов после завершения терапии H. pylori полезно для определения будущего клинического течения болезни. Язвы двенадцатиперстной кишки рецидивировали у 6% пациентов, излечившихся от инфекции, по сравнению с 67% пациентов, которые остались положительными на H pylori . 70 Подобные результаты 70 были отмечены у пациентов с язвой желудка: рецидив язвы после лечения произошел у 4% вылеченных пациентов и 59% тех, кто продолжал иметь H. pylori .

Симптомы пациента после терапии H pylori не всегда коррелируют с успехом или неудачей эрадикации. Облегчение диспепсии не всегда предполагает излечение H pylori , хотя 2 исследования 71 , 72 показали, что сохранение определенных симптомов, связанных с язвой (то есть тошнота, дискомфорт в эпигастрии и боль при язве), является предиктором продолжения инфекции.В одном исследовании 72 симптомов или их отсутствие были высокочувствительными и специфичными для подтверждения эрадикации через 6 месяцев после лечения. Однако авторы предупреждают, что оценка на основе симптомов не должна использоваться для оценки результатов лечения у пациентов с высоким риском. И наоборот, продолжающиеся симптомы не всегда указывают на неэффективность лечения. Следовательно, последующее наблюдение и подтверждающее тестирование могут быть полезны для определения реакции пациента на лечение и риска рецидива язвы.

Неэндоскопические методы (например, UBT) рекомендуются для подтверждения эрадикации H. pylori после завершения терапии, если такое подтверждение считается необходимым. 58 , 73 , 74 UBT следует проводить не раньше, чем через 4–6 недель после завершения терапии H. pylori . Использование ИПП или высоких доз h3RA следует прекратить как минимум за 2 недели до введения UBT. 37 Недавнее исследование 42 показало, что обнаружение антигена в стуле является надежным методом подтверждающего тестирования при проведении через 4 недели после лечения. Тем не менее, некоторые исследования 48 -50 обнаружили высокий уровень ложноположительных результатов при обнаружении антигена в стуле через 4 недели после лечения.

Тестирование на антитела

менее полезно для немедленной оценки ответа после лечения, поскольку высокие уровни антител к H. pylori остаются в течение различных и продолжительных периодов времени. 75 Однако для человека, прошедшего более года после терапии, сероконверсия является надежным показателем успешной ликвидации. 76 Если эндоскопия клинически показана (например, для подтверждения заживления язвы) после лечения, клиницист должен получить несколько образцов биопсии из тела желудка и антрального отдела желудка для гистологического исследования и анализа уреазы, чтобы исключить стойкую инфекцию.

Результаты недавнего исследования 77 позволяют предположить, что пациенты хотят знать свой статус H pylori после завершения режима эрадикации H. pylori . Однако экономические факторы могут ограничивать полезность проведения подтверждающего тестирования у всех пациентов. Последующее тестирование для подтверждения эрадикации должно проводиться в плановом порядке у всех пациентов с подтвержденным диагнозом новой язвенной болезни или документально подтвержденной историей осложненной язвенной болезни.Пациенты с зарегистрированной историей неосложненной язвенной болезни, не подтвержденной эндоскопией или рентгенографией, а также пациенты с диспепсией в анамнезе должны пройти контрольное обследование, если симптомы повторяются. Подтверждающее тестирование также может быть выполнено у пациентов, у которых неизвестный статус H pylori вызывает чрезмерное беспокойство или потерю сна.

ЛЕЧЕНИЕ УСТОЙЧИВОЙ ИНФЕКЦИИ H PYLORI ПОСЛЕ ЛЕЧЕНИЯ

Пациенты, которые остаются положительными на H pylori после завершения эффективной схемы лечения H. pylori , должны быть оценены на предмет соблюдения режима лечения.Однако многие пациенты могут продолжать испытывать симптомы или оставаться положительными на H pylori , несмотря на полное соблюдение режима лечения. 77

АЛЬТЕРНАТИВНЫЕ РЕЖИМЫ ДЛЯ ПАЦИЕНТОВ, НЕ ПРОВОДЯЩИХ НАЧАЛЬНУЮ ТЕРАПИЮ H PYLORI

Выбор альтернативной схемы лечения должен основываться на первоначальной схеме лечения.Например, если в качестве терапии первой линии использовалась тройная терапия, состоящая из ИПП или ранитидина цитрата висмута, кларитромицина и амоксициллина, второй курс лечения должен состоять из ИПП, метронидазола, субсалицилата висмута и тетрациклина. 78 -80 В качестве альтернативы пациенты, которые не реагируют на начальный курс лечения, могут быть направлены к гастроэнтерологу для дальнейшего обследования.

Пациентам, которые не отвечают на начальный и вторичный курс терапии анти– H pylori , рекомендуется направлять к гастроэнтерологу.Этим пациентам часто требуется эндоскопия с биопсией и посевом для определения устойчивости к антибиотикам. Дальнейшая терапия будет тогда основана на обнаруженных паттернах резистентности.

Резюме и рекомендации

Helicobacter pylori — это повсеместный организм, который связан с гистологическим гастритом, язвенной болезнью, лимфомой лимфоидной ткани, связанной со слизистой оболочкой желудка, и повышенным риском аденокарциномы желудка.Исследования документально подтвердили, что излечение от инфекции связано с заживлением язвы, исчезновением симптомов и излечением язвенной болезни, связанной с H. pylori . Лечение инфекции H pylori снижает заболеваемость, связанную с язвенной болезнью, сохраняет ресурсы здравоохранения и часто устраняет необходимость в поддерживающей антисекреторной лекарственной терапии. Рисунки 1, 2 и 3 предназначены для помощи врачам в уходе за пациентами с недавно диагностированной язвой, язвенной болезнью в анамнезе и диспепсией в анамнезе соответственно.

Пациенты с подтвержденной язвенной болезнью должны быть обследованы на инфекцию H pylori . Неэндоскопическое тестирование на инфекцию H pylori также рекомендуется лицам в возрасте 50 лет и младше с симптомами, указывающими на язвенную болезнь, и без тревожных симптомов, указывающих на злокачественное новообразование. Другие подгруппы людей также могут потребовать оценки H. pylori . Метод обнаружения H pylori зависит от клинической картины пациента.Независимо от того, как и почему им был поставлен диагноз, пациентам с положительным результатом на H pylori следует предложить лечение с использованием эффективной схемы лечения против H pylori . После лечения пациенты с задокументированной язвенной болезнью нуждаются в последующей оценке их статуса после лечения H pylori .

Принята к публикации 15 сентября 1999 г.

Эта работа была поддержана неограниченным образовательным грантом от TAP Pharmaceuticals Inc, Дирфилд, Иллинойс.

Автор, ответственный за переписку: Уолтер Л. Петерсон, доктор медицины, Медицинский центр по делам ветеранов (111 B-1), 4500 S Lancaster Rd, Dallas, TX 75216.

1.Парсонне J Helicobacter pylori и рак желудка. Gastroenterol Clin North Am. 1993; 2289-104Google Scholar2, Национальные институты здравоохранения, Helicobacter pylori при язвенной болезни. Заявление о согласии NIH. 1994; 121-23 Google Scholar 3.Маршалл BJWarren JR Неопознанные изогнутые бациллы в желудке пациентов с гастритом и язвенной болезнью. Ланцет. 1984; 11311-1315Google ScholarCrossref 4.Kuipers EJThijs JCFesten HPM Распространенность Helicobacter pylori при язвенной болезни. Aliment Pharmacol Ther. 1995; 9 ((дополнение 2)) 59-69 Google Scholar5.Laine IHopkins RJGirardi LS Было ли переоценено влияние терапии Helicobacter pylori на рецидивы язвы в Соединенных Штатах? метаанализ строго разработанных исследований. Am J Gastroenterol. 1998; 931409–1415Google Scholar6.Valle JKekki MSipponen Пихамаки Цюрала M Отдаленное течение и последствия гастрита Helicobacter pylori . Сканд Дж Гастроэнтерол. 1996; 31546-550Google ScholarCrossref 7.Forman DWebb П.Парсоннетт J Helicobacter pylori и рак желудка. Ланцет. 1994; 343243–244Google ScholarCrossref 8.Parsonnet Дж. Фридман GDVandersteen DP и другие. Инфекция Helicobacter pylori и риск рака желудка. N Engl J Med. 1991; 3251127–1131Google ScholarCrossref 9. Номура AStemmermann GNChyou п и другие. Helicobacter pylori Инфекция и рак желудка среди американцев японского происхождения на Гавайях. N Engl J Med. 1991; 3251132–1136Google ScholarCrossref 10. Недоступно, заражение Helicobacter pylori . Рабочая группа IARC по оценке канцерогенных рисков для людей, шистосом, печеночных двуусток и Helicobacter pylori Монографии IARC по оценке канцерогенных рисков для людей. Vol 61 Lyon, France International Agency for Research on Cancer 1994; 177-240 Google Scholar11, Сонненберг AEverhart JE Воздействие язвенной болезни на здоровье в США. Am J Gastroenterol. 1997;

