Тип 16 и 18: Human Papillomavirus высокого канцерогенного риска (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 типы), ДНК генотипирование [реал-тайм ПЦР]

Содержание

Human Papillomavirus высокого канцерогенного риска (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 типы), ДНК генотипирование [реал-тайм ПЦР]

Выявление возбудителя папиллома-вирусной инфекции (Human Papillomavirus), в ходе которого с помощью метода полимеразной цепной реакции в реальном времени (РТ-ПЦР) исследуется ДНК вирусов в образце биоматериала. При этом определяется наличие высококанцерогенных типов вируса (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58 и/или 59), производится их типирование.

Синонимы русские

Папиллома-вирусы человека высокого канцерогенного риска (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 типы), вирусы папилломы высокого канцерогенного риска (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 типы), ВПЧ высокого канцерогенного риска (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 типы).

Синонимы английские

Papillomavirus hominis, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 types, DNA.

Метод исследования

Полимеразная цепная реакция в режиме реального времени.

Какой биоматериал можно использовать для исследования?

Соскоб из прямой кишки, соскоб урогенитальный.

Общая информация об исследовании

Вирусы папилломы человека (ВПЧ) широко распространены, поражают эпителий кожи и слизистых оболочек и обладают онкогенным потенциалом. ВПЧ передается при тесном контакте с инфицированным эпителием, поэтому основные пути заражения – половой и контактно-бытовой. Возможна передача ВПЧ от инфицированной матери к плоду. Человек может быть инфицирован несколькими типами ВПЧ.

К факторам, провоцирующим развитие ВПЧ-инфекции, относятся: ранее начало половой жизни, большое количество половых партнеров, сниженный иммунитет, применение оральных контрацептивов, авитаминозы, инфекции, передаваемые половым путем, курение и проживание в крупных городах.

Инкубационный период может длиться от 2 месяцев до 2-10 лет. Характерно скрытое течение заболевания, при котором отсутствуют клинические проявления, а при кольпоскопическом, цитологическом и гистологическом обследовании выявляется норма. В 30  % случаев в течение 6-12 месяцев может произойти избавление от вируса. Диагностика скрытой ВПЧ-инфекции осуществляется только методом ПЦР.

При острой инфекции возникают доброкачественные образования, такие как папилломы, бородавки, кондиломы. У детей папиллома-вирусы могут приводить к папилломатозу гортани. Поражение клеток трофобласта папиллома-вирусами чревато спонтанным абортом.

Объединение ДНК папиллома-вируса с геном клетки приводит к дисплазии/неоплазии (чаще всего в переходной зоне шейки матки). К папиллома-вирусам высокого онкогенного риска относятся ВПЧ типов 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 и 68. Инфицирование ими приводит к относительно доброкачественному бовеноидному папулезу или плоскоклеточным интраэпителиальным неоплазиям шейки матки.

Для выявления ВПЧ высокого онкогенного риска используется в основном полимеразная цепная реакция в режиме реального времени, которая позволяет найти ДНК ВПЧ в исследуемом биоматериале и идентифицировать его отдельные типы. Принцип метода основан на амплификации (многократном увеличении числа копий) специфичного для данного возбудителя участка ДНК.

Для чего используется исследование?

  • Для выявления папиллома-вирусной инфекции высокого онкогенного риска.
  • Для подтверждения/исключения персистирования определенного типа ВПЧ.
  • Чтобы оценить степень канцерогенного риска у женщин с дисплазией эпителия шейки матки.

Когда назначается исследование?

  • При первичном скрининге рака шейки матки (наряду с цитологическим исследованием) у женщин старше 30 лет.
  • После хирургического лечения цервикальной интраэпителиальной неоплазии (CIN II) для выявления/исключения персистенции определенного типа ВПЧ высокого онкогенного риска (оценка в динамике).
  • При сомнительных результатах цитологического исследования гинекологических мазков.

Что означают результаты?

Референсные значения: отрицательно.

Причины положительного результата

  • Инфицирование папиллома-вирусом.

Причины отрицательного результата

  • Отсутствие папиллома-вирусной инфекции.
  • Низкое содержание ВПЧ в крови.

Выявление ДНК ВПЧ в исследуемом материале свидетельствует о наличии папиллома-вирусной инфекции. Если ДНК ВПЧ в исследуемом биоматериале не выявляется, то наличие папиллома-вирусной инфекции маловероятно.

Human Papillomavirus высокого канцерогенного риска (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68 типы), ДНК количественно, скрининг с определением возможности интеграции вируса в геном [реал-тайм ПЦР]

Исследование используется для диагностики папиллома-вирусной инфекции, с одновременным определением количества вирусной ДНК в исследуемом материале. Анализ позволяет сделать вывод о степени поражения слизистой, оценить эффективность терапии в процессе лечения. Определяется суммарное количество ДНК 14 типов ВПЧ высокого канцерогенного риска (ВКР) с отдельным определением ДНК ВПЧ 16-го, 18-го и 45-го генотипов. Тест также позволяет оценить вероятность интеграции ВПЧ 16-го, 18-го и 45-го типа в геном человека (что является опасным и прогностически неблагоприятным фактором).

Синонимы русские

Папиллома-вирусы высокого канцерогенного риска, вирусы папилломы высокого канцерогенного риска, ВПЧ высокого канцерогенного риска.

Синонимы английские

Human Papillomavirus, DNA; HPV, Viral Load.

Метод исследования

Полимеразная цепная реакция в режиме реального времени.

Какой биоматериал можно использовать для исследования?

Соскоб урогенитальный.

Как правильно подготовиться к исследованию?

  • Женщинам исследование рекомендуется производить до менструации или через 2-3 дня после её окончания.
  • Мужчинам не мочиться в течение 3 часов до взятия урогенитального мазка.

Общая информация об исследовании

Вирусы папилломы человека (ВПЧ) представляют собой широко распространённую и вариабельную группу вирусов, поражающих эпителий кожи и слизистых оболочек и обладающих онкогенным потенциалом. ВПЧ передаётся при тесном контакте с инфицированным эпителием, поэтому основные пути заражения – половой и контактно-бытовой. Возможна передача ВПЧ от инфицированной матери к плоду.

К факторам, провоцирующим развитие ВПЧ-инфекции, относятся ранее начало половой жизни, большое количество половых партнеров, сниженный иммунитет, применение оральных контрацептивов, авитаминозы, инфекции, передаваемые половым путём, курение и проживание в крупных городах.

Инкубационный период может длиться от 2 месяцев до 2-10 лет. Характерно скрытое течение заболевания, при котором отсутствуют клинические проявления, а при кольпоскопическом, цитологическом и гистологическом обследовании выявляется норма. В 30 % случаев в течение 6-12 месяцев может произойти избавление от вируса. Диагностика скрытой ВПЧ-инфекции осуществляется только методом ПЦР.

ВПЧ может по-разному воздействовать на эпителий: способствовать возникновению доброкачественных образований (папиллом, кондилом) или объединению ДНК папиллома-вируса с геном клетки, что приводит к дисплазии (неоплазии) и в дальнейшем к раку (чаще всего в переходной зоне шейки матки).

К папиллома-вирусам высокого онкогенного риска относятся ВПЧ типов 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68. 

Для выявления возбудителя используется метод полимеразной цепной реакции, которая позволяет обнаружить ДНК вируса. Принцип метода основан на многократном увеличении числа копий специфичного для данного возбудителя участка ДНК.

Полимеразная цепная реакция (ПЦР) – это метод молекулярной диагностики, позволяющий выявлять генетический материал возбудителя на ранних этапах заболевания. Он характеризуется высокими показателями диагностической чувствительности и специфичности, быстротой получения конечного результата и доступностью. Особенностью метода является возможность выявлять ДНК вируса даже при малом содержании её в исследуемом биологическом материале. Метод основан на многократном увеличении числа копий специфичного для данного возбудителя участка ДНК. Для диагностики может использоваться разнообразный биологический материал, взятый у детей, взрослых лиц, людей с патологией иммунной системы, беременных женщин. Метод позволяет определять количество молекул ДНК исследуемого вируса, что является важным в диагностике острой формы инфекции, реактивации персистентной инфекции, носительстве вируса, а также при контроле эффективности проводимой противовирусной терапии.

По данным исследований, количественное содержание вируса в материале коррелирует со степенью неоплазии: чем выше вирусная нагрузка, тем выраженнее цитологические изменения в эпителии. При обследовании необходимо учитывать генотип вируса, наличие и степень цитологических и гистологических изменений в тканях, увеличение или снижение вирусной нагрузки через несколько месяцев (6 месяцев и более) после предыдущего обследования.

В исследовании проводится определение суммарного количества ДНК 14 типов ВПЧ высокого канцерогенного риска (ВКР) с отдельным определением ДНК ВПЧ 16, 18 и 45 генотипов. ВПЧ ВКР являются главной этиологической причиной развития РШМ и предшествующей ему тяжелой дисплазии. ВПЧ обнаруживается в 95 % случаев РШМ, из них 16, 18, 45 генотипы в совокупности являются причиной 75 % плоскоклеточных раков и 94 % аденокарцином шейки матки.

Известно, что развитие РШМ часто ассоциировано с интеграцией ДНК вируса в геном клетки-хозяина. Наиболее часто интегрируют ВПЧ 16 и 18 генотипов, при этом происходит разрыв участка Е1/Е2 при сохранении онкогена Е6/Е7. В тест-системе, на которой выполняется данное исследование, по разным каналам прибора детектируются разные участки генома ВПЧ 16, 18 и 45 типов. Выявление области Е6 при отсутствии области Е1/Е2 позволяет косвенно судить о возможности интеграции вируса в геном человека. В случае обнаружения возможности интеграции вируса в геном в бланк ответа выводится соответствующая информация.

Для чего используется исследование?

  • Чтобы оценить риск развития новообразований, ассоциированных с ВПЧ (рак шейки матки, рак прямой кишки, рак аногенитальной области и других локализаций).
  • Для контроля за эффективностью лечения предраковых заболеваний, ассоциированных с ВПЧ.
  • Для мониторинга папиллома-вирусной инфекции и прогнозирования ее течения.

Когда назначается исследование?

  • При выявлении цитологических изменений в мазке на атипию, в мазке по Папаниколау, в гистологическом препарате.
  • При кондиломах и других морфологических изменениях половых путей.
  • При скрининге рака шейки матки у женщин старше 25-30 лет (в качестве дополнительного исследования).
  • При наблюдении за инфицированными ВПЧ.
  • При лечении рака и предраковых состояний, ассоциированных с ВПЧ.

Что означают результаты?

Уровень вирусной нагрузки интерпретируется с учетом результатов цитологического исследования мазков, гистологических изменений в биоптате и генотипа вируса, изменении его количества с течением времени.