-620Google Scholar12.Imperiale TFSperoff TCebul RDMcКаллоу AJ Анализ стоимости альтернативных методов лечения язвы двенадцатиперстной кишки. Ann Intern Med. 1995; 123665–672Google ScholarCrossref 13.Vakil NFennerty B Экономика искоренения инфекции Helicobacter pylori при язвенной болезни двенадцатиперстной кишки. Am J Med. 1996; 100 ((ПРИЛОЖЕНИЕ 5A)) 60-63Google ScholarCrossref 14.Tytgat GNJNoach IARauws EAJ Инфекция Helicobacter pylori и язвенная болезнь двенадцатиперстной кишки. Gastroenterol Clin North Am. 1993; 22127-140Google Scholar 15.Laine L Helicobacter pylori и осложненная язвенная болезнь. Am J Med. 1996; 100 ((Suppl)) 52S- 59SGoogle ScholarCrossref 16.Bayerdorffer ENeubauer ARudolph B и другие.Регресс первичной лимфомы желудка слизисто-ассоциированного типа лимфоидной ткани после лечения инфекции Helicobacter pylori . Ланцет. 1995; 3451591-1594Google ScholarCrossref 17.Sonneberg ATownsend WF Стоимость лечения язвенной болезни двенадцатиперстной кишки антибиотиками. Arch Intern Med. 1995; 155922–928Google ScholarCrossref 18. О’Брайен BGoeree RMohamed HHunt R Экономическая эффективность эрадикации Helicobacter pylori для длительного лечения язвы двенадцатиперстной кишки в Канаде. Arch Intern Med. 1995; 1551958-1964Google ScholarCrossref 19.Unge PJonsson BStalhammar НЕТ Экономическая эффективность эрадикации Helicobacter pylori по сравнению с поддерживающим и эпизодическим лечением у пациентов с язвой двенадцатиперстной кишки в Швеции. Фармакоэкономика. 1995; 8410-427Google ScholarCrossref 20. Фендрик AMMcCort Я. Т. Чернев MEHirth РАПатель CBloom BS Немедленное искоренение Helicobacter pylori у пациентов с ранее задокументированной язвенной болезнью: клинические и экономические эффекты. Am J Gastroenterol. 1997; 112017-2024 Google Scholar21.Ofman JJEtchason Дж. Фуллертон SKahn KLSoll Стратегии ведения АГ для Helicobacter pylori — серопозитивных пациентов с диспепсией: клинические и экономические последствия. Ann Intern Med. 1997; 126280-291Google ScholarCrossref 22.Silverstein М.Д.Петтерсон TTalley N Первичная эндоскопия или эмпирическая терапия с тестированием на Helicobacter pylori при диспепсии или без него: анализ решения. Гастроэнтерология. 1996; 11072-83Google ScholarCrossref 23. Фендрик А.М.Чернев MEHirth RABloom BS Альтернативные стратегии ведения пациентов с подозрением на язвенную болезнь. Ann Intern Med. 1995; 123260-268Google ScholarCrossref 24.Steinbach GFord RGlober грамм и другие. Лечение антибиотиками лимфомы желудка из лимфоидной ткани, связанной со слизистой оболочкой: неконтролируемое испытание. Ann Intern Med. 1999; 13188-95Google ScholarCrossref 25.Wotherspoon ACDoglioni CDiss TC и другие. Регресс первичной B-клеточной лимфомы желудка низкой степени злокачественности из слизистой оболочки лимфоидной ткани после эрадикации Helicobacter pylori . Ланцет. 1993; 342575–577Google ScholarCrossref 26.Weber DMDimopoulos Маананду DPPugh WCSteinbach G Регресс лимфомы желудка из лимфоидной ткани, связанной со слизистой оболочкой, при лечении антибиотиками Helicobacter pylori . Гастроэнтерология. 1994; 1071835-1838Google Scholar27.Roggero EZucca EPinotti грамм и другие. Ликвидация инфекции Helicobacter pylori при первичной лимфоме желудка низкой степени злокачественности из лимфоидной ткани слизистой оболочки. Ann Intern Med. 1995; 122767-769Google ScholarCrossref 28.Blecker UMcKeithan TWHart Дж. Киршнер Резолюция BS Helicobacter pylori — лимфопролиферативное заболевание желудка у ребенка. Гастроэнтерология. 1995; 109973- 977Google ScholarCrossref 29.Montalban CManzanal ABoixeda D и другие. Эрадикация Helicobacter pylori для лечения MALT-лимфомы низкой степени злокачественности: последующее наблюдение вместе с последовательными молекулярными исследованиями. Ann Oncol. 1997; 8 ((дополнение 2)) 37-39Google ScholarCrossref 30.Neubauer AThiede CMorgner А и другие. Излечение инфекции Helicobacter pylori и продолжительность ремиссии лимфомы лимфоидной ткани, ассоциированной со слизистой оболочкой желудка низкой степени. J Natl Cancer Inst. 1997; 8-1355Google ScholarCrossref 31.Parsonnet JHarris RAHack HMOwens DK Моделирование экономической эффективности скрининга Helicobacter pylori для предотвращения рака желудка: обязательство для клинических испытаний. Ланцет. 1996; 348150-154Google ScholarCrossref 32. Фендрик А.М.Чернев MEHirth RABloom BSBandekar Р.Р.Шейман JM Клинические и экономические эффекты H.pylori для предотвращения рака желудка. Arch Intern Med. 1999; 159142-148Google ScholarCrossref 33.Genta RMGraham DY Сравнение участков биопсии для гистопатологической диагностики Helicobacter pylori : топографическое исследование плотности и распределения H. pylori . Gastrointest Endosc. 1994; 40342-345Google ScholarCrossref 34.Genta RMRobason GOGraham Д.Ю. Одновременная визуализация Helicobacter pylori и морфологии желудка: новое окрашивание. Hum Pathol. 1994; 25221-226Google ScholarCrossref 35.Laine LLewin DNNaritoku WEstrada RCohen H Проспективное сравнение имеющихся в продаже экспресс-тестов на уреазу для диагностики Helicobacter pylori . Gastrointest Endosc. 1996; 44523-526Google ScholarCrossref 36. Грэм DYGenta REvans DG и другие. Helicobacter pylori не мигрирует из антрального отдела в тело в ответ на омепразол. Am J Gastroenterol. 1996; 0-2124Google Scholar 37.Laine Лестрада RTrujillo МКнигге KFennerty МБ Влияние терапии ингибиторами протонной помпы на диагностическое тестирование Helicobacter pylori . Ann Intern Med. 1998; 129547-550Google ScholarCrossref 38.Chey WDWoods М.Шейман JMNostrant TTDelValle J Лансопразол и ранитидин влияют на точность дыхательного теста с содержанием С-мочевины 14 посредством pH-зависимого механизма. Am J Gastroenterol. 1997;

-450 Google Scholar39.Chey WDSpybrook MCarpenter SNostrant TTElta GHScheiman JM Длительное действие омепразола на дыхательный тест 14 C-мочевина. Am J Gastroenterol. 1996; 9189-92Google Scholar 40. McGowan CCCover TLBlaser MJ Ингибитор протонной помпы омепразол подавляет кислотную выживаемость Helicobacter pylori по уреазно-независимому механизму. Гастроэнтерология. 1994; 1071573-1578Google ScholarCrossref 41. Cohen HLaine L Эндоскопические методы диагностики H. pylori . Aliment Pharmacol Ther. 1997; 11 ((дополнение 1)) 3-9Google ScholarCrossref 42.Vaira DMalfertheiner PMegraud F и другие. Диагностика инфекции Helicobacter pylori с помощью нового неинвазивного анализа на основе антигенов: многоцентровое исследование. Ланцет. 1999; 35430-33Google ScholarCrossref 43.Орманд JETalley JFCarpenter HA и другие. Дыхательный тест на C-мочевину для диагностики Helicobacter pylori . Dig Dis Sci. 1990; 35879-884Google ScholarCrossref 44. Cutler AFHavstad SMa CKBlaser MJPerez-Perez Г.И.Шуберт TT Точность инвазивных и неинвазивных тестов для диагностики инфекции Helicobacter pylori . Гастроэнтерология. 1995; 109136-141Google ScholarCrossref 45.Marchildon PACiota Л.М.Заманиян ФЗПавлин Дж. С. Грэм DY Оценка трех коммерческих иммуноферментных анализов по сравнению с дыхательным тестом с мочевиной C для выявления инфекции Helicobacter pylori . J Clin Microbiol. 1996; 341147-1152Google Scholar46.Perri FMaes BGeypens B и другие. Влияние отдельных доз препаратов, кормления и бактериального уреолиза толстой кишки на результаты дыхательного теста на мочевину. Aliment Pharmacol Ther. 1995; 9705-709Google ScholarCrossref 47.Savarino VBisso GPivari M и другие. Влияние омепразола и ранитидина на точность 13 С-мочевинного дыхательного теста (UBT) [аннотация]. Gut. 1998; 43 ((дополнение 2)) A51Google ScholarCrossref 48.Makristathis Паскинг ESchutze K и другие. Обнаружение Helicobacter pylori в образцах стула методами ПЦР и иммуноферментного анализа на антиген. J Clin Microbiol. 1998; 362772-2774Google Scholar 49.Trevisani LSartori С.Галвани F и другие. Оценка нового иммуноферментного анализа для обнаружения Helicobacter pylori в кале: проспективное пилотное исследование. Am J Gastroenterol. 1999; 941830-1833Google ScholarCrossref 50.Calvet XFeu FForne M и другие. Оценка нового иммуноферментного анализа для обнаружения инфекции Helicobacter pylori в образцах стула. Гастроэнтерол Гепатол. 1999; 22270-272 Google Scholar 51. Годдард AFSpiller RC Влияние омепразола на вязкость желудочного сока, pH и количество бактерий. Aliment Pharmacol Ther. 1996; 10105-109Google ScholarCrossref 52.Unge PGad АГнарпе Хольссон J Улучшает ли омепразол противомикробную терапию, направленную на Campylobacter pylori у пациентов с антральным гастритом? Сканд Дж Гастроэнтерол. 1989; 16749-54Google ScholarCrossref 53.Hosking SWLing TKWChung SCS и другие. Заживление язвы двенадцатиперстной кишки путем эрадикации Helicobacter pylori без антикислотной терапии: рандомизированное контролируемое исследование. Ланцет. 1994; 343508-510Google ScholarCrossref 54.Лам SKChing CKLai KC и другие. Излечивает ли лечение Helicobacter pylori (Hp) только антибиотиками язву двенадцатиперстной кишки (DU)? рандомизированное двойное слепое плацебо-контролируемое исследование. Gut. 1997; 4143-48Google ScholarCrossref 55.Laine Лестрада RTrujillo М.Фуканага KNeil G Рандомизированное сравнение различных периодов тройной терапии два раза в день для эрадикации Helicobacter pylori . Aliment Pharmacol Ther. 1996; 101029-1033Google ScholarCrossref 56.Yousfi ММЭл-Зимаиты HMTAl-Assi MTCole RAGenta RMGraham DY Метронидазол, омепразол и кларитромицин: эффективная комбинированная терапия для инфекции Helicobacter pylori . Aliment Pharmacol Ther. 1995; 9209-212Google ScholarCrossref 57.Laine Лестрада RTrujillo MEmami S Рандомизированное сравнение тройной терапии на основе цитрата висмута ранитидина для Helicobacter pylori . Am J Gastroenterol. 1997;

3-2215Google Scholar58.Soll Комитет по параметрам AHPractice Американского колледжа гастроэнтерологии, Медикаментозное лечение язвенной болезни: практические рекомендации. JAMA. 1996; 275622-629Google ScholarCrossref 59. Van der Hulst RWMKeller JJRauws EAJTytgat GNJ Лечение инфекции Helicobacter pylori : обзор мировой литературы. Helicobacter. 1996; 16-19Google ScholarCrossref 60.Peura DA Отчет Международной обновленной конференции Инициативы по здоровью пищеварительной системы о Helicobacter pylori . Гастроэнтерология. 1997; 113 ((Suppl)) S4- S8Google ScholarCrossref 61.

Недоступно, Helidac [вкладыш из пакета]. Норидж, Нью-Йорк Procter & Gamble

62.de Бур WADriessen WMMJansz AR и другие. Эффект подавления кислоты на эффективность лечения инфекции Helicobacter pylori . Ланцет. 1995; 345817-820Google ScholarCrossref 63.Borody TJAndrews PFracchia грамм и другие. Омепразол повышает эффективность тройной терапии в уничтожении Helicobacter pylori . Gut. 1995; 37477-481Google ScholarCrossref 64.Lind TVeldhuyzen van Zanten SJOUnge п и другие. Ликвидация Helicobacter pylori с использованием однонедельной тройной терапии, сочетающей омепразол с двумя противомикробными препаратами: исследование MACH-1. Helicobacter. 1996; 1138-1444Google ScholarCrossref 65.Misiewicz JJHarris AWBardham KD и другие. Однонедельная тройная терапия для Helicobacter pylori : многоцентровое сравнительное исследование. Gut. 1997; 41735-739Google ScholarCrossref 66.Laine LMalone ТБоеченек WWang W Текущие показатели устойчивости к антибиотикам H. pylori в США и факторы, предсказывающие устойчивость: результаты продолжающихся испытаний в 77 центрах [аннотация]. Гастроэнтерология. 1999; 116A228Google Scholar 67.Riff DSKidd SRose Фабер MWeissfeld Сипман Н. Тройная терапия лансопразолом, кларитромицином и амоксициллином для лечения инфекции Helicobacter pylori : краткий отчет. Helicobacter. 1996; 1238–242Google ScholarCrossref 68.Lamouliatte HCayla РЗербиб FTalbi PMegraud Fde Mascarel A Тройная терапия ИПП-амоксициллин-кларитромицин для H.pylori : оптимальная схема лечения в 1996 г. [аннотация]. Гастроэнтерология. 1996; 110A171Google Scholar 69. Weissfeld АССиммоны DEVance PHTrevino EKidd SGreski-Rose P Чувствительность in vitro изолятов Helicobacter pylori до лечения из двух многоцентровых клинических испытаний в США. Гастроэнтерология. 1996; 110A295Google Scholar70.Hopkins RJGirardi LSTurney EA Взаимосвязь между эрадикацией Helicobacter pylori и уменьшением рецидивов язвы двенадцатиперстной кишки и желудка: обзор. Гастроэнтерология. 1996; 1101244-1252Google ScholarCrossref 71.Vakil NHahn BMcSorley D Рецидивирующие симптомы и гастроэзофагеальная рефлюксная болезнь у пациентов с язвой двенадцатиперстной кишки, пролеченных от инфекции Helicobacter pylori . Aliment Pharmacol Ther. 2000; 1445-51Google ScholarCrossref 72.Phull PSHalliday DPrice ABJacyna MR Отсутствие диспептических симптомов как тест на эрадикацию Helicobacter pylori . BMJ. 1996; 312349-350Google ScholarCrossref 73.Klein PDGraham DY Минимальные требования к анализу для обнаружения инфекции Helicobacter pylori с помощью дыхательного теста 13 C-мочевина. Am J Gastroenterol. 1993; 881865-1969 Google Scholar 74. Ван де Вау Бамде Бур WAHermsen HWEMValkenburg JGMGeuskens LMTytgat GNJ. Полезность дыхательного теста на С-мочевину 14 в качестве инструмента полуколичественного мониторинга после лечения инфекции Helicobacter pylori . Сканд Дж Гастроэнтерол. 1997; 32112-117Google ScholarCrossref 75. Kousunen Т.У. Сеппала KSarna SSipponen P Диагностическое значение снижения титров антител IgG, IgA и IgM после эрадикации Helicobacter pylori . Ланцет. 1992; 339893-895Google ScholarCrossref 76.Feldman MCryer BLee EPeterson WL Роль сероконверсии в подтверждении излечения от инфекции Helicobacter pylori . JAMA. 1998; 280363- 365Google ScholarCrossref 77.Fendrick AMChey WDMagaret NPalaniappan JFennerty MB Состояние симптомов и желание Helicobacter pylori подтверждающих тестов после эрадикационной терапии у пациентов с язвенной болезнью. Am J Med. 1999; 107133-136Google ScholarCrossref 78. Европейская группа по изучению Helicobacter pylori (EHPSG), Современные европейские концепции управления инфекцией Helicobacter pylori : Маастрихтский консенсусный доклад. Gut. 1997; 418-13Google ScholarCrossref 79.Chiba NHunt RH Подавление кислоты висмутом, метронидазолом и тетрациклином (BMT) при эрадикации H. pylori : метаанализ [аннотация]. Gut. 1996; 39 ((дополнение 2)) A36Google ScholarCrossref 80.de Boer WA Как достичь почти 100% излечения от инфекции H. pylori у пациентов с язвенной болезнью: личная точка зрения. J Clin Gastroenterol. 1996; 22313-316Google ScholarCrossref

Инфекция Helicobacter pylori

Определение

Helicobacter pylori ( H pylori ) — это тип бактерий, поражающих желудок.Это очень распространенное явление, которым страдают около двух третей населения мира и от 30% до 40% людей в Соединенных Штатах. Инфекция H. pylori является наиболее частой причиной язвенной болезни. Однако у большинства людей инфекция не вызывает проблем.

Альтернативные названия

Инфекция H. pylori

Причины

Бактерии H. pylori , скорее всего, передаются напрямую от человека к человеку. Обычно это происходит в детстве. Если не лечить, инфекция сохраняется на протяжении всей жизни.

Непонятно, как бактерии передаются от одного человека к другому. Бактерии могут распространяться от:

  • Контакт рот в рот
  • Заболевание желудочно-кишечного тракта (особенно при рвоте)
  • Контакт со стулом (фекальными массами)
  • Загрязненная пища и вода

Бактерии могут вызвать язвы в следующим образом:

  • H. pylori проникает в слизистую оболочку желудка и прикрепляется к слизистой оболочке желудка.
  • H. pylori заставляет желудок производить больше желудочной кислоты. Это повреждает слизистую оболочку желудка, что у некоторых людей приводит к язве.

Помимо язв, бактерии H. pylori могут также вызывать хроническое воспаление желудка (гастрит) или верхней части тонкой кишки (дуоденит).

H pylori также иногда может привести к раку желудка или редкому типу лимфомы желудка.

Симптомы

Приблизительно от 10% до 15% людей, инфицированных H. pylori , заболевают язвенной болезнью.Небольшие язвы могут не вызывать никаких симптомов. Некоторые язвы могут вызвать серьезное кровотечение.

Ноющая или жгучая боль в животе — частый симптом. Боль может усиливаться натощак. Боль может отличаться от человека к человеку, и у некоторых людей боли нет.

Другие симптомы включают:

  • Чувство полноты или вздутия живота и проблемы с потреблением такого же количества жидкости, как обычно
  • Голод и чувство пустоты в желудке, часто через 1-3 часа после еды
  • Легкая тошнота, которая может исчезнуть с рвота
  • Потеря аппетита
  • Потеря веса без попытки
  • Отрыжка
  • Кровавый или темный, дегтеобразный стул или кровавая рвота

Осмотр и анализы

Ваш лечащий врач проверит вас на H pylori , если вы:

  • У вас есть пептические язвы или язвы в анамнезе.
  • У вас дискомфорт и боль в желудке, длящиеся более месяца.

Сообщите своему врачу, какие лекарства вы принимаете.Нестероидные противовоспалительные препараты (НПВП) также могут вызывать язвы. Если у вас проявляются симптомы инфекции, врач может выполнить следующие тесты для H pylori . К ним относятся:

  • Дыхательный тест — дыхательный тест с мочевиной (Дыхательный тест с изотопом углерода и мочевиной, или UBT). Ваш врач заставит вас проглотить специальное вещество, содержащее мочевину. Если присутствует H pylori , бактерии превращают мочевину в диоксид углерода. Это обнаруживается и записывается на выдохе через 10 минут.
  • Анализ крови — определение антител к H. pylori в крови.
  • Тест стула — определяет наличие бактерий в стуле.
  • Биопсия — исследует образец ткани, взятый из слизистой оболочки желудка с помощью эндоскопии. Образец проверяется на бактериальную инфекцию.

Лечение

Чтобы ваша язва зажила и уменьшила вероятность ее рецидива, вам дадут лекарства для:

  • Убить бактерии H. pylori (если есть)
  • Снизить уровень кислоты в желудок

Принимайте все лекарства, как вам сказали.Также могут помочь другие изменения в образе жизни.

Если у вас язвенная болезнь и инфекция H pylori , рекомендуется лечение. Стандартное лечение включает в себя различные комбинации следующих лекарств в течение 10–14 дней:

  • Антибиотики для уничтожения H. pylori
  • Ингибиторы протонной помпы для снижения уровня кислоты в желудке
  • Висмут (основной ингредиент пепто-бисмола). ) могут быть добавлены для уничтожения бактерий

Принимать все эти лекарства в течение 14 дней непросто.Но это дает вам лучший шанс избавиться от бактерий H pylori и предотвратить язвы в будущем.

Перспективы (Прогноз)

Если вы примете лекарства, высока вероятность того, что инфекция H pylori будет излечена. У вас будет гораздо меньше шансов получить новую язву.

Иногда H. pylori бывает трудно полностью вылечить. Могут потребоваться повторные курсы различных процедур. Иногда проводится биопсия желудка, чтобы проверить микроб, чтобы определить, какой антибиотик лучше всего подействует.Это может помочь в дальнейшем лечении. В некоторых случаях H pylori невозможно вылечить никаким лечением, хотя симптомы можно уменьшить.

В случае лечения повторное заражение может произойти в районах с плохими санитарными условиями.

Возможные осложнения

Длительная (хроническая) инфекция H. pylori может привести к:

  • Язвенной болезни
  • Хроническому воспалению
  • Язвы желудка и верхних отделов кишечника
  • Рак желудка
  • Связанные со слизистой оболочкой желудка лимфоидная ткань (MALT) лимфома

Осложнения могут включать:

  • Тяжелая кровопотеря
  • Рубцы от язвы могут затруднить опорожнение желудка
  • Перфорация или отверстие желудка и кишечника

Когда обращаться a Medical Professional

Тяжелые симптомы, которые появляются внезапно, могут указывать на закупорку кишечника, перфорацию или кровотечение, причем все это является неотложной ситуацией.Симптомы могут включать:

  • Деготь, черный или кровянистый стул
  • Сильная рвота, которая может включать кровь или вещество с видом кофейной гущи (признак серьезного кровотечения) или все содержимое желудка (признак кишечного тракта). непроходимость)
  • Сильная боль в животе с рвотой или без нее или с признаками крови

Любой, у кого есть какие-либо из этих симптомов, должен немедленно обратиться в отделение неотложной помощи.

Ссылки

Morgan DR, Crowe SE.Инфекция Helicobacter pylori. В: Feldman M, Friedman LS, Brandt LJ, eds. Заболевания желудочно-кишечного тракта и печени Слейзенгера и Фордтрана. 10-е изд. Филадельфия, Пенсильвания: Эльзевьер Сондерс; 2016: глава 51.

Веб-сайт Национального института рака. Helicobacter pylori и рак. www.cancer.gov/about-cancer/causes-prevention/risk/infectious-agents/h-pylori-fact-sheet. Обновлено 5 сентября 2013 г. По состоянию на 3 апреля 2017 г.

Teitelbaum EN, Hungness ES, Mahvi DM. Желудок. В: Townsend CM, Beauchamp RD, Evers BM, Mattox KL, eds. Sabiston Учебник хирургии. 20-е изд. Филадельфия, Пенсильвания: Эльзевьер; 2017: глава 48.

Лабораторное поддержание видов Helicobacter

Abstract

Виды Helicobacter — это грамотрицательные бактерии, которые колонизируют слизистую оболочку желудка или кишечника многих млекопитающих и птиц-хозяев и вызывают гистологическое воспаление. Связь H. pylori с гастритом, язвенной болезнью и раком желудка делает его значимым патогеном для человека.Животные модели этих болезней используются для изучения патогенеза инфекции H. pylori и при разработке вакцины ( UNIT 8B.1 ). И бактериальные факторы, и факторы хозяина вносят вклад в патогенез Helicobacter , и поэтому микробиология очень важна. В этом разделе описывается, как культивировать наиболее часто используемые виды желудочных Helicobacter , H. pylori, H. mustelae и H. felis .

Ключевые слова: Helicobacter , кривая роста, морфологическая идентификация, препарат кровяного агара, методы культивирования щепоткой биопсии

Тематическая группа: Микробиология, грамотрицательные бактерии, культура клеток, бактерии

In vitro, Helicobacter Growth довольно медленно и только в условиях пониженного (но не отсутствующего) кислорода (т.е.е., микроаэрофильные условия) и богатые среды. Первичным культурам может потребоваться до 5-7 дней для достижения оптимального роста, хотя последующие пассажи занимают всего несколько дней. Идентификация H. pylori может быть сделана путем подтверждения присутствия ферментов уреазы, каталазы и оксидазы, а также путем наблюдения микроскопических доказательств высокой подвижности и спиральной или изогнутой морфологии (Windsor and O’Rourke, 2000). Колонии маленькие, круглые и кажутся полупрозрачными на фоне кровяного агара. H.pylori устойчив к сульфаниламидам, ванкомицину, триметоприму и цефсулодину, что позволяет создавать очень эффективные селективные среды при выделении бактерий из клинических биопсий. Однако он чувствителен ко многим распространенным антибиотикам, включая тетрациклин, гентамицин, канамицин и пенициллин. Следовательно, эти антибиотики можно использовать для уничтожения внеклеточных H. pylori при проведении экспериментов по совместному культивированию с фагоцитами или в качестве маркеров отбора при введении кассет генов в H.pylori геном.

В данном разделе сначала представлены протоколы выращивания организмов Helicobacter на чашках (Базовый протокол 1) или в жидких культурах (Базовый протокол 2), за ними следует Базовый протокол 3, в котором описывается использование уколов агара для культивирования Хеликобактер . Культивирование H. pylori из образцов клинической биопсии описано в Основном протоколе 4. Представлены протоколы поддержки, которые описывают приготовление твердой среды для роста на чашках (протокол поддержки 1), метод количественного определения количества организмов Helicobacter в активно растущей культуре (протокол поддержки 2), а также методы количественной оценки H.felis in vitro (протокол поддержки 3). Протокол поддержки 4 описывает количественное определение Helicobacter с помощью количественной ПЦР. Кроме того, был предоставлен способ жидкой культуры Helicobacter , который не требует использования инкубатора для тканевых культур (см. Альтернативный протокол). Наконец, представлены методы для подтверждения роста H. pylori (см. Протокол поддержки 5).

ВНИМАНИЕ: H. pylori и H. mustelae являются патогенами уровня биологической безопасности 2 (BSL-2); H.felis является патогеном BSL-1. Считается, что заражение H. pylori взрослым происходит относительно редко, и большинство инфицированных людей остаются бессимптомными и остаются здоровыми на всю жизнь. Соблюдайте все соответствующие инструкции и правила по использованию и обращению с патогенными микроорганизмами. См. UNIT 1A.1 и другие соответствующие ресурсы ( ПРИЛОЖЕНИЕ 1B ) для получения дополнительной информации.