  • Количество ДНК ВПЧ не определяется при отсутствии вируса в исследуемом образце или его минимальном количестве (ниже детектируемого уровня) – риск развития патологического процесса, связанного с ВПЧ, минимальный.
  • Клинически малозначимая концентрация вируса (менее 103 копий ДНК ВПЧ на 105 клеток) – минимальный риск развития дисплазии, транзиторное течение вирусного процесса.
  • Клинически значимая концентрация вируса (более 103 копий ДНК ВПЧ на 105 клеток) – хроническая инфекция с высоким риском развития дисплазии и РШМ.
  • Более 105 копий ДНК ВПЧ на 105 клеток при установленном факте персистентного течения инфекции (ВПЧ выявляется более 1 года) – усиленная вирусная нагрузка, ассоциированная с повышенным риском тяжелой дисплазии, часто встречается при РШМ.
  • Снижение вирусной нагрузки в 10 раз за 6 месяцев – транзиторная инфекция.
  • Рост вирусной нагрузки через 6 и более месяцев после лечения указывает на возможность рецидива.

ДНК папилломавируса 16/18 типов (Human Papillomavirus 16/18) с определением типа, количественно

Выберите требуемый вид биоматериала

Соскобы из урогенитального тракта не берутся в течение суток после местной терапии (свечи, мази, спринцевания), после полового контакта и во время менструации у женщин. После кольпоскопии, интравагинального УЗИ должно пройти 48 часов. В случае наличия признаков острого воспаления необходимость взятия мазка определяется лечащим врачом. Если необходимо получить соскоб из уретры, то перед взятием материала нужно не мочиться 1,5 — 2 часа. Если исследование назначается для контроля излеченности, то взятие материала на исследование методом ПЦР возможно не ранее, чем через 28 дней после окончания приема антибиотиков, на микробиологические исследования не ранее,чем через 14 дней.

Накануне исследования не применять местные лекарственные препараты и процедуры, исключить половой акт. При взятии соскоба из уретры не мочиться в течение 1,5-2 часов до процедуры. Если исследование назначается для контроля излеченности, то взятие материала на исследование методом ПЦР возможно не ранее, чем через 28 дней после окончания приема антибиотиков, на микробиологические исследования не ранее,чем через 14 дней.

Соскобы из урогенитального тракта не берутся в течение суток после местной терапии (свечи, мази, спринцевания), после полового контакта и во время менструации у женщин. После кольпоскопии, интравагинального УЗИ должно пройти 48 часов. В случае наличия признаков острого воспаления необходимость взятия мазка определяется лечащим врачом. Если необходимо получить соскоб из уретры, то перед взятием материала нужно не мочиться 1,5 — 2 часа. Если исследование назначается для контроля излеченности, то взятие материала на исследование методом ПЦР возможно не ранее, чем через 28 дней после окончания приема антибиотиков, на микробиологические исследования не ранее,чем через 14 дней.

Определение ДНК вируса папилломы человека 16,18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59

Синонимы: ДНК ВПЧ ВКР (высокого канцерогенного риска).

Связанные тесты: клинико-визуальный осмотр, кольпоскопия, гистология, цитологическое исследование мазков (мазки по Папаниколау, ПАП-тест)/жидкостная цитология.

 Исследование по определению ДНК ВПЧ ВКР является основным методом диагностики по выявлению вируса папилломы человека в соскобе эпителиальных клеток урогенитального тракта. Молекулярно – биологические методы (ПЦР) позволяют идентифицировать определенные типы ВПЧ и имеют высокую прогностическую значимость, особенно, если на фоне ВПЧ-инфекции уже имеется картина дисплазии эпителия шейки матки, что позволяет говорить о степени риска развития рака.

ВПЧ – инфекция наиболее часто встречающееся заболевание, передающееся половым путем.

Вирус поражает клетки эпителия кожи и слизистых оболочек. Основным путем заражения ВПЧ является половой путь передачи инфекции (с учетом анального секса и орально-генитальных контактов). Следует отметить, что у 70 % молодых людей в возрасте от 15 до 25 лет ВПЧ элиминируется в течение 18-24 месяцев, после 35 лет ВПЧ сохраняется более продолжительное время. Скорость исчезновения ВПЧ зависит от иммунореактивности клеток организма человека и значительно снижается при инфицировании несколькими типами ВПЧ.  Среди лиц, живущих активной половой жизнью, особенно в возрасте до 30 лет, ВПЧ-инфекция с одинаковой частотой поражает и мужчин и женщин. В то же время наиболее серьезные поражения она вызывает у женщин. ВПЧ считается инициирующим фактором в развитии рака шейки матки и рассматривается в качестве причины дистрофических и злокачественных заболеваний вульвы и влагалища.

Выявление и определение типа ВПЧ дает возможность оценивать риск развития неоплазии и дифференцировать персистенцию вируса от случая нового заражения. Риск развития опухолевого процесса в большой степени связан с типом ВПЧ; выявление ДНК ВПЧ высокого онкогенного риска — 16, 18, 31, 33, 35, 39, 45, 51, 52, 56 и 58 дают основание предполагать, что клетки эпителия могут подвергнуться злокачественному перерождению. Рак шейки матки (РШМ) имеет длительный период развития. Своевременная диагностика предраковых состояний шейки матки имеет важное значение в предотвращении злокачественных новообразований.

В каких случаях рекомендуется проводить исследование?
  • наличие субъективных и/или объективных симптомов заболевания;
  • скрининговые исследования на ИППП;
  • беременность;
  • скрининговое обследование в комплексе с цитологическим исследованием;
  • неопределенные и сомнительные результаты цитологических исследований;
  • дифференциальная диагностика с заболеваниями непапилломавирусной этиологии.

Используемый метод исследования

Полимеразная цепная реакция (ПЦР) в режиме реального времени.

Материал для исследования

Соскоб эпителиальных клеток из цервикального канала, влагалища, уретры.

Подготовка к исследованию

В предполагаемый день обследования проводиться туалет половых органов без применения моющих, дезинфицирующих средств, антибактериального мыла; исключается спринцевание влагалища у женщин; от последнего мочеиспускания до взятия материала должно пройти не менее 2 часов.

Просим обратить Ваше внимание!

Исследование проводится не ранее, чем:

  • через 2 дня после УЗИ-исследования с помощью влагалищного датчика, гинекологического осмотра;
  • через 5 дней после кольпоскопии и биопсии/жидкостной цитологии;
  • через 2 недели после применения всех видов местных лекарственных форм (свечи, мази и т.п.), антисептических средств и лекарственных препаратов (пробиотики, эубиотики), содержащих микроорганизмы;
  • через 3 недели после незащищенного полового контакта с партнером, в котором Вы не уверенны;
  • через 4 недели после применения системных антибактериальных препаратов и для контроля терапии.

В течение 2 – 3 дней до исследования необходимо воздержаться от незащищенных половых контактов.

За дополнительной информацией о возможности проведения исследования в конкретном случае рекомендуется обратиться по телефонам нашего центра.

Взятие клинического материала у беременных женщин проводится только врачом; необходимо  предварительно записаться на прием.

Формат выдачи результата:

Обнаружено / не обнаружено, тип ВПЧ.

Определение ДНК ВПЧ ВКР может говорить о высоком уровне онкогенного риска и необходимости наблюдения в лечебно-профилактических учреждениях.

Церварикс вакцина для профилактики заболеваний, вызываемых вирусом папилломы человека типов 16 и 18 инструкция по применению, цена в аптеках Украины, аналоги, состав, показания | Cervarix vaccine for the prevention of diseases caused by human papillomavirus types 16 and 18 суспензия для инъекций компании «GlaxoSmithKline Biologicals S.A.»

механизм действия. Как было доказано, персистенция онкогенных типов вируса папилломы человека (ВПЧ) является причиной практически всех случаев рака шейки матки во всех регионах мира.

Церварикс — рекомбинантная вакцина, изготовленная из высокоочищенных неинфекционных вирусоподобных частиц основного белка L1 оболочки ВПЧ 16-го и 18-го типов (ВПЧ-16 и -18). Вирусоподобные частицы не содержат вирусной ДНК, поэтому они не могут инфицировать клетки или быть причиной рака данной локализации. В исследованиях на животных показано, что вирусоподобные частицы основного белка L1 вакцины ответственны за развитие гуморального иммунного ответа и формирование клеточной иммунной памяти.

Церварикс содержит адъювант AS04, который в клинических исследованиях продемонстрировал способность вызывать более сильный и продолжительный иммунный ответ по сравнению с вакциной, содержащей те же антигены с гидроксидом алюминия (Al(OH)3) в качестве адъюванта.

Инвазивный рак шейки матки включает плоскоклеточную цервикальную карциному (84%) и аденокарциному (16%, в развитых странах — до 20% по данным программ массовых обследований).

ВПЧ-16 и -18 ответственны за развитие около 70% случаев рака шейки матки, 90% рака ануса и 70% случаев интраэпителиальной неоплазии вульвы (VIN 2/3) и интраэпителиальной неоплазии влагалища (VaIN 2/3) высокой степени, связанной с ВПЧ, во всех регионах мира. Другие онкогенные типы ВПЧ (ВПЧ-31, -33, -35, -39, -45, -51, -52, -56, -58, -59, -66, -68) также могут вызывать рак шейки матки. ВПЧ-16 -18, -45 и -31 — это четыре наиболее распространенных типа, выявленные в плоскоклеточной цервикальной карциноме (около 76% случаев) и аденокарциноме (около 91% случаев).

Данные клинических исследований

Доказательства анамнестического ответа (иммунной памяти). Назначение бустерной дозы в среднем через 6,8 года после первой вакцинации вызвало анамнестический иммунный ответ на ВПЧ-16/-18 (при определении методом ELISA и методом нейтрализации псевдовириона) на 7-й день. Через 1 мес после введения ударной дозы, средний геометрический титр (GMT) превышал таковой, который наблюдали через 1 мес после проведения первичного курса вакцинации. Анамнестический иммунный ответ также регистрировали в отношении родственных типов ВПЧ-31 и -45.

Профилактическая эффективность

Клиническая эффективность у женщин в возрасте от 15 до 25 лет. Эффективность вакцины Церварикс оценена в двух контролируемых двойных слепых рандомизированных клинических исследованиях (HPV-001/007 и HPV-008) с участием всего 19 778 лиц женского пола в возрасте 15–25 лет.

Клинические исследования HPV-001/007 проводились в Северной и Латинской Америке. В исследованиях HPV-023 наблюдали пациенток из бразильской когорты 001/007. Критерии включения в исследование: отсутствие ДНК онкогенных типов ВПЧ (ВПЧ-16, -18, -31, -33, -35, -39, -45, -51, -52, -56, -58, -59, — 66 и -68) в исследуемых образцах шейки матки, сероотрицательный статус в отношении антител к вирусам ВПЧ-16 и -18 и цитологические показатели в норме. Указанные характеристики наблюдали у представителей популяции, не инфицированных онкогенными типами ВПЧ до вакцинации.

Клинические исследования HPV-008 проводили в Северной Америке, Латинской Америке, Европе, Азиатско-Тихоокеанском регионе и Австралии. Полученные до вакцинации образцы тестировали на наличие ДНК онкогенных ВПЧ (ВПЧ-16, -18, -31, -33, -35, -39, -45, -51, -52, -56, -58, -59, -66 и -68), также выполняли серологический тест на наличие антител к вирусам ВПЧ-16 и -18. Женщин вакцинировали независимо от основных цитологических показателей, ВПЧ- и ДНК-статуса. Такие характеристики отмечали у представителей популяции, включавшей женщин с подтвержденным инфицированием ВПЧ в прошлом и/или в настоящее время.