СТРАТЕГИЧЕСКОЕ ПЛАНИРОВАНИЕ

Было описано несколько различных добавок селективной среды Helicobacter (см.).Рецепт Скирроу, коммерчески доступный от Difco, BBL и Oxoid, был первоначально разработан для выделения видов Campylobacter . Хотя добавка Скирроу (10 мкг / мл ванкомицина, 5 мкг / мл триметоприма и 2,5 МЕ / мл полимиксина B) плюс амфотерицин B использовалась для выделения и культивирования видов Helicobacter , авторы обнаружили, что рецепты более эффективны. эффективный. В частности, так называемая селективная добавка A Glaxo (GSSA) полезна для выделения H.pylori от мышей при попытке адаптировать новый штамм H. pylori к мышам (Lee et al., 1997; McColm, 1997; McColm et al., 1995). Однако обратите внимание, что использование GSSA может вызвать смещение в процессе отбора / адаптации, поскольку было показано, что некоторые изоляты H. pylori чувствительны к налидиксовой кислоте. При попытке выделить H. pylori или один из других видов Helicobacter из биопсии человека или животного необходимо использовать одну или другую добавку.Это особенно важно для изоляции бактерий от мышей, поскольку они копрофаги (они потребляют собственные фекалии). Для чистых культур лабораторных штаммов добавление селективной среды менее важно, но для упрощения приготовления планшетов для роста бактерий не помешает всегда использовать чашки, приготовленные с указанными добавками.

Таблица 8B.1.1

Добавки для селективных сред

982 2020 982 2020 982 2020
Антибиотик H. pylori H.pylori GSSA a H. felis H. mustelae
Амфотерицин B 2,5 мкг / мл 2,5 мкг / мл / мл
Бацитрацин 20 мкг / мл
Цефсулодин 16 мкг / мл 04 10.7 мкг / мл
Полимиксин B 3,3 мкг / мл 0,125 мкг / мл
Trimethoprim4 20 мкг / мл
Ванкомицин 6 мкг / мл 10 мкг / мл 6 мкг / мл 6 мкг / мл

OFGAC3 OFGAC3 PROTOCOL72

ORGANIC3 OFGAC3 PROTOCOL72 НА ТВЕРДОМ СРЕДЕ

H.pylori — привередливый организм, способный расти только в узких условиях. Его необходимо выращивать на богатых питательными веществами агарах, таких как колумбийский кровяной агар, с добавлением цельной крови любого из множества крупных млекопитающих, таких как лошадь, бык или овца. Пониженное давление кислорода имеет решающее значение; поэтому обычно используется закрытая контейнерная система, способная создавать микроаэрофильные условия. Многие лаборатории добились успеха при выращивании H. pylori на чашках с использованием инкубатора для тканевых культур, установленного на 37 ° C и 5 или 10% CO 2 с подносом с дистиллированной водой, установленным на дне инкубатора для поддержания влажности.В зависимости от изолята, дозы посевного материала, свежести и влажности чашек рост обычно наблюдается от двух до пяти дней. Однако некоторым лабораториям не удалось добиться роста H. pylori с помощью этого метода. Таким образом, наиболее надежным методом остается закрытая контейнерная система. Обычно это анаэробный сосуд с оболочкой из микроаэрофильной системы. Также необходимо инкубировать в течение нескольких дней при 37 ° C, прежде чем колонии можно будет легко наблюдать.Различные виды желудочных Helicobacter , такие как H. pylori, H. felis и H. mustelae , различаются по морфологии колоний. H. felis чрезвычайно подвижен и легко образует сливающиеся газоны, которые для неподготовленного глаза могут напоминать незасеянные тарелки. Следовательно, глаз должен быть обучен обнаруживать рост H. felis по блеску или дымке на пластине. H. pylori и H. mustelae образуют маленькие, круглые, полупрозрачные колонии, которые могут быть впервые видны при уколе булавкой уже через 2–4 дня, постепенно увеличиваясь.

Материалы
  • Чашки со свежеприготовленным кровяным агаром, содержащие соответствующий антибиотик (см. Протокол поддержки 1)

  • Чашки, содержащие жизнеспособные колонии Helicobacter , жидкую культуру Helicobacter (Базовый протокол 2) или замороженный исходный материал Helicobacter

  • Одноразовые разбрасыватели бактерий (PGC Scientific), лабораторные разбрасыватели стекла или инокуляционные петли

  • Анаэробные сосуды с закрывающейся крышкой (модель BBL No.100 использует одну оболочку микроаэрофильной системы и вмещает 12 планшетов; Модель 150 использует три конверта GasPak и вмещает 36 планшетов.) В качестве альтернативы можно использовать стандартные инкубационные контейнеры BD GasPak ™ EZ (вмещает 12–18 планшетов) или большие (вмещает 30–33 планшетов) или контейнеры / микроаэрофильные системы других производителей.

  • Микроаэрофильные системные конверты, такие как бумажный пакетик BD GasPak ™ EZ Campy (каталог Becton Diskinson № 260680) или пакет Oxoid CampyGen ™ (каталог Oxoid CN0025 или CN0035), оба из которых содержат активированный уголь и аскорбиновую кислоту.Эти системные конверты заменили конверты для микроаэрофильных систем BBL CampyPak Plus и комплекты для генерации оксоидного газа — Campylobacter System (каталог № BR0056 и BR0060) во многих странах. Последние системы, которые все еще могут быть доступны в некоторых странах, используют палладиевые катализаторы и генерируют диоксид углерода и водород для истощения кислорода, тогда как в более новых системах замены катализаторы не используются и вырабатывается только диоксид углерода.

  1. Засейте свежеприготовленные чашки с кровяным агаром несколькими колониями из жизнеспособной чашки, используя инокуляционную петлю; в качестве альтернативы инокулируйте от 20 до 100 мкл размороженного материала из замороженной массы или жидкой культуры.

  2. Используйте разбрасыватель бактерий или петлю для посева, чтобы распределить материал вперед и назад по всей пластине сверху вниз. Поверните тарелку на 90 ° и повторите.

  3. Накройте чашки и поместите их в анаэробные сосуды.

    • При культивировании H. pylori и H. mustelae на чашках, держите чашки перевернутыми во время инкубации. Однако для Helicobacter felis не переворачивайте чашки. H. felis очень подвижен, и дополнительная влага, которая капает на чашку при культивировании неинвертированным способом, помогает ему расти (см. «Критические параметры и устранение неисправностей» и ПРИЛОЖЕНИЕ 4A).

    • Некоторые лаборатории помещают смоченное в воде бумажное полотенце в анаэробный сосуд для создания увлажненной атмосферы. Однако добавление воды к некоторым типам оболочки микроаэрофильной системы (см. Шаг 4) помогает достичь той же цели. Из-за высокого содержания влаги в анаэробных банках важно тщательно дезинфицировать банки между использованием; также может быть полезно включить в среду противогрибковую и / или селективную антибиотическую добавку (см.).

  4. При использовании катализатора, содержащего оболочку микроаэрофильной системы , отрежьте угол, разделите края и поместите внутрь анаэробного сосуда катализатором наружу.Добавьте 10 мл воды в каждый конверт, затем закройте крышку анаэробной банки. Поместите сосуд в инкубатор с температурой 37 ° C или в теплую комнату. Новые пакетики, содержащие активированный уголь / аскорбиновую кислоту, не требуют воды, но мы обнаружили, что включение влажного бумажного полотенца в банку может ускорить рост Helicobacter и восстановление организмов после биопсии.

    • Доступно несколько различных типов конвертов газогенерирующих микроаэрофильных систем. Убедитесь, что вы выбрали правильный, иначе бактерии Helicobacter могут не расти.Обратите внимание, что H. pylori является микроаэрофильным, а не анэробным. Поэтому не выбирайте систему, предназначенную для анэробов (без кислорода или с очень низким содержанием кислорода).

    • Если имеется инкубатор, в котором можно управлять тремя газами, или если можно получить газовые баллоны с индивидуальной смесью, их можно использовать вместо анаэробных сосудов и конвертов газогенераторных систем. Инкубатор должен быть настроен на подачу от 5% до 7% O 2 /10% CO 2 с остатком N 2 . Если инкубатор позволяет контролировать два газа плюс воздух, установите его на 20–35% воздуха (что дает 5–7% кислорода), 10% CO 2 и баланс N 2 .Отметим также, что мы добились определенного успеха при использовании стандартных инкубаторов CO 2 , настроенных на 5%, предпочтительно 10% CO 2 . Для определения оптимальной газовой смеси для конкретного инкубатора может потребоваться метод проб и ошибок.

  5. Через 3-4 дня откройте банку и проверьте чашки на предмет роста. Если рост отсутствует или наблюдается только низкий рост, чашки можно вернуть в банку со свежим газовым пакетом еще на 2–3 дня.

    • H. pylori и H.Mustelae образуют отдельные колонии размером с булавочную головку, которые постепенно становятся больше и их легче идентифицировать (). Колонии на чашках с плотной культурой могут сливаться в сливающийся газон, который приобретает характерный блеск, если смотреть на чашку под углом. Таким образом, если необходимо подсчитать отдельные колонии H. pylori или H. mustelae, важно время, и может потребоваться исследовать чашки в двух или трех разных временных точках. H. felis имеет тенденцию образовывать сливные листы в течение нескольких дней культивирования. Раннее обследование может позволить подсчитать отдельные колонии, но эти колонии могут быть очень маленькими и их трудно обнаружить.

      Морфология колоний H. pylori

      H. pylori высевали на чашку с кровяным агаром 6 дней назад. Круглые полупрозрачные колонии иллюстрируют характерный внешний вид H. pylori , выращенного на чашках. Отдельные колонии на правой половине планшета возникли в результате трехкратного разбавления иннокулята, использованного на левой стороне планшета. Таким образом, колонии на левой стороне более многочисленны и меньше, вероятно, в результате истощения питательных веществ.При еще более концентрированном инокуляте отдельные колонии сливались бы в сливной полупрозрачный мат, что лучше всего наблюдалось, наклоняя пластину под углом к ​​падающему свету.

ПРОТОКОЛ ПОДДЕРЖКИ 1

ПОДГОТОВКА ПЛАСТИН КРОВЯНОГО АГАРА ДЛЯ РОСТА ВИДОВ

HELICOBACTER

Для успешного культивирования организмов Helicobacter необходимо использовать чашки свежего питательного кровяного агара. Коммерчески приготовленные тарелки могут работать, но свежесть этих тарелок нельзя контролировать, и они часто могут быть слишком старыми или слишком сухими.Кроме того, им не будет хватать соответствующих селективных антибиотиков. Если у вас нет доступа к надежной бактериологической лаборатории, которая может подготовить свежие чашки в соответствии со спецификациями, лучше приготовить их в собственной лаборатории. Подойдет любой из нескольких питательных агаров, рекомендованных для роста привередливых организмов, в том числе колумбийский агар, основа Мюллера-Хинтона и основа кровяного агара (доступная от BBL, торговая марка Becton Dickinson). Важно, чтобы тарелки были относительно свежими и влажными.При подготовке чашек дайте агару затвердеть только до его затвердевания (не в течение ночи). Если чашки не будут использоваться немедленно, храните их в запечатанных пластиковых рукавах при температуре 4 ° C не более 2–3 недель.

Материалы
  • Основа питательного агара: основа колумбийского агара, основа агара Мюллера-Хинтона или основа кровяного агара (доступна в BBL; также см. ПРИЛОЖЕНИЕ 2C )

  • Базовые растворы антибиотиков (см.)

  • Дефрибринированная цельная кровь (лошадь, овца или бык), стерильная (Cleveland Scientific)

  • 1000-миллилитровые стеклянные колбы Эрленмейера или круглодонные стеклянные колбы или 1000-миллилитровые бутыли для культур тканей

  • Водяная баня 56 ° C

  • Стерильные чашки Петри из полистирола диаметром 100 мм с рукавами

  1. Взвесьте рекомендованное производителем количество питательной агаровой основы для 500 мл среды и добавьте в колбу или бутыль, содержащие 500 мл дистиллированной или водопроводной воды.Взбалтывайте до тех пор, пока весь порошок не распределится и не будет свободно взвешиваться.