Как и в любых исследованиях профилактической эффективности, лица, первично инфицированные ВПЧ определенного типа, не привлекались к оценке эффективности этого типа.

Цервикальную интраэпителиальную неоплазию 2-й (CIN) и 3-й (CIN2+) степени использовали в исследованиях в качестве суррогатного маркера цервикального рака. Персистирующую инфекцию продолжительностью более 6 мес также считали суррогатным маркером цервикального рака. Хотя цервикальная интраэпителиальная неоплазия 1-й (CIN) степени не является суррогатным маркером цервикального рака, это заболевание требует медицинского наблюдения.

Эффективность вакцины против ВПЧ-16/-18 у женщин, не инфицированных онкогенными типами ВПЧ (исследование HPV-001/007/023). Результаты эффективности для гистологических конечных точек, связанных с ВПЧ-16/-18, которые отмечали в исследовании HPV-001/007 (в общей когорте, то есть у женщин, получивших хотя бы одну дозу вакцины), представлены в табл. 1.

Таблица 1. Эффективность вакцины в предотвращении случаев CIN2+ и CIN1+, ассоциированных с ВПЧ-16/-18
Конечная точка ВПЧ-16/-18 Церварикс (n=481) Контроль (соль алюминия) (n=470) Эффективность, % (ДИ 95%)
Количество случаев, n
CIN2+1 0 9 100 (51,3–100)
CIN1+2 0 15 100 (73,4–100)

1Цервикальная интраэпителиальная неоплазия ≥2-го уровня.

2Цервикальная интраэпителиальная неоплазия ≥1-го уровня.

Эффективность против цитологических аномалий, вызванных ВПЧ-16/-18, составляла 96,7% (95% доверительный интервал (ДИ) 87,3–99,6). Эффективность против персистирующей инфекции ВПЧ-16/-18 составляла 98,2% (95% ДИ 89,5–100) и 96,9% (95% ДИ 81,4–99,9) для 6- и 12-месячного определения соответственно.

В исследовании HPV-023 наблюдали лиц (N=437) в течение 9,4 года (примерно 113 мес) введения после первой дозы. В вакцинированной группе новых случаев инфекции или гистопатологических заболеваний, ассоциированных с ВПЧ-16/-18, не было. В группе плацебо отмечено 4 случая 6-месячной персистирующей инфекции, 1 случай 12-месячной персистирующей инфекции и 1 случай CIN1+, связанные с ВПЧ-16/-18.

В дескриптивном факторном анализе исследований HPV-001/007/023 эффективность против инфицирования ВПЧ-16/-18 и 6-месячной персистирующей инфекции составляла 91,0% (95% ДИ 80,3–96,5) и 96,8% (95% ДИ 80,4–99,9) соответственно. Несмотря на наличие признаков продолжающегося воздействия ВПЧ-инфекции у женщин, наблюдавшееся в контрольной группе, доказательств снижения защиты у вакцинированных женщин не было.

Эффективность вакцины у женщин с доказанным наличием инфекции ВПЧ в прошлом и/или в настоящее время (исследование HPV-008).

Профилактическая эффективность против ВПЧ-16/-18 у женщин, не инфицированных ВПЧ-16/-18. В исследовании HPV-008 проведен первичный анализ эффективности когорты, согласно протоколу (КСП) (КСП включает женщин, получивших три дозы вакцины и не инфицированных соответствующим типом ВПЧ на 0-й и 6-й месяц) и общей когорты вакцинированных (ОКВ)-1 (ОКВ-1 включает женщин, получивших хотя бы одну дозу вакцины и не инфицированных соответствующим типом ВПЧ на 0-й месяц). Обе когорты включали женщин с показателями в норме или цитологическими показателями низкого исходного уровня, исключались только женщины с цитологическими показателями (0,5%) высокого уровня.

В исследовании HPV-008 ≈26% женщин имели доказанную инфекцию ВПЧ-16/-18 в прошлом и/или в настоящее время, а <1% женщин были ДНК ВПЧ-положительными на исходном уровне относительно типов ВПЧ-16/-18.

Окончательный анализ испытания HPV-008 был инициирован событием, то есть выполнялся, когда в когорте КСП накапливалось не менее 36 случаев CIN2+, ассоциированных с ВПЧ-16/18. Период последующего наблюдения продолжался в среднем 39 мес после введения после первой дозы.

Анализ исследования проводили в конце 4-летнего периода наблюдения (то есть через 48 мес после введения первой дозы) и включал всех лиц из ОКВ-1.

В определенном протоколом анализе эффективность вакцины против CIN1+ и CIN2+, ассоциированных с ВПЧ-16/-18, была статистически значимой в когортах КСП и ОКВ-1.

Дальнейшее исследование установило, что несколько случаев CIN3+, CIN1+ и CIN2+ были вызваны различными онкогенными типами ВПЧ. Чтобы отличить тип (или типы) ВПЧ, которые скорее всего отвечают за заболевание, от временно ассоциированного типа (или типов) ВПЧ использовали выделение типа ВПЧ (исследовательский анализ). Выделение типа ВПЧ — это определение типов ВПЧ с помощью полимеразной цепной реакции (ПЦР) хотя бы в одном из двух предоставленных цитологических образцов, кроме типов, выявленных при заболевании. При определении типа ВПЧ, анализ исключает случаи (в группе вакцинированных лиц и контрольной группе), которые не считают причинно связанными с инфекциями ВПЧ-16 или -18, приобретенными в ходе исследования.

Результаты, отмеченные в обоих анализах (то есть в определенном протоколом анализе и выявлении типов ВПЧ), приведены в табл. 2.

Таблица 2. Эффективность вакцины против CIN1+, CIN2+, CIN3+, ассоциированных с ВПЧ-16/-18
Конечная точка ВПЧ-16/-18 Окончательный анализ

исследования

Анализ на конечной стадии

исследования

Церварикс Контрольная группа Эффективность, % (96,1% ДИ) Церварикс Контрольная группа Эффективность, % (95% ДИ)
N n N n N n N n
Анализ согласно протоколу (КСП и ОКВ-1)
CIN3+ КСП1 7344 2 7312 10 80

(0,3–98,1)

7338 2 7305 24 91,7

(66,6–99,1)

ОКВ-12 8040 2 8080 22 90,9

(60,8–99,1)

8068 2 8103 40 95,0

(80,7–99,4)

CIN2+ КСП1 7344 4 7312 56 92,9

(79,9–98,3)

7338 5 7305 97 94,9

(87,7–98,4)

ОКВ-12 8040 5 8080 91 94,5

(86,2–98,4)

8068 6 8103 135 95,6

(90,1–98,4)

CIN1+ КСП1 7344 8 7312 96 91,7

(82,4–96,7)

7338 12 7305 165 92,8

(87,1–96,4)

ОКВ-12 8040 11 8080 135 91,8

(84,5–96,2)

8068 15 8103 210 92,9

(88,0–96,1)

Определение типа ВПЧ (анализ исследования) (КСП и ОКВ-1)
CIN3+ КСП1 7344 0 7312 8 100

(36,4–100)

7338 0 7305 22 100

(81,8–100)

ОКВ-12 8040 0 8080 20 100

(78,1–100)

8068 0 8103 38 100

(89,8–100)

CIN2+ КСП1 7344 1 7312 53 98,1

(88,4–100)

7338 1 7305 92 98,9

(93,8–100)

ОКВ-12 8040 2 8080 87 97,7

(91,0–99,8)

8068 2 8103 128 98,4

(94,3–99,8)

CIN1+ КСП1 7344 2 7312 90 97,8

(91,4–99,8)

7338 3 7305 154 98,1

(94,3–99,6)

ОКВ-12 8040 5 8080 128 96,1

(90,3–98,8)

8068 6 8103 196 97,0

(93,3–98,9)

N — количество женщин в каждой группе; n — количество случаев.

1Три дозы вакцины, ДНК-отрицательные и -сероотрицательные на 0-й месяц и ДНК-отрицательные на 6-й месяц относительно соответствующего типа ВПЧ (ВПЧ-16/-18).

2Как минимум одна доза вакцины, ДНК-отрицательные и -сероотрицательные на 0-й месяц соответствующего типа ВПЧ (ВПЧ-16/-18).

Кроме того, во время окончательного анализа исследования в отдельных случаях показана статистически значимая эффективность вакцины против CIN2+, ассоциированной с ВПЧ-16 и -18, в обеих когортах и в каждом анализе.

Также оценивалась эффективность вакцины против персистенции инфекции на протяжении 6-го и 12-го месяца и цитопатологии (наличие атипичных плоских клеток невыясненного значения (клеток ASCUS)), ассоциированных с ВПЧ-16/-18. Эффективность вакцины против каждой конечной точки была статистически значимой в обеих когортах.

Окончательный анализ исследования:

  • 6-месячная персистенция инфекции: 94,3% (91,5; 96,3) в когорте КСП и 90,2% (87,3; 92,6) — в когорте ОКВ-1;
  • 12-месячная персистенция инфекции: 91,4% (86,1; 95,0) в когорте КСП и 85,3% (79,9; 89,4) — в когорте ОКВ-1;
  • цитологические отклонения (наличие клеток ASCUS) составляли 89,0% (84,9; 92,1) в когорте КСП и 86,7% (82,8; 89,8) — в когорте ОКВ-1.

Анализ на конечной стадии исследования:

  • 6-месячная персистенция инфекции: 94,3% (92,0; 96,1) в когорте КСП и 91,0% (88,5; 93,0) — в когорте ОКВ-1;
  • 12-месячная персистенция инфекции: 92,9% (89,4; 95,4) в когорте КСП и 88,2% (84,5%; 91,2%) — в когорте ОКВ-1;
  • цитологические отклонения (наличие клеток ASCUS): 90,7% (87,8; 93,1) в когорте КСП и 88,6% (85,6; 91,0) — в когорте ОКВ-1.

Во время окончательного анализа в обеих когортах отмечали статистически значимую эффективность вакцины против VIN1+ (вульварной интраэпителиальной неоплазии 1-й степени и более высоких степеней заболевания) или VaIN1+ (вагинальной интраэпителиальной неоплазии 1-й степени и более высоких степеней заболевания), ассоциированных с ВПЧ-16/-18: 80,0% (96,1% ДИ 0,3–98,1) в когорте КСП и 83,2% (96,1% ДИ 20,2–98,4) — в когорте ОКВ-1. В анализе конечного этапа исследования эффективность вакцины против VIN1+ или VaIN1+, ассоциированных с ВПЧ-16/-18, составляла 75,1% (95% ДИ 22,9–94,0) в когорте КСП и 77,7% (95% ДИ 32,4–94,5) — в когорте ОКВ-1.

Выявлено два случая VIN2+ или VaIN2+, ассоциированные с ВПЧ-16 или -18, в группе вакцинации и 7 случаев — в контрольной группе в когорте КСП. Целью исследования не являлась демонстрация разницы между вакциной и контрольной группой для данных конечных точек.

Отсутствуют доказательства защиты от заболеваний, вызванных типами ВПЧ, по которым лица уже были ДНК-положительными на момент включения в исследование. Однако лица, которые до проведения вакцинации уже были инфицированы одним из типов ВПЧ, содержащихся в вакцине, были защищены от клинических заболеваний, обусловленных другим вакцинным типом ВПЧ.