  2. Неплотно накройте сосуды и автоклав при стандартных условиях для жидких реагентов (18 фунтов на кв. Дюйм / 120 ° C) в течение 20 мин.

  3. Извлеките емкости из автоклава и поместите в водяную баню 56 ° C.

  4. Добавьте соответствующее количество антибиотиков, необходимых для конкретных видов Helicobacter (см.).

  5. Добавьте 35 мл дефибринированной цельной крови, предварительно нагретой до комнатной температуры.

    • В качестве альтернативы можно использовать «замороженную» цельную кровь, которая была заморожена и разморожена для получения гемолиза; однако авторы не сочли это необходимым.

  6. Снимите колбу с водяной бани и осторожно перемешайте, пока кровь не распределится равномерно. Сведите к минимуму образование пузырей.

  7. Немедленно разлить среду по чашкам Петри диаметром 100 мм и удалить пузырьки пламенем. Сложите теплые чашки в группы по четыре или пять и дайте остыть при комнатной температуре (только до затвердевания агара).

  8. После затвердевания агара поместите чашки в пластиковый рукав и храните при 4 ° C до тех пор, пока не потребуется.

БАЗОВЫЙ ПРОТОКОЛ 2

КУЛЬТУРА

HELICOBACTER PYLORI В ЖИДКОЙ СРЕДЕ

Helicobacter также можно выращивать в жидких средах. В зависимости от вида можно использовать несколько стратегий. Некоторые богатые питательными веществами среды, такие как Brain Heart Infusion или бульон Brucella , будут поддерживать рост при добавлении 10% инактивированной нагреванием фетальной бычьей сыворотки (FBS).Пониженное давление кислорода может быть обеспечено либо за счет использования закрытой контейнерной системы, способной создавать микроаэрофильные условия, либо, в случае H. pylori , за счет использования инкубатора CO 2 . Для роста требуется инкубация при 37 ° C. Экспоненциальный рост или даже насыщенные культуры могут быть получены всего за 24 часа, в зависимости от дозы посева.

Материалы
  • Бульон Brucella или другая подходящая жидкая среда с добавлением 10% (об. / Об.) Термоинактивированной FBS

  • Чашка с агаром, содержащая сильный рост жизнеспособных H.pylori (Основной протокол 1)

  • Одноразовые разбрасыватели бактерий (PGC Scientific) или стеклянные разбрасыватели лабораторного производства

  • 25 см 2 флаконы для культивирования тканей из полистирола

  • 37 ° C, 5% CO 2 инкубатор

  1. Поместите 1 мл бульона Brucella /10% среды FBS в центр 100-миллиметрового планшета с культурой H. pylori .

  2. С помощью стерильного разбрасывателя бактерий поднимите H.pylori с пластины путем непрерывного аккуратного сгребания поверхности. Слегка наклоните пластину вперед и соберите жидкость к переднему краю.

  3. Перенесите 100 мкл или более суспензии H. pylori в 25-сантиметровую колбу для тканевых культур 2 , содержащую 10 мл бульона Brucella / среды FBS.

  4. Закрепите крышку колбы так, чтобы она была достаточно свободной для газообмена, но не настолько ослаблена, чтобы не упасть.

  5. Поместите колбу в инкубатор с температурой 37 ° C, 5% CO 2 , стоя вертикально.

  6. Дайте культуре вырасти за ночь. Проверьте рост Helicobacter , осторожно встряхнув колбу, чтобы суспендировать бактерии, а затем поместите колбу горизонтально на инвертированный микроскоп. H. pylori , выращиваемый в жидкой культуре, имеет тенденцию к образованию мелких и крупных агрегатов, и после того, как встряхивание колбы стабилизируется и более крупные агрегаты оседают на нижней поверхности горизонтальной колбы, может быть полезно сосредоточить внимание на этих агрегатах при низком ( 4-кратное или 10-кратное увеличение объектива), чтобы определить глубину резкости, на которой индивидуальный H.pylori . Затем с помощью микроскопа с 20-кратным или предпочтительно с 40-кратным увеличением найдите высокоподвижные бактерии как признак здоровой и очень жизнеспособной культуры. Фазовые цели могут улучшить визуализацию жидких культур. (См. Дополнительные материалы, Supp Movie S1 и Supp Movie S2)

  7. Пассирование культуры путем переноса небольшой аликвоты в другую колбу, содержащую 10 мл бульона Brucella / среды FBS.

    • Прохождение до начала снижения жизнеспособности (ОП 0.От 2 до 0,3 или ниже).

    • Объем аликвоты, используемой для пассажа, сильно варьируется и должен зависеть от плотности культуры и того, как скоро новая культура должна достичь насыщения. Обычно от 100 до 200 мкл здоровой культуры создают насыщенную культуру в течение 24-48 часов. На этом этапе можно начать выращивание более крупных культур, используя 60 мл среды в 75-см колбе 2 или 100 мл в 150-см колбе 2 .

АЛЬТЕРНАТИВНЫЙ ПРОТОКОЛ

КУЛЬТУРА

HELICOBACTER ВИДОВ, ЗА ИСКЛЮЧЕНИЕМ H.PYLORI В ЖИДКОЙ СРЕДЕ

Статические жидкие культуры, способные расти в стандартных условиях инкубатора для тканевых культур, были описаны только для H. pylori (см. Основной протокол 2). Другие виды желудочных Helicobacter , такие как H. felis , требуют постоянного встряхивания и микроаэрофильных закрытых систем культивирования, например авторам не удалось вырастить H. felis в жидкой культуре при перемешивании в инкубаторе CO 2 ; следовательно, требуются альтернативные методы выращивания.Отсутствие инкубатора CO 2 или нежелание коллег разрешить использование инкубатора для тканевых культур для роста бактериальных культур (из-за опасений по поводу загрязнения) также могут способствовать альтернативным стратегиям. Большинство желудочных патогенов легко выращиваются в той же жидкой культуральной среде, которая описана в Основном протоколе 2, при помещении в подходящую колбу в анаэробном сосуде на роторном шейкере.

Дополнительные материалы (также см. Базовый протокол 2)
  • Автоматическое дозирующее устройство (например,g., Drummond Pipet-Aid или, для объемов ≤1 мл, Gilson Pipetman или эквивалентный автоматический дозатор)

  • Пробирки для культивирования 5 мл

  • Бутылки Эрленмейера на 500 мл или для культур тканей, которые помещаются внутри модели BBL No. 100 анаэробный сосуд

  • Анаэробный сосуд (и) с закрывающейся крышкой (модель BBL 100 или эквивалент)

  • Конверты для микроаэрофильной системы (см. Базовый протокол 1)

  • Роторный шейкер 37 ° C с Кронштейны объемом 2 литра для установки BBL модели No.100 анаэробный сосуд

  • Дополнительные реактивы и оборудование для количественного определения Helicobacter (см. Основной протокол 2; см. Основной протокол 3 для H. felis ) и исследования влажного крепления Helicobacter (протокол поддержки 4)

  1. Поместите 1 мл бульона Brucella /10% среды FBS в центр чашки с культурой H. pylori .

  2. С помощью стерильного разбрасывателя бактерий поднимите H.felis с плиты путем непрерывного аккуратного сгребания поверхности. Слегка наклоните пластину вперед и соберите жидкость к переднему краю.

  3. Перенесите собранные бактерии в стерильную пробирку объемом 5 мл с помощью автоматического дозатора.

  4. Поместите аликвоту, эквивалентную бактериям, собранным с половины чашки (0,5 мл), в стерильную колбу Эрленмейера на 500 мл, содержащую 100 мл среды Brucella / FBS.

    • Также возможно прохождение небольшого объема существующей, активно растущей жидкой культуры.Посевной материал будет варьироваться от 1 до 10 мл в зависимости от жизнеспособности культуры и скорости, с которой желательно, чтобы произошел новый рост.

  5. Поместите колбу с засеянной средой в анаэробный сосуд.

  6. Отрежьте угол оболочки при использовании оболочки газогенерирующей системы с катализатором, разделите края и поместите внутрь анаэробного сосуда катализатором наружу. Добавьте 10 мл воды в каждый конверт, затем закройте крышку анаэробной банки.Если вы используете пакетики без катализатора, выньте пакетик из фольги, вставьте его в емкость и закройте ее крышкой.

  7. Поместите запечатанный сосуд в кронштейн для 2-литровой колбы на орбитальном шейкере при 37 ° C.

  8. Инкубируйте при встряхивании при 100–125 об / мин в течение 24–48 часов.

  9. В конце этой инкубации или ранее удалите аликвоту культуры и определите оптическую плотность (см. Протокол поддержки 2; см. Протокол поддержки 3 для H.felis ).

  10. Приготовьте влажную основу (см. Протокол поддержки 4) и проверьте его подвижность и отсутствие загрязнения другими бактериями.

ПРОТОКОЛ ПОДДЕРЖКИ 2

КОЛИЧЕСТВО

HELICOBACTER ОРГАНИЗМОВ ПО КУЛЬТУРАМ

И H. pylori , и H. mustelae образуют отдельные колонии при выращивании на содержащей кровь агаровой основе. Таким образом, серийное разведение и подсчет колоний можно использовать для количественного определения как H.pylori и H. mustelae . Однако для скорости и удобства может быть более эффективным составить кривую роста, чтобы концентрацию бактерий можно было определить просто путем измерения оптической плотности при выращивании в жидкой культуре.

В следующем методе в качестве примера используется H. pylori ; однако другие виды Helicobacter также могут быть количественно определены с помощью этой процедуры, за исключением H. felis , с которым следует обращаться, как описано в протоколе поддержки 3.

Материалы
  • Бульон Brucella или другая подходящая жидкая среда с добавлением 10% (об. / Об.) Термоинактивированной FBS

  • Активно растущая жидкая культура H. pylori (см. Основной протокол 2 или альтернативный Протокол)

  • Чашки со свежеприготовленным кровяным агаром, содержащие соответствующий антибиотик (см. Протокол поддержки 1)

  • 25 см 2 колба для культуры ткани

  • 37 ° C, 5% CO 2 инкубатор

  • Спектрофотометр с видимым спектром длин волн, предпочтительно с адаптером для микрокюветы

  • Кювета или микрокювета

  • Стерильные пробирки для приготовления разведений

  • Одноразовые разбрасыватели бактерий (PGC Scientific) или лабораторные разбрасыватели стекла

  • Дополнительные реактивы и оборудование для микроаэрофильного культивирования Hel на чашках icobacter (Основной протокол 1)

  1. Поместите 10 мл бульона Brucella /5% среды FBS в 25-см колбу для культуры ткани 2 и засевайте 100 мкл лог-фазовой культуры H .pylori . Поместите в инкубатор 37 ° C, 5% CO 2 .

  2. Несколько раз в день равномерно ресуспендировать бактерии, вращая колбу, извлекать аликвоту 100 мкл и переносить в кювету или микрокювету для спектрофотометра.

    • В зависимости от жизнеспособности исходной культуры для завершения кривой роста может потребоваться от 1 до 3 дней или даже больше.

  3. Определите OD 550 культуры, используя бульон Brucella /10% FBS в качестве холостого опыта.

  4. Используя стерильные пробирки, приготовьте последовательные 10-кратные разведения аликвоты от 1:10 2 до 1:10 5 .

  5. Засейте 10 мкл каждого разведения на чашку с кровяным агаром с антибиотиками и равномерно распределите с помощью бактериального разбрасывателя до тех пор, пока на чашке не останется жидкости. Отметьте каждую чашку или часть используемого планшета с указанием точки времени и разведения.

    • Чтобы уменьшить количество необходимых чашек, каждую чашку можно разделить на половину или даже трети с помощью маркера на дне чашки и распределения каждого 10-мкл посевного материала только в отмеченных границах.

  6. Накройте чашки и поместите в анаэробные сосуды с GasPaks, как описано в основном протоколе 1.

  7. Повторите шаги 2–6 с жидкими культурами до тех пор, пока OD 550 не приблизится к 0,5.

  8. Оцените чашки через 4–5 дней и подсчитайте колонии, рассчитав разведение и объем, чтобы определить количество колониеобразующих единиц (КОЕ) на миллилитр.