Общее влияние вакцинации на тяжесть заболеваний, вызванных ВПЧ. Общая эффективность вакцины, независимо от типа ДНК ВПЧ, при наличии заболевания и стратифицированная по статусу ДНК ВПЧ и серостатусу на исходном уровне, оценивалась в исследовании HPV-008.

В когортах ОКВ и ОКВ-Н, включавших всех вакцинированных женщин, продемонстрирована эффективность вакцины против CIN3+, CIN2+ и CIN1+ (табл. 3). В этих когортах также выявлено влияние вакцины Церварикс на уменьшение количества случаев локальной терапии на шейке матки (процедура петлевой электроэксцизии, конизация, ножевая или лазерная) (см. табл. 3).

Когорта ОКВ-Н — это подгруппа когорты ОКВ, включающая женщин с нормальными показателями цитологии, которые на исходном уровне были ДНК ВПЧ-отрицательными по 14 онкогенным типам ВПЧ (ВПЧ-16, -18, -31, -33, -35, -39, -45, -51,-52, -56, -58, -59, -66, -68) и сероотрицательными по ВПЧ-16 и -18.

Таблица 3. Эффективность вакцины независимо от ДНК типа ВПЧ-заболевания, независимо от первичного серостатуса
Конечная точка ВПЧ-16/-18 Окончательный анализ

исследования

Анализ на конечной стадии

исследования

Церварикс Контрольная группа Эффективность, % (96,1% ДИ) Церварикс Контрольная группа Эффективность, % (95% ДИ)
N n N n N n N n
CIN3+ ОКВ-Н1 5449 3 5436 2 87,0

(54,9–97,7)

5466 3 5452 44 93,2

(78,9–98,7)

ОКВ2 8667 77 8682 116 33,4

(9,1–51,5)

8694 86 8708 158 45,6

(28,8–58,7)

CIN2+ ОКВ-Н1 5449 33 5436 110 70,2

(54,7–80,9)

5466 61 5452 172 64,9

(52,7–74,2)

ОКВ2 8667 224 8682 322 30,4

(16,4–42,1)

8694 287 8708 428 33,1

(22,2–42,6)

CIN1+ ОКВ-Н1 5449 106 5436 211 50,1

(35,9–61,4)

5466 174 5452 346 50,3

(40,2–58,8)

ОКВ2 8667 451 S682 577 21,7

(10,7–31,4)

8694 579 8708 798 27,7

(19,5–35,2)

Локальная цервикальная терапия ОКВ-Н1 5449 26 5436 83 68,8

(50,0–81,2)

5466 43 5452 143 70,2

(57,8–79,3)

ОКВ2 S667 180 8682 240 24,7

(7,4–38,9)

8694 230 8708 344 33,2

(20,8–43,7)

N — количество женщин в каждой группе; n — количество случаев; ОКВ-Н1 — включает всех вакцинированных лиц (получивших хотя бы одну дозу вакцины) с нормальными цитологическими показателями, которые были ДНК ВПЧ-отрицательными к 14 онкогенным типам ВПЧ и сероотрицательными к ВПЧ-16/-18 на исходном уровне; ОКВ2 включает всех вакцинированных лиц (получивших хотя бы одну дозу вакцины).

Профилактическая эффективность против инфицирования типами ВПЧ, отличными от ВПЧ-16/-18. В исследовании HPV-008 эффективность вакцины против 12 онкогенных типов ВПЧ, не содержащихся в вакцине (ВПЧ-31, -33, -35, -39, -45, -51, -52, -56, -58, -59, -66, -68), оценивалась в когортах КСП и ОКВ-1.

В окончательном анализе исследования продемонстрирована статистически значимая эффективность вакцины против CIN2+ для всех типов ВПЧ вместе (ВПЧ-31, -33, -35, -39, -45, -51, -52, -56, -58, -59, -66, -68), за исключением типов ВПЧ-16/-18, которая составляла 54,0% (96,1% ДИ 34,0–68,4) в когорте КСП и 46,0% (96,1% ДИ 27,0–60,3) — в когорте ОКВ-1. В анализе конечной стадии исследования эффективность вакцины против CIN2+ для всех типов ВПЧ вместе, за исключением типов ВПЧ-16/-18, составляла 46,8% (95% ДИ 30,7–59,4) в когорте КСП и 40,8% (95% ДИ 25,5–53,1) — в когорте ОКВ-1.

В окончательном анализе исследования наблюдали статистически значимую эффективность вакцины против 6-месячной персистенции инфекции и против CIN2+ относительно таких типов ВПЧ:

  • 6-месячная персистирующая инфекция: типы 31, 33, 45 в когорте КСП; типы 31, 33, 45, 51 в когорте ОКВ-1;
  • CIN2+: типы 31, 51, 58 в когорте КСП; типы 31, 33, 35, 51 в когорте ОКВ-1.

В анализе конечной стадии исследования наблюдалось большее число случаев и нижний предел 95% ДИ >0 для типов 31, 33, 45 и 51 в отношении 6-месячной персистенции инфекции и CIN2+ в когортах КСП и ОКВ-1. Для CIN2+ нижний предел 95% ДИ >0 также наблюдалась для типа ВПЧ-39 в когорте КСП и типа ВПЧ-66 в когорте ОКВ-1.

Клиническая эффективность у женщин в возрасте ≥26 лет. Эффективность Церварикс оценивали в рандомизированном двойном слепом клиническом исследовании III фазы (NPV-015) с привлечением 5777 женщин в возрасте ≥26 лет. Это исследование проводилось в Северной Америке, Латинской Америке, Азиатско-Тихоокеанском регионе и Европе и позволило включить женщин с наличием в анамнезе инфекционных заболеваний, вызванных ВПЧ. Промежуточный анализ проведен по завершению всеми пациентками визита на 48-м месяце исследования.

Первичные анализы эффективности проводились в когорте КСП для определения эффективности и ОКВ.

Эффективность вакцины против первичной комбинированной конечной точки (6-месячной персистирующей инфекции и/или CIN1+), связанной с ВПЧ-16/-18, приведена в табл. 4.

Таблица 4. Эффективность вакцины против 6-месячной персистирующей инфекции и/или CIN1+, связанной с ВПЧ-16/-18, в когортах КСП и ОКВ
Конечная точка ВПЧ-16/-18 КСП1 ОКВ2
Церварикс Контроль Эффективность, % (97,7% ДИ) Церварикс Контроль Эффективность, % (97,7% ДИ)
N=1898 N=1854 N=2772 N=2779  
n n n n  
6М ПИ и/или CIN1+ 7 36 81,1 (52,1–94,0) 90 158 43,9 (23,9–59,0)
6М ПИ и/или CIN1+(HPV TAA) 7 36 81,1 (52,1–94,0) 89 155 43,5 (23,1–58,7)

N — количество человек в каждой группе.

n — количество лиц, у которых отмечался минимум один случай, в каждой группе.

HPV TAA — алгоритм распределения типа ВПЧ.

6М ПИ — 6-месячная персистирующая инфекция.

CIN1+ — CIN1, CIN2, CIN3, аденокарцинома in situ (AIS) или инвазивный рак шейки матки (IСС).

1Три дозы вакцины, ДНК-отрицательные и серологически на 0-м месяце и ДНК-отрицательные на 6-й месяц относительно соответствующего типа ВПЧ (ВПЧ-16/-18).

2Хотя бы одна доза вакцины, несмотря на ВПЧ, ДНК и серологический статус на 0-й месяц. Включает 15% пациентов с заболеваниями/инфекциями, вызванными ВПЧ, в анамнезе.

Эффективность вакцины против 6-месячной персистентной инфекции составила 79,1% (97,7% ДИ [27,6–95,9]) для ВПЧ-31 и 76,9% (97,7% ДИ [18,5–95,6]) — для ВПЧ-45 в группе ОКВ.

Иммуногенность, индуцированная вакциной. Гуморальный иммунный ответ на ВПЧ-16 и -18 измеряли с помощью типоспецифического иммуносорбентного ферментного анализа ELISA, данные которого коррелировали с тестами нейтрализации (включая тест на основе нейтрализации псевдовириона, разработанный Национальным институтом рака США). В клинических исследованиях продемонстрирована транссудация антител из плазмы крови в слизистую оболочку шейки матки.

Иммуногенность, индуцированную тремя дозами вакцины Церварикс, оценивали у 5 тыс. лиц женского пола в возрасте 9–55 лет.

По данным клинических исследований, у 99,9% первично сероотрицательных женщин произошла сероконверсия к типам ВПЧ-16/-18 через 1 мес после введения третьей дозы вакцины. GMT поствакцинального иммуноглобулина был намного выше титра, наблюдавшегося у ранее инфицированных женщин, но освободившихся от ВПЧ-инфекции (естественная инфекция). Женщины (как сероположительные, так и сероотрицательные) на момент введения первой дозы, развивали сходный иммунный ответ на вакцинацию.

Иммуногенность у лиц женского пола в возрасте 15–25 лет. В клиническом исследовании HPV-001/-007 иммунный ответ против ВПЧ-16/-18 изучали на протяжении 76 мес после первой дозы вакцины у лиц женского пола, которым на момент вакцинирования исполнилось 15–25 лет. В исследовании HPV-023 изучение иммунного ответа в подгруппе популяции из исследования HPV-001/007 продолжалось до 9,4 года после первой дозы.

В исследовании HPV-023 100% женщин были сероположительными по отношению к типам ВПЧ-16/-18, по данным анализа ELISA или теста на основе нейтрализации псевдовириона (PBNA), до 9,4 года после первой вакцинации.

GMT поствакцинального иммуноглобулина против ВПЧ-16 и -18 был наиболее высоким на 7-й месяц и снизился до уровня плато с 18-го месяца и, с несущественными отклонениями, сохранялся к концу периода наблюдения (113 мес). На 113-м месяце GMT как для ВПЧ-16, так и для ВПЧ-18 были все еще в 10 раз выше титров, наблюдавшихся у ранее инфицированных женщин, но освободившихся от ВПЧ (естественная инфекция), а 100% женщин были сероположительными к обоим антигенам.

В исследовании HPV-008 иммуногенность 48-го месяца была аналогична иммунному ответу, наблюдавшемуся в исследовании HPV-001/007. Аналогичный профиль кинетики отмечали у нейтрализующих антител.

Сравнение данных эффективности вакцины Церварикс, продемонстрированной у лиц женского пола в возрасте 15–25 лет, с другими возрастными группами. По данным совокупного анализа (HPV-029, — 030 и -048), у 99,7 и 100% девочек в возрасте 9 лет после третьей дозы (на 7-й месяц) состоялась сероконверсия к типам ВПЧ-16 и -18 соответственно, а GMT были в 1,4 и 2,4 раза выше по сравнению с таковыми в возрастных группах женского пола в возрасте 10–14 и 15–25 лет соответственно.

В двух клинических исследованиях (HPV-012, HPV-013), проведенных при участии девочек и подростков в возрасте (10–14 лет), у всех лиц после третьей дозы (на 7-й месяц) состоялась сероконверсия к типам ВПЧ-16 и -18, а GMT были по меньшей мере в 2 раза выше по сравнению с лицами женского пола в возрасте 15–25 лет.