    • Например, если 10 мкл разведения 1: 1000 дает 25 колоний, то имеется 100 × 1000 × 25 КОЕ = 2.5 × 10 6 КОЕ на миллилитр исходного образца.

  9. Постройте график OD 550 в зависимости от КОЕ, чтобы получить кривую роста.

    • Как отмечалось выше, авторы обнаружили, что OD 550 0,1 обычно дает ~ 10 7 КОЕ в их лабораториях. Однако конкретные условия в другой лаборатории могут быть совершенно другими, поэтому лучше построить собственную кривую роста.

  10. Повторите эту процедуру не менее двух раз и усредните результаты, чтобы получить достаточно точную кривую роста.

ПРОТОКОЛ ПОДДЕРЖКИ 3

КОЛИЧЕСТВО

HELICOBACTER FELIS ПО КУЛЬТУРАМ

H. felis не будет надежно формировать отдельные колонии, и даже если отдельные колонии наблюдаются с H. felis -, эти колонии могут быть ниже представляют количество присутствующих жизнеспособных организмов. Чтобы попытаться оценить количество «КОЕ» H. felis в исходных культурах, авторы использовали два подхода. Первый — использовать H.pylori как суррогат кривой роста H. felis . Следовательно, если кривая роста H. pylori показывает, что OD 550 , равная 0,1, равна 10 7 КОЕ H. pylori , разумной экстраполяцией будет то, что OD 550 для культуры H .felis также будет представлять ~ 10 7 КОЕ H. felis . Второй подход — приготовить субконфлюэнтную культуру H. felis и произвести серийные разведения этой культуры в бульоне Brucella .Пипетируйте аликвоту соответственно разведенной культуры в гемоцитометр ( ПРИЛОЖЕНИЕ 4A ) и быстро подсчитайте количество подвижных организмов при 400-кратном общем увеличении. Это сложно, поскольку необходимо использовать мощный объектив микроскопа, а бактерии H. felis очень подвижны и могут перемещаться в квадраты сетки гемацитометра и выходить из них. Авторы обнаружили, что эти два метода дают числа, которые находятся в разумном согласии друг с другом.

ПРОТОКОЛ ПОДДЕРЖКИ 4

КОЛИЧЕСТВЕННОЕ ОПРЕДЕЛЕНИЕ

HELICOBACTER КОЛИЧЕСТВЕННЫМ ПЦР

Количественное определение H.pylori и H. felis в биопсиях желудка можно получить с помощью количественной ПЦР с использованием стандартной кривой, состоящей из определенных концентраций хромосомной ДНК соответствующих бактерий. Эти процедуры основаны на отборе подходящих биопсий, которые включают части желудка, наиболее вероятно заселенные бактериями Helicobacter, и на эффективном выделении общей ДНК из биопсии. Этот анализ подходит для обнаружения менее 50 организмов, но, в отличие от количественного определения по культуре, этот анализ не делает различий между жизнеспособными и нежизнеспособными бактериями.Протокол, описанный ниже для количественной оценки H. pylori , основанный на обнаружении гена ureC , является модификацией процедуры, разработанной He at al. (Он и др., , др., , 2002). Протокол и праймеры, указанные для 16S РНК H. felis , были описаны Kong et al. (Kong et al. 1996). Другие исследователи опубликовали анализы на основе ПЦР с использованием праймеров для других генов Helicobacter, но авторы успешно использовали включенные здесь анализы ПЦР. Как и все протоколы ПЦР, следует проявлять особую осторожность, чтобы свести к минимуму вероятность перекрестного загрязнения образцов за счет использования наконечников фильтров, чистого пространства и специальных реагентов.

Материалы
  • Набор для выделения ДНК

  • Очищенная хромосомная ДНК H. pylori или H. felis

  • Термоциклер реального времени

  • H Планшеты для анализа Multiwell PCR

    928
  • pylori ureC праймеры (прямой 5 ‘- TTATCGGTAAAGACACCAGAAA — 3’; обратный 5 ‘- ATCACAGCGCATGTCTTC — 3’)

    или

  • H. felis 16S rRNA праймеры ATGACGAT; Reward 5 ‘- 5’-CGTTCACCCTCTCAGGCCGGATACC-3 ‘)

  • SYBR Green mastermix

  1. Определите концентрацию ДНК Helicobacter, выделенной из чистой культуры H.pylori с использованием набора для выделения ДНК путем измерения оптической плотности при 260 нм.

  2. Рассчитайте концентрацию числа копий как количество хромосом Helicobacter на микролитр [(концентрация ДНК нг / мкл) / (масса генома Helicobacter)]. Масса генома Helicobacter составляет приблизительно 1,65 Mb, что соответствует приблизительно 1,78 × 10 -6 нг.

  3. Приготовьте серию 10-кратных разведений хромосомной ДНК Helicobacter с наивысшей концентрацией порядка 10 7 копий и самой низкой концентрацией порядка 10 1 копий.

  4. Выделите тотальную ДНК из ткани биопсии желудка с помощью коммерческого набора для выделения ДНК.

    • Важно установить вес биопсии ткани до выделения общей ДНК. Пробирки, которые будут использоваться для проведения биопсии тканей, следует предварительно взвесить, а затем взвесить второй раз после помещения биопсии внутрь. Затем вес пробирки можно вычесть из общего количества, чтобы установить влажный вес биопсии.

    • Также очень важно предпринять шаги для оптимизации выделения ДНК Helicobacter из биопсии ткани, поскольку процедура выделения ДНК также позволит выделить ДНК ткани.Для большинства наборов протокол, который необходимо соблюдать, будет специфическим для выделения тотальной ДНК из ткани. Необходимо внести изменения, чтобы увеличить выделение ДНК из бактерий, например, дополнительный этап при 95 ° C в течение 10 минут после расщепления протеиназой К. Проконсультируйтесь с производителем относительно модификаций и рекомендаций. Комплект DNeasy от Qiagen дает конкретные рекомендации по выделению бактериальной ДНК из образцов тканей.

    • Наконец, не используйте кусочки ткани, масса которых превышает рекомендованную для реакции выделения ДНК.Это приведет к снижению восстановления и чистоте ДНК.

  5. Подготовьте аналитический планшет для количественной ПЦР. Каждый образец должен быть приготовлен в трех экземплярах с использованием 3 мкл экстрагированной ДНК образца плюс 5 мМ каждого из соответствующих праймеров и мастер-микса SYBR green. Довести общий объем до рекомендованного производителем объема с водой. В том же планшете настройте серию разведений стандартной хромосомной ДНК, приготовленной на шаге 3 выше, в трех экземплярах с соответствующими праймерами и SYBR Green.Не забудьте включить набор из трех лунок без ДНК-матрицы в качестве контроля.

  6. Для количественного определения H. pylori с использованием праймеров, специфичных для ureC, выполните реакцию с предварительной стадией денатурации при 95 ° C в течение 10 минут, с последующими 40 циклами денатурации при 95 ° C в течение 10 секунд, отжиг при 55 ° C в течение 10 секунд и удлинение грунтовки при 72 ° C в течение 20 секунд.

    • Для количественного определения H. felis с использованием праймеров, специфичных для 16S РНК, выполните двухэтапную реакцию, состоящую из одного цикла при 50 ° C в течение 2 минут, затем 95 ° C в течение 10 минут, затем 40 циклов денатурации при 95 ° C. в течение 10 секунд и отжиг / удлинение при 60 ° C в течение 60 секунд.

  7. Запрограммируйте термоцилиндр для расчета среднего числа копий ДНК в каждом трехкратном образце на основе стандартной кривой.

  8. Определите бактериальную нагрузку в биопсии ткани путем экстраполяции общего количества копий в общий объем, выделенный из процедуры выделения ДНК, на основе количества копий в 3 мкл, используемых для реакции. Разделите это число на массу ткани, чтобы получить количество копий на 1 мг ткани.

БАЗОВЫЙ ПРОТОКОЛ 3

КУЛЬТУРА

HELICOBACTER ОРГАНИЗМОВ В АГАРОВЫХ СТАБАХ

Непрерывное культивирование организмов Helicobacter in vitro использует много ресурсов в виде продуктов крови, сред и систем газовых пакетов, поскольку H.pylori , как правило, нельзя хранить в течение длительного периода времени без использования замороженных систем хранения. Частое прохождение, происходящее каждые несколько дней или, по крайней мере, один раз в неделю, также увеличивает вероятность занесения переносимых по воздуху плесени и других загрязнителей в культуры. Некоторые из этих проблем можно обойти, приготовив уколы агара для длительного хранения H. pylori или H. felis при 37 ° C (Xu et al. 2010. В этих культурах для уколов агара можно наблюдать видимый рост в пределах несколько дней инокуляции и будет оставаться жизнеспособным до месяца в случае H.felis , или как минимум несколько месяцев в случае H. pylori . Также сообщалось, что небольшие модификации этого метода могут использоваться в качестве альтернативы отправке замороженных культур на сухом льду в качестве метода доставки H. pylori другим исследователям (Reddy et al., 2011).

Материалы
  • Активная культура Helicobacter , растущая на Колумбийском кровяном агаре или приемлемая альтернатива

  • Бульон Brucella или среда для инфузии сердца мозга, содержащая 0.6% агар _

  • Полипропиленовые пробирки с круглым дном, 5 мл, 12 × 75 мм и защелкивающимися крышками (BD Bioscience)

  • Одноразовые посевные петли на 1 мкл

  1. Автоклавная среда при стандартных условиях для жидких реагентов (18 psi / 120 ° C) в течение 20 мин.

  2. Распределите среду с помощью пипетки в стерильных условиях, четыре мл на пробирку. Неплотно закройте пробирки крышками и дайте застыть в течение ночи.

  3. Соберите тяжелый посевной материал бактерий с чашки с колумбийским кровяным агаром, используя одноразовую петлю для переноса.

  4. Воткните петлю в пробирки примерно на две трети глубины агара три-четыре раза.

  5. Неплотно закройте пробирки крышками.

  6. Поместите пробирки в инкубатор для культур тканей при 37 ° C при 5 или 10% CO 2 с емкостью для воды, расположенной на дне инкубатора для поддержания влажности.

  7. Проверьте наличие «мутных следов» в агаре, указывающих на рост бактерий.

    • Может потребоваться удерживать трубки над головой, чтобы потолок служил фоном, и смотреть на трубки под разными углами, чтобы наблюдать облачность, которая образуется в результате увеличения плотности бактерий.Эта облачность может не проявиться до трех-четырех дней. ()

      Укол агара, инокулированный с использованием H. pylori вида

      , H. pylori был инокулирован в укол с агаром приблизительно за 10 дней до этого. Две красные стрелки выделяют «мутную дорожку», по которой H. pylori растет в агаре и из которой можно выделить жизнеспособные H. pylori и пассировать на чашки с кровяным агаром или жидкую культуру.

  8. Плотно закройте пробирки крышками и продолжайте хранить в инкубаторе для культур тканей или при комнатной температуре.

БАЗОВЫЙ ПРОТОКОЛ 4

ПОДГОТОВКА КЛИНИЧЕСКОЙ БИОПСИИ ДЛЯ КУЛЬТУРЫ

HELICOBACTER PYLORI

Материал для биопсии желудочного зажима обычно берут во время эндоскопии у субъектов с симптомами активного гастрита или язвенной болезни. Кроме того, в моделях на животных конечной точкой часто является подтверждение и количественное определение инфекции. Наряду с идентификацией H. pylori в гистологических срезах ткани, культура жизнеспособных H.pylori остается окончательным тестом для положительного диагноза инфекции H. pylori . Кроме того, огромное генетическое и фенотипическое разнообразие изолятов H. pylori создает стимулы для продолжения выделения новых клинических изолятов для дальнейшего экспериментального анализа в лаборатории. H. pylori можно выделить из материала биопсии желудка инфицированных субъектов или экспериментально инфицированных животных путем гомогенизации ткани и инокуляции пластинок с питательным кровяным агаром.Использование бульона для анализа уреазы (см. Протокол поддержки 4) для хранения или транспортировки биопсии может предоставить предварительные доказательства присутствия H. pylori , если индикаторный краситель станет ярко-красным в течение 24 часов после извлечения.