В клиническом исследовании (HPV-070), проведенном с участием девочек в возрасте 9–14 лет, которые придерживались графика 2-й дозы (0-й; 6-й месяц), все лица были сероположительными к типам ВПЧ-16 и -18 после второй дозы (на 7-й месяц). Иммунный ответ после двух доз у девочек в возрасте от 9 до 14 лет оказался не меньшим, чем иммунный ответ после трех доз у лиц женского пола в возрасте от 15 до 25 лет.

На основании данных иммуногенности сделан вывод об эффективности вакцины Церварикс у девушек в возрасте от 9 до 14 лет.

Иммуногенность у женщин в возрасте ≥26 лет. В исследовании фазы III (HPV-015) с привлечением женщин в возрасте ≥26 лет за период наблюдения 48 мес, а именно через 42 мес после завершения полного курса вакцинации, 100 и 99,4% первично сероотрицательных женщин оставались сероположительными к антителам анти-ВПЧ-16 и анти-ВПЧ-18 соответственно. Титры антител достигли пика на 7-м месяце, затем постепенно снижались до 18-го месяца и стабилизировались до 48-го месяца.

В другом клиническом исследовании (HPV-014), проведенном среди женщин в возрасте от 26 до 55 лет (N=362), все пациентки были сероположительными к типам ВПЧ-16/-18 после третьей дозы (на 7-й месяц). Титры антител были ниже у этой группы пациенток по сравнению с женщинами в возрасте 15–25 лет. Однако все пациентки оставались сероположительными к ВПЧ-16, причем все пациентки, за исключением одной, остались сероположительными к ВПЧ-18 в течение фазы последующего наблюдения (до 48-го месяца). При этом уровень антител был выше уровня антител, наблюдавшегося в случае естественной инфекции.

Сравнение иммуногенности Церварикса и вакцины для профилактики заболеваний, вызываемых ВПЧ-6, -11, -16, -18 типа, у женщин в возрасте 18–45 лет. Сравнительное исследование не меньшей эффективности с применением коммерческой вакцины для профилактики заболеваний, вызываемых ВПЧ-6, -11, -16, -18 типа (исследование HPV-010), у женщин в возрасте 18–45 лет, продемонстрировало не меньшую эффективность иммунного ответа, вызываемого вакциной Церварикс для нейтрализующих антител к ВПЧ-16/-18 типа, во всех возрастных группах в течение максимум трех лет после первой вакцинации (табл. 5).

Таблица 5. Оценка не меньшей эффективности* относительно титров нейтрализирующих антител вакцины Церварикс и вакцины для профилактики заболеваний, вызываемых ВПЧ-6, -11, -16, -18 типа, к ВПЧ-16/-18 на 7-й и на 36-й месяц (КСП) в исследовании HPV-010
Период Возраст (лет) Церварикс Вакцина для профилактики заболеваний, вызываемых ВПЧ-6, -11, -16, -18 типа Коэффициент GMT антител вакцины Церварикс/вакцины для профилактики заболеваний, вызываемых ВПЧ-6, -11, -16, -18 типа (97,6% ДИ на 7-й месяц; 95% ДИ на 36-й месяц)
N GMT (ED50) N GMT (ED50)  
7-й месяц ВПЧ-16 18–26 104 36 791,8 103 10 053,1 3,66 (2,56–5,23)
27–35 90 23 907,9 85 4958,4 4,82 (3,28–7,09)
36–45 96 17 301,5 83 7634,4 2,27 (1,52–3,39)
ВПЧ-18 18–26 118 16 486,9 131 2257,9 7,30 (5,14–10,37)
27–35 102 9501,6 101 1043,0 9,11 (6,01–13,82)
36–45 110 9845,5 91 1438,8 6,84 (4,59–10,19)
36-й месяц ВПЧ-16 18–26 60 3844,7 62 653,2 5,89 (3,69–9,39)
27–35 63 1897,6 49 501,7 3,78 (2,39–5,98)
36–45 61 1794,2 57 823,7 2,18 (1,32–3,58)
ВПЧ-18 18–26 64 1593,7 76 127,8 12,47 (7,99–19,45)
27–35 75 942,8 61 101,9 9,25 (5,85–14,64)
36–45 71 903,5 61 103,2 8,76 (5,34–14,35)

ED50 = ожидаемая доза = разведение сыворотки, обеспечивающее уменьшение сигнала на 50% по сравнению с контролем без сыворотки.

GMT = среднее геометрическое титра антител.

N = количество пациентов с поствакцинальными результатами.

Не меньшая эффективность продемонстрирована, когда нижняя граница 97,6% ДИ или 95% ДИ была >0,5.

*Больший иммунный ответ, вызванный вакциной Церварикс, также продемонстрирован за период до 36-го месяца для нейтрализующих антител ВПЧ-16/-18 во всех возрастных группах. Клиническая значимость этого наблюдения неизвестна.

Иммуногенность у ВИЧ-инфицированных женщин

В клиническом исследовании, проведенном при участии 120 ВИЧ-положительных пациенток без клинического проявления заболевания, в возрасте 18–25 лет (60 участниц получили вакцину Церварикс), все женщины, вакцинированные препаратом Церварикс, были сероположительными по отношению к ВПЧ-16 и -18 после третьей дозы (к 7-му месяцу), и сероположительность для 16-го и 18-го типа сохранялась до 12 мес. GMT антител было ниже в этой популяции по сравнению с популяцией ВИЧ-отрицательных пациенток, но в 15 раз превышало уровни антител, регистрируемые при естественной ВПЧ-инфекции. При этом ВИЧ-положительные лица в возрасте 18–25 лет хорошо переносили вакцинацию препаратом Церварикс в течение максимум 6 мес после введения последней дозы вакцины и в течение периода наблюдения, составлявшего 12 мес; вакцина также не влияла на уровень CD4+-лимфоцитов, показатели вирусной нагрузки и клиническую стадию ВИЧ-инфекции.

в соответствии с требованиями медицинской практики, перед вакцинацией рекомендуется собрать анамнез пациента (обращая особое внимание на последствия предыдущей вакцинации и возможное возникновение побочных реакций) и провести медицинский осмотр.

Как и при применении других инъекционных вакцин, места проведения прививок должны быть обеспечены наличием медицинских средств и лекарственных препаратов для оказания медицинской помощи в случае возникновения редких проявлений анафилактических реакций. Поэтому пациенты должны находиться под наблюдением не менее 30 мин после вакцинации.

Явление синкопе (обморока) может возникать после или даже до вакцинации как психогенный ответ на инъекцию иглой.

Это может сопровождаться несколькими неврологическими симптомами, такими как нарушение зрения, парестезии и тонико-клонические движения конечностей во время восстановления. Поэтому важно обеспечить условия во избежание возможного травматизма пациента при потере сознания.

Церварикс ни в коем случае нельзя вводить внутрисосудисто или внутрикожно. Данные о п/к введении вакцины Церварикс отсутствуют.

Как и для других вакцин, применяемых в/м, Церварикс следует назначать с осторожностью пациентам с тромбоцитопенией или любым нарушением свертывания крови, поскольку у этих лиц может возникнуть кровотечение после в/м введения.

Как и для других вакцин, защитный иммунный ответ может быть получен не у всех вакцинированных.

Церварикс является профилактической вакциной. Она не предназначена для предотвращения прогрессирования имеющихся на момент вакцинации заболеваний, вызванных ВПЧ. Церварикс не обеспечивает защиту против всех онкогенных типов ВПЧ (см. ХАРАКТЕРИСТИКА). Церварикс обеспечивает защиту только против заболеваний, вызванных ВПЧ-16 и -18, и, в некоторой степени, против заболеваний, вызванных некоторыми другими онкогенными типами ВПЧ (см. ХАРАКТЕРИСТИКА). Поэтому следует соблюдать соответствующие меры безопасности для профилактики заболеваний, передающихся половым путем.

Вакцинация является первичной профилактикой и не отменяет регулярных профилактических осмотров и скрининга рака шейки матки (SVC) (вторичной профилактики) и угрозы относительно влияния ВПЧ и заболеваний, передающихся половым путем.

Кроме пациентов с наличием симптомов ВИЧ и относительно которых имеется ограниченная информация (см. ХАРАКТЕРИСТИКА), данные по применению вакцины Церварикс у пациентов с нарушением иммунной реакции, например у пациентов, получающих иммуносупрессивное лечение, отсутствуют. Для этой группы больных ожидаемый иммунологический ответ после вакцинации может быть не получен.

Продолжительность защитной реакции полностью не определена. Продолжительную защитную эффективность отмечали в течение 9,4 года после введения первой дозы. Долгосрочные исследования по изучению продолжительности защитной эффективности вакцины продолжаются (см. ХАРАКТЕРИСТИКА).

Данные по безопасности, иммуногенности и эффективности относительно взаимозаменяемости вакцины Церварикс с другими ВПЧ-вакцинами не получены.

Это лекарственное средство содержит менее 1 ммоль (23 мг)/дозу натрия, то есть практически свободно от натрия.

Беременность. Специальных исследований по изучению применения вакцины у беременных не проводили.

Данные относительно беременных, полученные в ходе клинических исследований, из регистров беременностей и эпидемиологических исследований, свидетельствуют о том, что применение вакцины Церварикс не изменяет риска развития патологии у новорожденных, включая врожденные дефекты. Данных недостаточно, чтобы сделать вывод о том, влияет ли применение вакцины Церварикс на риск самопроизвольного аборта.

Однако в ходе программы клинических исследований зарегистрировано в общей сложности 10 476 беременностей, включая 5387 беременностей у женщин, вакцинированных Цервариксом. В целом результаты беременностей (например новорожденные без патологий, новорожденные с наличием патологий, включая врожденные дефекты, преждевременные роды и самопроизвольные аборты) были идентичными между группами вакцинированных и невакцинированных женщин.

Влияние вакцины Церварикс на эмбриональное/фетальное, перинатальное и послеродовое выживание и развитие оценивали у крыс. Эти экспериментальные исследования не выявили прямого или опосредованного неблагоприятного влияния на фертильность, беременность, эмбриональное развитие, роды или послеродовое развитие.

Женщинам, которые забеременели или пытаются забеременеть, рекомендуется отложить вакцинацию до окончания беременности.

Кормление грудью. В клинических исследованиях влияние вакцины Церварикс на детей при ее применении кормящими грудью не изучали.

Церварикс следует назначать в период кормления детей грудным молоком только тогда, когда возможная польза от вакцинации превышает вероятный риск.

По данным серологических исследований на крысах можно предположить наличие передачи антител против ВПЧ-16 и -18 с грудным молоком во время лактации. Тем не менее неизвестно, экскретируются ли индуцированные вакциной антитела в грудное молоко у человека.

Способность влиять на скорость реакции при управлении транспортными средствами или работе с другими механизмами. Исследования о влиянии вакцины Церварикс на способность управлять транспортными средствами и работать с механизмами не проводились. Однако некоторые побочные реакции могут временно влиять на скорость реакции при управлении транспортными средствами или работе с другими механизмами (см. ПОБОЧНЫЕ ЭФФЕКТЫ).

Количественное определение и генотипирование ДНК ВПЧ КВАНТ-4 (типы 6,11,16,18) в соскобе (ПЦР)

АНМО «Ставропольский краевой клинический консультативно-диагностический центр»:

355017, г. Ставрополь, ул. Ленина 304

(8652) 951-951, (8652) 35-61-49 (факс)

(8652) 951-951, (8652) 31-51-51 (справочная служба)

Посмотреть подробнее

Обособленное подразделение «Диагностический центр на Западном обходе»:

355029 г. Ставрополь, ул. Западный обход, 64

(8652) 951-951, (8652) 31-51-51 (контактный телефон)

(8652) 31-68-89 (факс)

Посмотреть подробнее

Клиника семейного врача:

355017 г. Ставрополь, пр. К. Маркса, 110 (за ЦУМом)

(8652) 951-951, (8652) 31-51-51 (контактный телефон)

(8652) 31-50-60 (регистратура)

Посмотреть подробнее

Невинномысский филиал:

357107, г. Невинномысск, ул. Низяева 1

(86554) 95-777, 8-962-400-57-10 (регистратура)

Посмотреть подробнее

Обособленное структурное подразделение в г. Черкесске :

369000, г. Черкесск, ул. Умара Алиева 31

8(8782) 26-48-02, +7-988-700-81-06 (контактные телефоны)

Посмотреть подробнее

Обособленное структурное подразделение в г. Элисте :

358000, г. Элиста, ул. Республиканская, 47

8(989) 735-42-07 (контактные телефоны)

Посмотреть подробнее

ЗАО «Краевой клинический диагностический центр»:

355017 г. Ставрополь, ул. Ленина 304

(8652) 951-951, (8652) 35-61-49 (факс)

(8652) 951-951, (8652) 31-51-51 (справочная служба)

Посмотреть подробнее

Обособленное структурное подразделение на ул. Савченко, 38 корп. 9:

355021, г. Ставрополь, ул. Савченко, 38, корп. 9

8 (8652) 316-847 (контактный телефон)

Посмотреть подробнее

Обособленное структурное подразделение на ул. Чехова, 77 :

355000, г. Ставрополь, ул. Чехова, 77

8(8652) 951-943 (контактный телефон)

Посмотреть подробнее

Обособленное структурное подразделение в г. Михайловске:

358000, г. Михайловск, ул. Ленина, 201 (в новом жилом районе «Акварель»).

8(988) 099-15-55 (контактный телефон)

Посмотреть подробнее

Вирус папилломы человека 16-18 (ВПЧ), цена 0.01 Тг., заказать в Алматы — Satu.kz (ID#51870508)

Вирусы папилломы человека (ВПЧ, Genital Human Papillomavirus 16,18 by PCR; HPV 16,18 DNA) — известно более ста видов вирусов, более 30 из которых инфицируют слизистую половых органов. ВПЧ представляет собой безоболочечные ДНК-вирусы, входящие в состав семейства Papillomaviridae. Вирусы передаются только от человека к человеку половым путем, а также при микротравмах кожи и слизистых оболочек. Может передаваться от матери к плоду при прохождении через родовые пути. Среди инфекций, передающихся половым путем, ВПЧ-инфекция является одной из наиболее распространенных в мире. По эпидемиологическим данным к группе риска можно отнести практически всех людей живущих половой жизнью. В процессе своей жизнедеятельности ВПЧ оказывет либо продуктивное (папилломы и кондиломы), либо трансформирующее (дисплазии различной степени и рак) действие. К вирусам оказывающим онкогенное действие высокого риска относятся: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 и 68. Этот перечень постоянно растет за счет уточнения строения ДНК и выявления новых типов промежуточного риска. К ВПЧ-вирусам оказывающим онкогенное действие низкого риска относятся: 6, 11, 42, 43, 44. ВПЧ проникают и размножаются в сквамозном эпителии кожи, образуя доброкачественные бородавки, в слизистых оболочках, вызывая генитальные, оральные и конъюнктивальные папилломы, стимулируют пролиферацию эпителия. ВПЧ-инфекция характеризуется латентным, субклиническим или клинически выраженным течением. Проявлениями у женщин могут быть генитальные бородавки, которые покрывают наружное отверстие уретры, анальная область, область преддверия влагалища, стенки влагалища, шейки матки. У мужчин поражается анальная область, головка полового члена, крайняя плоть, мошонка. Особенностью ВПЧ является способность вызывать латентную инфекцию. До или после активной инфекции ВПЧ может находиться внутри клеток в неактивном состоянии, то есть вирус производит транскрипцию и экспрессию, но инфекционных вирусов не образуется. При нормальном иммунитете рецидивы ВПЧ-инфекции маловероятны. Однако при иммунодефиците (иммуносупрессивная терапии или ВИЧ-инфекция) увеличивает риск новообразований. ВПЧ-инфекция является причиной папилломатоза гортани, остроконечных кондилом, опухолей половых органов, рака шейки матки. Ежегодно в мире примерно 250 000 женщин погибает от рака шейки матки в основном в развивающихся странах. Различные заболевания ассоциируются с различными типами ВПЧ. К примеру, ВПЧ типа 16 и 18 являются причиной рака шейки матки, ВПЧ типа 2 и 27 – простых бородавок, ВПЧ типа 6 и 11 – папилломатоза гортани и остроконечных кондилом. По Европейской классификации в зависимости от выраженности атипии клеток дисплазию шейки матки принято делить на легкую среднюю и тяжелую. В США принята классифицировать дисплазию высокой и низкой степени. Легкая дисплазия эпителия ассоциируется с ВПЧ как высокого, так и низкого онкогенного риска. Тяжелая дисплазия эпителия шейки матки ассоциируется с ВПЧ высокого онкогенного риска. Анализ на ВПЧ у женщин и анализ на ВПЧ у мужчин сдается методом ПЦР. Чувствительность и специфичность метода ПЦР (полимеразная цепная реакция) при определении ДНК ВПЧ около 100%. Показания к проведению Бородавки, кондиломы генитальной области. Выявлении дисплазии эпителия при цитологическом исследовании. Профилактические скрининговые исследования. Подготовка к анализу Недопустимо забирать материал у женщин во время месячных. Рекомендуем после оплаты заказа записаться на сдачу мазка на конкретное время в выбранном Вами временном интервале во избежание длительного ожидания. Для записи следует позвонить в выбранный медицинский центр по телефону, указанному на направлении на анализы (доступно в личном кабинете сразу после оплаты). Факторы, влияющие на результаты анализа Некачественное взятие материала (мало материала), материал у женщин взят во время месячных. Интерпретация результатов исследования В ответе отдельно указывается результат определения ДНК ВПЧ тип 16 и ДНК ВПЧ тип 18. Положительный результат анализа на ВПЧ: в образце обнаружена ДНК ВПЧ типа 16 и/или типа 18: инфицирование ВПЧ тип 16 и/или 18. Отрицательный результат анализа на ВПЧ: в анализируемом образце не обнаружена ДНК ВПЧ типа 16 и/или типа 18: нет инфицирования ВПЧ тип 16 и/или 18. Отрицательный результат исследования может быть также и при нарушении правил взятия материала, когда в образце не содержится ДНК возбудителя в достаточном для проведения исследования количестве. — Единица измерения: качественный тест, результат выдаётся в виде: положительный, отрицательный — Референсные значения Отрицательный результат

Экспрессия генов вируса папилломы человека типа 16 и 18 в неоплазиях шейки матки

Вирусы папилломы человека (ВПЧ) типов 16 и 18 в значительной степени вовлечены в формирование прогрессирующих новообразований шейки матки. Вирусы производят сложные семейства перекрывающихся информационных РНК, которые связаны с дифференцировкой, что делает необходимым анализ экспрессии генов в контексте морфологии. Мы разработали субгеномные клоны ВПЧ 16 и 18 типов, из которых in vitro могут быть получены меченные 3H рибозонды, специфичные для отдельных семейств мРНК.Используя эти зонды для гибридизации in situ, мы исследовали серийные срезы архивных биоптатов всего спектра генитальных поражений. В плоскоклеточных поражениях низкой степени выражены все открытые рамки считывания вируса, и наиболее распространенная транскрипция охватывает открытые рамки считывания E4 и E5 на 3′-конце области E. Транскрипция L-области, кодирующая белки капсида, была ограничена терминально дифференцированными кератиноцитами. По мере увеличения степени неоплазии клеточная дифференцировка и общая вирусная транскрипция снижались, и, за некоторыми исключениями, транскрипты L2 и L1 перестали существовать.Преобразовательная область E6-E7 неизменно подвергалась дерепрессии. Интересно, что характер экспрессии гена HPV-16 предполагает сосуществование эписомальной и интегрированной вирусной ДНК. Напротив, в очагах поражения HPV-18 вся вирусная матричная ДНК оказалась интегрированной. Было установлено, что интеграция происходила вблизи границы открытых рамок считывания E1 и E2. Паттерны вирусной транскрипции были подобны в карциномах in situ и в инвазивных карциномах, независимо от гистологических типов клеток или связанных типов вирусов, что согласуется с мнением о том, что для прогрессирования необходимы дополнительные изменения гена-хозяина.На основе экспрессии вирусных генов in vivo и регуляции промотора E6, ранее охарактеризованной in vitro, мы обсуждаем молекулярный механизм канцерогенеза, связанного с ВПЧ.

Значение ВПЧ высокого риска, отличного от типа 16/18, у женщин с отрицательной цитологией: действительно ли безопасно ждать 1 год?

Фон: Вирус папилломы человека (ВПЧ) является основным фактором риска рака шейки матки.ВПЧ 16 и 18 являются двумя наиболее канцерогенными генотипами, о которых сообщалось в большинстве случаев рака шейки матки. ВПЧ высокого риска (ВПЧ), отличные от ВПЧ 16/18, вызывают примерно четверть случаев рака шейки матки. Мы стремились представить результаты биопсии под контролем кольпоскопии у женщин, не инфицированных 16/18 hrHPV, с отрицательной цитологией.

Методы: Это ретроспективное когортное исследование, проведенное с участием 752 пациентов в возрасте от 30 до 65 лет с ВПЧ не 16/18 и отрицательной цитологией, которым проводилась биопсия под контролем кольпоскопии в гинекологическом онкологическом центре третичного уровня в период с января 2016 года по январь 2019 года.

Полученные результаты: Средний возраст женщин составил 42,35 ± 9,41 года. Интраэпителиальная неоплазия шейки матки (ЦИН) 2+ обнаружена у 49 (6,5%) женщин с отрицательной цитологией. Частота поражений CIN 2+ у женщин с аномальной цитологией составила 12,8%. Пациенты с аномальной цитологией примерно в 2,1 и 2,4 раза увеличили вероятность поражения CIN 2+ в образцах цервикальной биопсии и эндоцервикального выскабливания соответственно.Поражение CIN 3+ выявлено у 20 (2,7%) женщин с отрицательной цитологией. У одного (0,1%) пациента с ВПЧ 39 и отрицательной цитологией был инвазивный рак шейки матки. Двумя наиболее распространенными подтипами ВПЧ были ВПЧ 31 и ВПЧ 51.