Обычно во время эндоскопии у каждого пациента можно получить несколько биопсий. Одна или несколько биопсий помещаются в одну пробирку для культивирования. В дополнение к культивированию, как правило, полезно отправить дополнительные биопсии в гистологическую лабораторию для вложения, срезов и окрашивания.Эти биопсии следует собирать в 10% забуференный формалин. Если доступно достаточное количество биопсий, также может быть полезно поместить одну или несколько биопсий в замораживающий флакон, а затем погрузить в жидкий азот и хранить при -80 ° C или ниже, например, для выделения РНК.

Материалы
  • Материал для ущемления желудка

  • Транспортная среда (см. Рецепт) в стерильных пробирках

  • Бульон Brucella или другая подходящая жидкая среда с добавлением 10% (об. / Об.) FBS

  • Свежеприготовленные чашки с кровяным агаром, содержащие соответствующий антибиотик (см. Протокол поддержки 1)

  • Стерильные пинцеты

  • Стерильные одноразовые пестики в виде гранул и 1.Микроцентрифужные пробирки объемом 5 мл (Kontes, каталожный номер 749520)

  • Одноразовые разбрасыватели бактерий (PGC Scientific) или стеклянные разбрасыватели лабораторного производства

  • Дополнительные реагенты и оборудование для микроаэрофильных культур на планшетах Helicobacter (Основной протокол 1 )

  1. Извлеките материал биопсии желудка из клинической лаборатории в транспортной среде.

    • Биопсии для посева должны быть получены как можно скорее после эндоскопии, хотя авторам удалось добиться определенного успеха в культивировании биоптатов, хранящихся в течение ночи при комнатной температуре в транспортной среде.

  2. С помощью стерильных пинцетов извлеките кусочки биопсии из пробирок со средой для транспортировки и поместите в стерильную 1,5-миллилитровую микроцентрифужную пробирку (поставляется вместе с одноразовым пестиком для гранул) с 0,1 мл бульона Brucella /10% FBS.

  3. Измельчите ткань стерильным одноразовым пестиком для гранул и добавьте дополнительно 0,1 мл бульона Brucella / FBS.

  4. Засейте 10 мкл гомогената на чашку с кровяным агаром с соответствующими селективными антибиотиками и распределите с помощью петли для посева или разбрасывателя.

  5. Накрывающие чашки, поместите в анаэробные сосуды с оболочками микроаэрофильной системы и культивируйте, как описано в Базовом протоколе 1, шаги с 3 по 5.

ПРОТОКОЛ ПОДДЕРЖКИ 5

ПОДТВЕРЖДЕНИЕ

HELICOBACTER PYLORI 04 Рост использование селективных антибиотиков значительно снизит рост / изоляцию микроорганизмов, отличных от Helicobacter , из желудков животных, все же необходимо быть уверенным, что извлеченные организмы на самом деле принадлежат к виду Helicobacter .Хотя для этого можно использовать процедуры снятия отпечатков нуклеиновых кислот или ПЦР, существуют также простые морфологические и биохимические тесты, которые можно использовать для скрининга предполагаемого роста Helicobacter на чашках. Для этого используют инокуляционную петлю для отбора материала с чашки с видимым ростом и затем исследуют морфологию организмов с помощью фазово-контрастной микроскопии влажного образца и / или микроорганизмов, окрашенных по Граму ( ПРИЛОЖЕНИЕ 3C ). Дополнительные подтверждающие процедуры включают тестирование бактерий на активность уреазы, каталазы и оксидазы; эти методы также описаны ниже.

Все виды желудочных Helicobacter продуцируют большое количество фермента уреазы, которая может расщеплять мочевину на диоксид углерода и аммиак. Считается, что аммиак смягчает кислотность желудка и, таким образом, помогает бактериям в его колонизации. Возможно, особенно у экспериментальных животных, для других уреаз-положительных микроорганизмов (например, видов Proteus ) колонизировать желудок. Таким образом, для подтверждения идентичности H.pylori . Как отмечалось выше, для дальнейшей проверки можно использовать методы снятия отпечатков нуклеиновых кислот и ПЦР.

Мокрое покрытие / морфология

Жизнеспособные Helicobacter виды будут очень подвижными, и если на предметное стекло поместить достаточное количество бактерий, их можно будет легко обнаружить с помощью фазово-контрастной микроскопии при общем увеличении от 400 до 1000 раз. H. felis относительно длинный и имеет отчетливую морфологию штопора с узкими спиралями. H. pylori и H.mustelae короче, спиральки менее отчетливы. В целом они имеют форму запятой или крыла чайки. В здоровой культуре бактерии будут «плавать» довольно быстро. Разросшаяся культура может давать оптическую плотность в желаемом диапазоне, но наблюдение низкой подвижности или ее отсутствия будет указывать на отсутствие жизнеспособности. Таким образом, важно всегда проверять посевы на морфологию и подвижность.

Тест на уреазу

Поместите полную петлю материала в 0,3 мл бульона для теста на уреазу Стюартса (см. Рецепт).Бульон должен стать розовым в течение нескольких минут.

Тест каталазы

Поместите полную петлю материала в 0,2–0,5 мл 3% -ной H 2 O 2 . Жизнеспособный Helicobacter будет быстро образовывать пузырьки. Это можно сделать в 96-луночном микротитровальном планшете, если нужно протестировать несколько образцов.

Оксидазный тест

Либо поместите петлю материала в каплю дистиллированной воды на Bacto Differentiation Disk Oxidase (BD Biosciences, кат. № 1633), либо поместите диск на колонию или зону роста на планшете с капля дистиллированной воды.Розовый или бордовый цвет в течение 10–20 минут, который в конечном итоге становится почти черным, указывает на положительный результат теста.

РЕАГЕНТЫ И РАСТВОРЫ

Используйте деионизированную дистиллированную воду во всех рецептах и ​​этапах протокола. Стандартные стандартные решения см. В ПРИЛОЖЕНИЕ 2A ; сведения о поставщиках см. в ПРИЛОЖЕНИИ ДЛЯ ПОСТАВЩИКОВ .

Бульон для анализа уреазы Стюарта

  • 0,1 г дрожжевого экстракта

  • 0,091 г KH 2 PO 4

  • 0.095 г Na 2 HPO 4

  • 20,0 г мочевины

  • 0,010 г фенолового красного

  • 1 литр дистиллированной H 2 O

  • С помощью небольшого количества HCl

  • Обратите внимание, что этот рецепт имеет в 100 раз меньшую буферную способность, чем некоторые коммерчески доступные бульоны для анализа уреазы. Если тестовый бульон используется с более высокой концентрацией буфера, он будет менее чувствительным и даст много ложноотрицательных результатов.Авторы обычно делают только 500 мл за раз, а затем используют часть из них в качестве транспортной среды (см. Рецепт).

Транспортная среда для Helicobacter

В бульон для анализа уреазы Стюарта (см. Рецепт) добавьте 20 г глюкозы или сахарозы на 100 мл. Стерилизовать фильтрованием и хранить до нескольких месяцев при 4 ° C.

КОММЕНТАРИЙ

Общая информация

Helicobacter pylori — это грамотрицательная микроаэрофильная спиральная бактерия, которая преимущественно обитает в антральном отделе желудка человека (Marshall and Warren, 1984; Suerbaum and Michetti, 2002).Хотя H. pylori можно найти в теле или дне желудка или в желудочной метаплазии двенадцатиперстной кишки, он, по-видимому, хорошо адаптирован только к тканям желудка. Его не обнаруживают, например, в нормальном тонком или толстом кишечнике или в пищеводе. Организм находится в слое слизи как поверхностного, так и железистого эпителия. Эта экологическая ниша служит для защиты организма от суровых условий окружающей среды желудка и от эффекторных механизмов хозяина. Однако, несмотря на то, что реакции хозяина неэффективны в очищении организма, H.pylori вызывает состояние активного / хронического воспаления желудка (с участием как нейтрофилов, так и лимфоцитов) у всех инфицированных людей. Хотя у большинства инфицированных людей нет явного заболевания, у подгруппы инфицированных людей могут развиться пептические язвы, рак желудка или лимфома, связанная со слизистой оболочкой желудка, лимфатической ткани (MALT). Исход инфекции определяется сложным взаимодействием между факторами вирулентности бактерий и реакцией хозяина. Лица с высоким выходом желудочного сока, инфицированные вирулентным вирусом H.pylori могут быть предрасположены к инфекциям с преобладанием антрального отдела желудка и гастриту, ведущему к язвенной болезни, в то время как люди с пониженной кислотностью желудочного сока склонны к инфицированию как антрального отдела, так и тела желудка, а также к пангастриту, атрофии железистых и париетальных клеток. в теле / ​​дне желудка и аденокарциноме желудка.

Оценка генома H. pylori выявила большое разнообразие изолятов (Jiang et al., 1996; Tomb et al., 1997; Suerbaum, 2000; Kawai et al., 2011). Таким образом, хотя полные геномы двадцати отдельных изолятов были опубликованы, была идентифицирована гипервариабельная область хромосомы, которая может содержать до 7% от общего числа генов (Alm et al., 1999). Многие из этих генов специфичны для отдельных изолятов. Это может затруднить полную характеристику фенотипа H. pylori . Кроме того, хотя плазмиды были идентифицированы в штаммах H. pylori , было описано или разработано несколько стабильных плазмид Helicobacter , подходящих для клонирования и методов экспрессии (Kleanthous et al., 1991; Стэнли и др., 1992; Бересвилл и др., 2005). Введение генов непосредственно в хромосому можно осуществить посредством естественной трансформации или электропорации с клонирующими векторами E. coli , но эффективность трансформации штаммов H. pylori сильно различается; поэтому необходимо идентифицировать конкретные изоляты, которые облегчают генетические манипуляции (Tsuda et al., 1993).

Процедуры в этом разделе описывают, как вырастить Helicobacter организмов с использованием чашек, агаровых уколов или жидких культур, как количественно определить виды Helicobacter и как восстановить H.pylori из клинической биопсии. Виды Helicobacter имеют тенденцию хорошо расти на средах, ранее установленных для других требовательных к кишечнику микроорганизмов (например, см. ПРИЛОЖЕНИЕ 2C ), хотя часто требуется добавление крови или сыворотки животных. Выращивание чистых культур видов Helicobacter облегчило изучение генетики, микробиологии, вирулентности и иммунологии Helicobacter . Поскольку вида Helicobacter связаны с растущим числом желудочных и внегастральных патологий, способность успешно выращивать виды Helicobacter может быть важным навыком.

Критические параметры и устранение неисправностей

H. pylori и другие виды Helicobacter считаются привередливыми организмами, которые трудно изолировать и размножить. И температура, и давление кислорода являются критическими параметрами для оптимального роста. Если инокуляция чашек из замороженного материала не удалась, необходимо проверить состояние анаэробного сосуда и целостность уплотнения в собранном виде. Однако, даже если не удается выявить никаких проблем, стоит попробовать еще раз, поскольку создание исходной культуры может быть трудным (см. Ожидаемые результаты).Точно так же устоявшиеся культуры нередко теряют жизнеспособность и перестают расти при пассировании. Необходимо проверить герметичность сосуда, чтобы убедиться, что достигается надлежащее давление кислорода, а тестовые полоски для проверки истощения кислорода можно получить у производителей. Также следует оценить свежесть / влажность пластин, через которые проходят бактерии. Авторы обнаружили, что свежесть крови лошади или другого животного, используемой для приготовления этих тарелок, также важна.