Выводы: Риск преинвазивных поражений шейки матки все еще может быть обнаружен и не может быть полностью устранен среди hrHPV, кроме 16/18-инфицированных женщин с отрицательным цитологическим исследованием.На основании результатов этого исследования направление женщин, не инфицированных 16/18 hrHPV, с отрицательным цитологическим исследованием на кольпоскопию, является надежной и осуществимой стратегией.

Ключевые слова: рак шейки матки; цервикальная интраэпителиальная неоплазия; кольпоскопия; вирус папилломы человека.

У моего пациента стойкая положительная реакция на ВПЧ 16/18 … и отрицательная кольпоскопия?

ВПЧ типов 16 и 18 вызывают 60-70% случаев рака шейки матки во всем мире, а остальные типы ВПЧ высокого риска являются причиной практически всех остальных случаев.В связи с необходимостью стратификации ВПЧ-положительных (цитологических отрицательных) пациентов было использовано генотипирование для ВПЧ типов 16 и 18, чтобы попытаться помочь идентифицировать женщин с повышенным риском рака шейки матки (или его предшественника, тяжелой дисплазии / CIN 3). В 10-летнем исследовании ВПЧ и заболеваний шейки матки 1 10-летняя частота встречаемости CIN 3 или выше составила 17,2% для женщин с положительным результатом теста на тип 16, 13,6% для типа 18 и 3% для других ВПЧ высокого риска. типы. Эти различия, безусловно, заметны, и генотипирование в настоящее время является приемлемым дополнением к рекомендациям по скринингу рака шейки матки ASCCP и ACOG.Однако примите во внимание следующее: учитывая приведенную выше статистику, у большинства женщин с отрицательным результатом цитологии шейки матки, у которых тест на ВПЧ 16/18 положительный, НЕ разовьется CIN 3+. И наоборот, женщина с отрицательным результатом теста на эти два типа ВПЧ высокого риска не защищена от рака шейки матки. Следовательно, первая группа может подвергнуться ненужному последующему наблюдению (или даже возможному удалению), зная, что они являются носителями ВПЧ особенно высокого риска, что беспокоит как пациента, так и врача.Кроме того, связь типов ВПЧ 16/18 с заболеванием шейки матки высокой степени варьирует в зависимости от географических и расовых границ. В статье, опубликованной в Cancer 2 , выяснилось, что афроамериканская раса, латиноамериканская этническая принадлежность и районы бедности связаны с более низкой заболеваемостью типов 16/18 среди женщин с тяжелой формой заболевания шейки матки. Дополнительное исследование 3 показало, что афроамериканские женщины в ДВА РАЗА реже заражаются ВПЧ 16/18, даже при тяжелой степени поражения шейки матки. РЕЗУЛЬТАТ: в то время как типы ВПЧ 16 и 18 вызывают большинство случаев рака шейки матки во всем мире, положительность этих генотипов не предсказывает их развитие; и отрицательные результаты для типов 16/18 не отменяют риск заболевания шейки матки высокой степени.

Изображение: нормальная клетка с 2 копиями 3q26 (TERC), одной из наиболее часто тестируемых на хромосомные аномалии при заболевании шейки матки, которое наблюдается примерно в 75% случаев рака шейки матки.


БИБЛИОГРАФИЯ 1 Хан MJ, et al. Повышенный 10-летний риск развития предрака и рака шейки матки у женщин с вирусом папилломы человека (ВПЧ) типа 16 или 18 и возможная полезность тестирования на тип-специфический ВПЧ в клинической практике. J Natl Cancer Inst. 20 июля 2005 г .; 97 (14): 1072-9. 2 Niccolai LM, et al. Индивидуальные и географические различия в типах вируса папилломы человека 16/18 при тяжелых поражениях шейки матки: ассоциации с расой, этнической принадлежностью и бедностью. Рак. 2013 15 августа; 119 (16): 3052-8. 3 Видал А.С. и др. Генотипы ВПЧ и цервикальная интраэпителиальная неоплазия в полиэтнической когорте на юго-востоке США. Контроль причин рака. 2014 Август; 25 (8): 1055-62. Статья написана патологом PathAdvantage Ричардом Хопли, доктором медицины.

Генетическая изменчивость, филогения и функциональное значение длинной контрольной области у вируса папилломы человека типа 16, 18 и 58 в Чэнду, Китай | Журнал вирусологии

  • 1.

    Ферлей Дж., Сурджоматарам И., Дикшит Р., Эсер С., Мазерс С., Ребело М. и др. Заболеваемость и смертность от рака во всем мире: источники, методы и основные закономерности в GLOBOCAN 2012. Int J Cancer. 2015; 43: 66–7.

    Google ученый

  • 2.

    Чен В., Чжэн Р., Бааде П.Д., Чжан С., Цзэн Х., Брей Ф. и др. Статистика рака в Китае, 2015. CA Cancer J Clin. 2016; 66: 115–32.

    Артикул Google ученый

  • 3.

    Бурк Р.Д., Харари А., Чен З. Варианты генома вируса папилломы человека. Вирусология. 2013; 445: 232–43.

    CAS PubMed PubMed Central Google ученый

  • 4.

    Гиттони Р., Аккарди Р., Чиокка С., Томмазино М. Роль вирусов папилломы человека в канцерогенезе. Раковая медицина. 2015; 9: 1–9.

    Google ученый

  • 5.

    Muñoz N, Bosch FX, De Sanjosé S, Herrero R, Castellsagué X, Shah KV и др.Эпидемиологическая классификация типов вируса папилломы человека, ассоциированных с раком шейки матки. N Engl J Med. 2003; 348: 518–27.

    PubMed Google ученый

  • 6.

    Шиффман М., Эрреро Р., Десалл Р., Хильдесхайм А., Вахолдер С., Родригес А.С. и др. Канцерогенность типов вируса папилломы человека отражает эволюцию вируса. Вирусология. 2005. 337: 76–84.

    CAS PubMed Google ученый

  • 7.

    де Вилльерс Э., Фоке С., Брокер Т.Р., Бернар Х., цур Хаузен Х. Классификация вирусологии папилломавирусов 2004; 324: 17–27.

  • 8.

    Ли Н., Франчески С., Хауэлл-Джонс Р., Снайдерс П.Д.Ф., Клиффорд Г.М. Распределение типа вируса папилломы человека среди 30 848 инвазивных форм рака шейки матки во всем мире: вариации в зависимости от географического региона, гистологического типа и года публикации. Int J Cancer. 2011; 128: 927–35.

    CAS PubMed Google ученый

  • 9.

    Hildesheim A, Schiffman M, Bromley C, Herrero R, Rodriguez C, Bratti C и др. Варианты вируса папилломы человека 16 типа и риск рака шейки матки. J Natl Cancer. 2001; 93: 315–8.

    CAS Google ученый

  • 10.

    zur Hausen H. Папилломавирусы и рак: от фундаментальных исследований до клинического применения. Нат Рев Рак. 2002; 2: 342–350.

  • 11.

    Wu Z, Qin Y, Yu L, Lin C, Wang H, Cui J, et al. Связь между вирусом папилломы человека HPV16, HPV18 и другой вирусной нагрузкой HR-HPV и гистологической классификацией поражений шейки матки: результаты крупномасштабного поперечного исследования.J Med Virol. 2017; 89: 535–41.

    CAS PubMed Google ученый

  • 12.

    Бао Ю.П., Ли Н., Смит Д.С., Цяо Ю.Л., Тан Дж., Лю Дж. И др. Распространение типа вируса папилломы человека у женщин из Азии: метаанализ. Int J Gynecol Cancer. 2008; 18: 71–9.

    PubMed Google ученый

  • 13.

    Гуан П., Хауэлл-Джонс Р., Ли Н., Бруни Л., Де Санхосе С., Франчески С. и др. Типы вируса папилломы человека у 115 789 ВПЧ-положительных женщин: метаанализ от инфекции шейки матки до рака.Int J Cancer. 2012; 131: 2349–59.

    CAS PubMed Google ученый

  • 14.

    Бурк Р.Д., Чен З., Ван Дорслаер К. Вирусы папилломы человека: генетические основы канцерогенности. Геномика общественного здравоохранения. 2009; 12: 281–90.

    PubMed PubMed Central Google ученый

  • 15.

    Graham SV. Регулирование гена вируса папилломы человека, зависимое от дифференцировки кератиноцитов. Вирусы.2017; 9: 245–62.

    PubMed Central Google ученый

  • 16.

    Хо Л., Чан С.И., Чоу В., Чонг Т., Тай С.К., Вилла Л.Л. и др. Варианты последовательностей вируса папилломы человека типа 16 в клинических образцах позволяют проверить и расширить эпидемиологические исследования и построить филогенетическое дерево. J Clin Microbiol. 1991; 29: 1765–72.

    CAS PubMed PubMed Central Google ученый

  • 17.

    Ямада Т., Манос М.М., Пето Дж., Грир К.Э., Муньос Н., Bosch FX и др. Вариации последовательности вируса папилломы человека типа 16 при раке шейки матки: мировая перспектива. J Virol. 1997; 71: 2463–72.

    CAS PubMed PubMed Central Google ученый

  • 18.

    Cornet I, Gheit T, Iannacone MR, Vignat J, Sylla BS, Del Mistro A, et al. Генетическая изменчивость ВПЧ16 и развитие рака шейки матки во всем мире. Br J Рак. 2013; 108: 240–4.

    CAS PubMed Google ученый

  • 19.

    de Sanjose S, Quint WGV, Alemany L, Geraets DT, Klaustermeier JE, Lloveras B, et al. Атрибуция генотипа вируса папилломы человека при инвазивном раке шейки матки: ретроспективное перекрестное всемирное исследование. Ланцет Онкол. 2010; 11: 1048–56.

    PubMed Google ученый

  • 20.

    Xi LF, Kiviat NB, Hildesheim A, Galloway DA, Wheeler CM, Ho J, et al.Варианты вируса папилломы человека типа 16 и 18: расовое распространение и устойчивость. J Natl Cancer Inst. 2006; 98: 1045–52.

    PubMed Google ученый

  • 21.

    Xi J, Chen J, Xu M, Yang H, Wen S, Pan Y и др. Полиморфизмы LCR, E6 и E7 изолятов HPV-58 в Юньнани. Юго-Западный Китай Virol J. 2018; 15:76.

    PubMed Google ученый

  • 22.

    Ли Дж, Мэй Дж, Ван Х, Ху Л., Линь И, Ян П.Распространенность вируса папилломы человека среди женщин с цервикальным интраэпителиальным новообразованием в Западном Китае. J Clin Microbiol. 2012; 50: 1079–81.

    PubMed PubMed Central Google ученый

  • 23.

    Чан П.К., Лам Ч.В., Чунг Т.Х., Ли У.В., Ло К.В., Чан Ю.М. и др. (2002). Ассоциация варианта вируса папилломы человека 58 типа с риском рака шейки матки. CancerSpectrum Knowl Environ. 2002; 94: 1249–53.

    CAS Google ученый

  • 24.

    Тамура К., Стечер Г., Петерсон Д., Филипски А., Кумар С. MEGA6: анализ молекулярной эволюционной генетики, версия 6.0. Mol Biol Evol. 2013; 30: 2725–9.