Правильно действующие газогенераторные системы в этих методах с закрытым контейнером имеют решающее значение для их успеха. В прошлом было доступно несколько вариантов на выбор, в том числе системы, в которых использовались катализаторы и генерировались как водород, так и диоксид углерода. В настоящее время доступен более ограниченный выбор: конверты BD GasPak ™ EZ Campy (Becton Dickinson) и CampyGen ™ (Oxoid) не используют катализаторы и генерируют только CO 2 , что является наиболее доступным. Авторы использовали обе эти системы для выращивания H.pylori и H. felis . Эти конверты просты в использовании и просто требуют, чтобы пользователь вынул пакетик из запечатанного конверта и поместил его в банку с пластинами агара непосредственно перед закрытием крышки. Быстрая герметизация емкости после добавления пакетиков очень важна, поскольку эти системы начинают очень быстро выделять CO 2 после контакта с воздухом. Эффективность этих пакетов для роста Helicobacter можно повысить, поместив влажное бумажное полотенце на дно банки перед помещением пластинок с бактериями и газообразующих саше внутрь.Учитывая трудности, связанные с выращиванием этих требовательных организмов, если рост не наблюдается через пять-семь дней, возможно, стоит повторить процедуру и, возможно, включить тест-полоски для проверки выработки CO 2 / O 2 истощения. После получения культур из биопсий или замороженных культур с использованием герметичных сосудов и систем генерации газа авторы обнаружили, что стандартные инкубаторы CO 2 , установленные на 5–10% CO 2 , могут использоваться для поддержания культур на чашках, жидких культур, и агаровые уколы H.pylori . Для культур на чашках H. pylori рост в инкубаторах CO 2 , как правило, несколько медленнее, чем в закрытых банках, и, за исключением уколов агаром, авторы не добились хороших результатов при выращивании H. felis в CO 2 инкубаторы.

Хотя бактериальное заражение чистых культур при использовании надлежащей техники встречается редко, наличие плесени может быть более проблематичным. Обычно заражение плесенью происходит при двух обстоятельствах. Во-первых, чашки часто загрязняются, когда их проверяют на рост, а затем снова помещают в анаэробные банки для дальнейшего роста.Это в значительной степени связано с удалением крышки планшета, чтобы лучше рассмотреть морфологию колонии. Второй источник загрязнения плесенью часто возникает из-за скопления воды на крышках перевернутых тарелок. Когда вода собирается между краем тарелки и крышкой, она фактически образует перемычку с внешней стороной тарелки. Если споры плесени присутствуют внутри емкости, они могут попасть внутрь пластины по этому водному пути. Решение состоит в том, чтобы держать чашки правой стороной вверх, но сбор капель воды на самом агаре может поставить под угрозу способность бактерий расти в виде изолированных колоний, и, если чашки выращиваются для количественного подсчета, получение точных чисел может быть затруднено. чтобы получить.Дезинфекция колпаков между использованием также может помочь уменьшить рост плесени, как и включение противогрибкового средства (амфотерицин B) в питательную среду.

Если культуры (пластинчатые или жидкие) разрастаются, бактерии могут погибнуть или стать кокковыми по своей природе. Хотя коккоидные организмы технически не могут быть мертвыми, их жизнеспособность может быть трудно определить. Разросшиеся, умирающие или кокковидные культуры дают измеримую оптическую плотность; однако эта оптическая плотность не будет истинным отражением количества полностью жизнеспособных КОЕ организмов Helicobacter .Таким образом, исследование жидких бактериальных культур, растущих в колбах для тканевых культур или путем влажного монтирования культур на чашках, на активную подвижность и ожидаемую морфологию является критическим параметром. (См. Видеоклипы, связанные с базовым протоколом 2 и влажными креплениями в протоколе поддержки 5). При использовании кривой роста и оптической плотности для оценки количества присутствующих организмов очень важно находиться на «верхней стороне» кривой роста, а не на «нижней стороне» или плато. Helicobacter организмы растут намного медленнее, чем многие другие бактерии, и важно периодически проверять их прогресс, чтобы не ждать слишком долго, прежде чем передать их или использовать их для анализа in vitro.

За исключением болезненных состояний, характеризующихся низкой кислотностью желудка, при которых может происходить чрезмерный рост бактерий в желудке многими видами, виды Helicobacter обычно являются единственными бактериями, которые могут успешно колонизировать желудок человека. Однако у копрофагических видов животных, таких как мыши, можно в обычном порядке культивировать многочисленные виды бактерий из тканей желудка. Таким образом, получение клинических или экспериментальных изолятов H. pylori из биопсии желудка может быть связано с заражением другими видами бактерий.Обычно в слизистой оболочке желудка выживает мало бактерий, но при наличии контаминантов можно заподозрить Proteus vulgaris . Он имеет тенденцию быть устойчивым к обычной селективной среде H. pylori . Это еще больше осложняется тем фактом, что Proteus — одна из немногих кишечных бактерий, которые также продуцируют фермент уреазу, что часто приводит к ложноположительным тестам на уреазу. Proteus также имеет тенденцию к быстрому росту и образует большие листы, эффективно покрывая любые H.pylori , которые могут присутствовать в виде небольших изолированных колоний. Следовательно, важно вносить много разведений гомогенатов клинической биопсии в надежде, что H. pylori можно будет выделить на фоне роста Proteus . Совместных результатов наблюдения за морфологией колоний и тестов на уреазу, каталазу и оксидазу, а также отличительной морфологии (спиралевидной формы или формы крыла чайки) и высокой подвижности организмов Helicobacter , наблюдаемых на влажном держателе, обычно достаточно, чтобы различить Helicobacter вида из Proteus видов.

Ожидаемые результаты

Создание жизнеспособных культур H. pylori и других видов Helicobacter может потребовать нескольких попыток, особенно если начать с замороженного материала. Однако, если засевают несколько чашек или предпринимаются повторные попытки, жизнеспособные культуры могут быть получены при условии, что анаэробные сосуды должным образом закрыты. Выполнение последующих пассажей из жизнеспособной культуры, как правило, намного надежнее, а установку легко поддерживать. Можно ожидать, что каждые 3-4 дня будут наблюдаться довольно большие и здоровые колонии после роста этих культур.Аналогичным образом, после создания жидких культур следует ожидать пассажа культур каждые 1-2 дня. Даже если микроскопическое исследование выявляет плотный рост, но минимально подвижные организмы, эти культуры могут быть жизнеспособными и подходящими для инокуляции в свежую среду.

Извлечение жизнеспособного H. pylori из клинической биопсии желудка может быть сложной задачей. Обычно лаборатории, выполняющие эту функцию на регулярной основе, не могут выделить H. pylori даже при положительном результате экспресс-теста на уреазу.Место источника биопсии, свежесть биопсии, лечение субъекта антибиотиками и плотность бактерий в биопсии — все это может повлиять на успех выделения H. pylori из ткани человека.

Вопросы времени

Время, необходимое для культивирования видов Helicobacter на твердой среде, будет варьироваться в зависимости от того, были ли заранее подготовлены чашки с кровяным агаром. Это также будет зависеть от количества засеваемых чашек. В общем, чашки можно подготовить и подготовить к культивированию за несколько часов.Подготовка среды и автоклавирование занимает менее часа. Двумя наиболее трудоемкими этапами являются охлаждение среды до 56 ° C и обеспечение адекватного гелеобразования среды после заливки пластин. Вся процедура может быть выполнена за одно утро или день. Фактическая инокуляция чашек и подготовка банок к инкубации занимают всего несколько минут.

Количество бактерий в исходной культуре можно приблизительно определить за несколько минут, измерив OD 550 и обратившись к кривой роста.Строгое определение КОЕ занимает больше времени, но с помощью ОП и кривой роста можно выбрать одно или два разведения для посева на чашки, что займет всего несколько минут. Затем чашки необходимо инкубировать в течение нескольких дней, но фактический подсчет колоний после их появления также занимает всего несколько минут. Гомогенизация биоптатов тканей и посев на соответствующие чашки занимает несколько минут на биопсию. Подсчет колоний на чашках должен занимать только 1 или 2 минуты на чашку, если не присутствует очень большое количество колоний.Аналогичным образом, тестирование культур на уреазу, каталазу и оксидазу можно выполнить за несколько минут при условии, что необходимые реагенты подготовлены заранее.

Жидкую среду можно приготовить быстрее, чем твердую среду, потому что нет необходимости заливать чашки и давать им возможность загустеть. Подготовка, стерилизация и охлаждение среды (до температуры от 37 ° C до комнатной) займет всего 2–3 часа, и большая часть этого времени тратится на ожидание, чтобы другие задачи можно было выполнять одновременно.Среду (без сыворотки и антибиотиков) можно приготовить заранее и хранить не менее 1 месяца. Добавление исходных растворов антибиотиков и сыворотки и инокуляция среды организмами Helicobacter занимает всего несколько минут. При необходимости приготовление исходных растворов антибиотиков можно произвести за 30 мин.

Построение кривой роста для жидких культур требует от 1 до 2 недель, но большая часть времени тратится на ожидание роста культур. Фактическое время практического использования намного короче, и после того, как кривая роста построена в стандартных условиях, ее не нужно повторять, если только лабораторные условия резко не изменятся.Первым шагом на кривой роста является инокуляция жидкой культуры. Это займет всего несколько минут. Затем через равные промежутки времени (от каждых 30 минут до нескольких раз в день в зависимости от скорости роста) необходимо определять оптическую плотность для аликвоты жидкой культуры, которую затем также необходимо серийно разбавить и засеять на свежую серия тарелок. Эта процедура может занять от 1 до 2 часов в день. Затем свежие чашки необходимо инкубировать в течение нескольких дней, пока не станут видны отдельные колонии.Если колоний еще не видно, чашки возвращают в инкубатор. Когда колонии становятся видимыми, их необходимо подсчитать. Простая проверка чашек занимает всего несколько минут, но подсчет колоний может занять от 1 до 2 часов в зависимости от того, сколько чашек инкубировали одновременно. Поскольку для получения разумного среднего значения всю процедуру придется повторить, она может растянуться, возможно, на 2 недели, а фактическое практическое занятие отнимет от 8 до 16 часов; может потребоваться еще больше времени, если чашки для культивирования не были подготовлены заранее.Поскольку это длительный и трудоемкий процесс, стоит проявить к нему большую осторожность и дважды подумать, чтобы изменить условия культивирования таким образом, чтобы это потребовало построения новой кривой роста. Также обратите внимание, что в какой-то момент времени оптическая плотность кривой роста может продолжать расти, но количество жизнеспособных КОЕ выйдет на плато, а затем уменьшится.

Helicobacter pylori — Лабораторные тесты онлайн AU

Кратко
Также известен как

H.тест на антитела к pylori ; Тест на антиген H. pylori; H. pylori дыхательный тест

Зачем сдавать анализы?

Для диагностики инфекции, вызываемой Helicobacter pylori

Когда сдать анализ?

Если у вас боли в желудочно-кишечном тракте или симптомы язвы

Требуется образец?

Дыхательный тест, ткань слизистой оболочки желудка с помощью гастроскопии, образец стула или образец крови из вены

Требуется подготовка к экзамену?

Нет для анализа крови; есть инструкция к дыхательному тесту; необходима специальная подготовка к гастроскопии

Что тестируется?

Эти тесты ищут доказательства инфекции, вызванной вирусом Helicobacter pylori .В настоящее время известно, что эта бактерия является основной причиной язвенной болезни. H. pylori также связано с развитием рака желудка.

Как отбирается образец для тестирования?

Размер сбора зависит от теста, который запрашивает ваш врач. Это может быть так же просто, как предоставить образец стула (фекалий) для поиска H. pylori или образец крови из вашей вены для обнаружения бактерий.

Более инвазивный тест потребует процедуры, называемой эндоскопией или гастроскопией, которая означает введение трубки через горло в желудок, чтобы взять небольшой кусочек ткани (а) из слизистой оболочки желудка.Биопсия может быть использована для выявления других причин боли в желудке, а также может быть протестирована в лаборатории на H. pylori . H. pylori производит уреазу, особую, которая позволяет ей выжить в среде желудка.

Лаборатория может обнаружить присутствие этой бактерии, ища этот фермент в образце ткани. Ткань также может быть исследована под микроскопом патологом, который будет искать эти бактерии или любые другие признаки заболевания, которые могут объяснить ваши.

Иногда вместо биопсии можно использовать дыхательный тест. Вас попросят выпить специальную жидкость, содержащую безвредный радиоактивный материал. Если в вашем желудочно-кишечном тракте присутствует H. pylori , материал будет разложен на радиоактивный диоксид углерода. Проверив вытесненный воздух, взятый из образца вашего дыхания, лаборатория может определить, есть ли этот организм в вашем теле.

.
Leave a Reply

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2021 © Все права защищены.