    CAS PubMed PubMed Central Google ученый

  • 25.

    Мателье А., Форнес О., Аренильяс Д. Д., Чен С. Ю., Денай Дж., Ли Дж. И др. JASPAR 2016: значительное расширение и обновление базы данных с открытым доступом профилей связывания факторов транскрипции. Nucleic Acids Res. 2016; 44: D110–5.

    CAS PubMed Google ученый

  • 26.

    Чен З., Шиффман М., Эрреро Р., ДеСалле Р., Анастос К., Сегонди М. и др. Эволюция и таксономическая классификация геномов вариантов, связанных с вирусом папилломы человека 16 (HPV16): HPV31, HPV33, HPV35, HPV52, HPV58 и HPV67. PLoS One. 2011; 6.

  • 27.

    Клиффорд Г.М., Смит Дж. С., Пламмер М., Муньос Н., Франчески С. Типы вируса папилломы человека при инвазивном раке шейки матки во всем мире: метаанализ.Br J Рак. 2003. 88: 63–9.

    CAS PubMed PubMed Central Google ученый

  • 28.

    Хван Т. Обнаружение и типирование ДНК вируса папилломы человека методом ПЦР с использованием консенсусных праймеров в различных поражениях шейки матки у корейских женщин. J. Korean Med. Sci. 1999. с. 593–9.

  • 29.

    Онуки М., Мацумото К., Сато Т., Оки А., Окада С., Минагути Т. и др. Инфекции вируса папилломы человека среди японских женщин: возрастная распространенность и типоспецифический риск рака шейки матки.Cancer Sci. 2009. 100: 1312–6.

    CAS PubMed Google ученый

  • 30.

    Адзума Ю., Кусумото-Мацуо Р., Такеучи Ф., Уэнояма А., Кондо К., Цунода Х. и др. Распределение генотипа вируса папилломы человека при цервикальной интраэпителиальной неоплазии 2/3 степени и инвазивном раке шейки матки у японских женщин. Jpn J Clin Oncol. 2014; 44: 910–7.

    PubMed Google ученый

  • 31.

    Hong D, Ye F, Chen H, Lü W., Cheng Q, Hu Y и др. Распространение генотипов вируса папилломы человека у пациентов с раком шейки матки и его предшественниками в провинции Чжэцзян. China Int J Gynecol Cancer. 2008; 18: 104–9.

    CAS PubMed Google ученый

  • 32.

    Чан ПКС, Хо WCS, Ю М.Н., Понг В.М., Чан ACL, Чан АКС и др. Распространение типов вируса папилломы человека при раке шейки матки в Гонконге: текущая ситуация и изменения за последние десятилетия.Int J Cancer. 2009; 125: 1671–7.

    CAS PubMed Google ученый

  • 33.

    Ding DC, Hsu HC, Huang RL, Lai HC, Lin CY, Yu MH, et al. Типоспецифическое распределение ВПЧ по всему спектру канцерогенеза шейки матки на Тайване: показатель вирусного онкогенного потенциала. Eur J Obstet Gynecol Reprod Biol. 2008. 140: 245–51.

    CAS PubMed Google ученый

  • 34.

    Cornet I, Gheit T, Franceschi S, Vignat J, Burk RD, Sylla BS, et al. Генетические варианты вируса папилломы человека 16 типа: филогения и классификация на основе E6 и LCR. J Virol. 2012; 86: 6855–61.

    CAS PubMed PubMed Central Google ученый

  • 35.

    Hang D, Yin Y, Han J, Jiang J, Ma H, Xie S и др. Анализ 16 вариантов вируса папилломы человека и риск рака шейки матки у населения Китая. Вирусология. 2016; 488: 156–61.

    CAS PubMed Google ученый

  • 36.

    Чен А.А., Гейт Т., Франчески С., Томмазино М., Клиффорд Г.М. Генетическая изменчивость вируса папилломы человека 18 и риск рака шейки матки во всем мире. J Virol. 2015; 89: 10680–7.

    CAS PubMed PubMed Central Google ученый

  • 37.

    Амадор-Молина А., Гонсалес-Монтойя Дж. Л., Гарсия-Карранка А., Мохар А., Лизано М. Внутритипные изменения гена E1 и длинная контрольная область влияют на функцию ori вариантов вируса папилломы человека 18 типа.J Gen Virol. 2013; 94: 393–402.

    CAS PubMed Google ученый

  • 38.

    Hubert WG, Kanaya T, Laimins LA. Репликация ДНК вируса папилломы человека 31 типа модулируется элементами вышележащей регуляторной области, которые лежат в 5′-положении от минимального ориджина. J Virol. 1999; 73: 1835–45.

    CAS PubMed PubMed Central Google ученый

  • 39.

    Chen Z, Ho WCS, Boon SS, Law PTY, Chan MCW, DeSalle R, et al.Древняя эволюция и распространение 58 вариантов вируса папилломы человека. J Virol. 2017; 91.

  • 40.

    Wang R, Chen X, Xu T, Xia R, Han L, Chen W. и др. MiR-326 регулирует пролиферацию и миграцию клеток при раке легких, воздействуя на phox2a, и регулируется HOTAIR. Am J Cancer Res. 2016; 6: 173–86.

    CAS PubMed PubMed Central Google ученый

  • 41.

    Ван Ф, Гао Й, Тан Л., Нин К., Гэн Н., Чжан Х и др.Новая ось PAK4-CEBPB-CLDN4, участвующая в миграции и инвазии клеток рака груди. Biochem Biophys Res Commun. 2019; 511: 404–8.

    CAS PubMed Google ученый

  • 42.

    Чжан Х., Чжао Дж., Суо З. Нокдаун HOXA5 подавляет онкогенез при плоскоклеточном раке пищевода. Biomed Pharmacother. 2017; 86: 149–54.

    CAS PubMed Google ученый

  • 43.

    Qin Y, Gong W, Zhang M, Wang J, Tang Z, Quan Z. Forkhead box L1 часто подавляется при раке желчного пузыря и подавляет рост клеток за счет индукции апоптоза митохондриальной дисфункцией. PLoS One. 2014; 9: 1–10.

    Google ученый

  • 44.

    Miettinen M, Mccue PA, Sarlomo-rikala M, Biernat W., Czapiewski P, Kopczynski J, et al. Sox10 — маркер не только шванновских и меланоцитарных новообразований, но и миоэпителиально-клеточных опухолей мягких тканей.Am J Surg Pathol. 2015; 39: 826–35.

    PubMed PubMed Central Google ученый

  • 45.

    Тонг X, Li L, Li X, Heng L, Zhong L, Su X и ​​др. SOX10, новый опухолевый супрессор, содержащий HMG-бокс, подавляет рост и метастазирование рака пищеварительной системы, подавляя путь wnt / β-катенин. Oncotarget. 2014; 5: 10571–83.

    PubMed PubMed Central Google ученый

  • 46.

    Чжун В, Цинь Г, Дай Кью, Хан З, Чен С., Лин Х и др. SOX при раке простаты человека: значение как факторы прогрессирования и прогноза. BMC Рак. 2012; 12: 248.

    CAS PubMed PubMed Central Google ученый

  • 47.

    Диттмер Дж. Роль транскрипционного фактора Ets1 при карциноме. Semin Cancer Biol. 2015; 35: 20–38.

    CAS PubMed Google ученый

  • Вирус папилломы человека 16 типа и плоскоклеточный рак головы и шеи

    Реферат

    Цель: Ранее сообщалось, что вирус папилломы человека (ВПЧ) связан с плоскоклеточным раком головы и шеи.Наша цель состояла в том, чтобы исследовать наличие и тип инфекции ВПЧ в опухолях головы и шеи и определить, была ли инфекция связана с индивидуальными характеристиками опухоли, привычкой пациента к употреблению табака и алкоголя или с клиническим исходом.

    План эксперимента: Используя план серии случаев, были получены образцы свежих опухолей у 89 пациентов с плоскоклеточным раком головы и шеи, включая 64 мужчин и 25 женщин. Большинство опухолей располагалось в полости рта, за ней следовала ротоглотка.Метод на основе ПЦР с анализом полиморфизма длины рестрикционных фрагментов был использован для обнаружения и типа HPV.

    Результаты: Из 89 пациентов 18 (20%) имели обнаруживаемый ВПЧ16 в образцах опухолей. ВПЧ16 был обнаружен в 64% опухолей миндалин, 52% опухолей ротоглотки и 5% опухолей полости рта. Средний возраст пациентов с HPV16-положительными опухолями был моложе пациентов с HPV-отрицательными опухолями. Кроме того, эта группа еженедельно потребляла меньше алкоголя и имела лучший клинический результат по сравнению с группой, не имеющей отношения к ВПЧ.Курение, клиническая стадия, степень опухоли и статус метастазов в опухолевые узлы не были связаны с наличием ВПЧ16.

    Выводы: Наше исследование подтверждает предыдущие сообщения, которые предполагают, что ВПЧ16 связан с плоскоклеточным раком, локализованным в ротоглотке и полости рта. Тот факт, что ВПЧ-положительные опухоли наблюдались у более молодых людей, потребляющих меньше алкоголя, с лучшей общей выживаемостью и выживаемостью по конкретным заболеваниям, предполагает наличие у этих пациентов различного процесса болезни.

    ВВЕДЕНИЕ

    Ежегодно регистрируется около 45 000 новых случаев HNSCC3. диагностирован в США (1) . Уровень инцидентов во всем мире намного выше, особенно на Индийском субконтиненте, в Гонконге и в Европе (2). . Несмотря на успехи в лечении за последние десятилетия, общая 5-летняя выживаемость в США остается на уровне ~ 55% (3). . Установленные этиологические факторы включают курение сигарет, трубки и сигар, злоупотребление алкоголем, жевание орехов бетеля и употребление бездымного табака.Однако 15–20% HNSCC (3) пациенты не подвергались воздействию табака или алкоголя (4) . Эта группа может расти (5) и включают большую часть молодых людей и женщин (6, 7, 8) . Все чаще исследования сосредотачиваются на выявлении возможного вирусного этиологического фактора; в основном это онкогенные ВПЧ.

    подтипов ВПЧ 16, 18 и 33 были обнаружены в> 99% случаев рака шейки матки во всем мире (9) . Эти типы вирусов продуцируют онкогенные белки (E6 и E7), которые нарушают функцию p53 и pRb соответственно и тем самым способствуют иммортализации клеток (10). .Эпидемиологические исследования выявили повышенную заболеваемость и относительный риск HNSCC среди субъектов, изначально страдающих раком шейки матки (11 , 12) . Таким образом, исследования были сосредоточены на распространенных этиологических факторах, таких как курение и инфицирование ВПЧ. Löning et al. (13) впервые предположил связь между ВПЧ и HNSCC в 1985 году, и с тех пор данные о возможной связи увеличиваются. Действительно, эти белки и последующее нарушение клеточного цикла были продемонстрированы в HNSCC (14, 15, 16, 17). .

    Предыдущие исследования сообщили о наличии ВПЧ типов 16 и 18 при раке ротоглотки. Оценки распространенности ВПЧ в опухолях HNSCC варьируются в зависимости от используемого метода обнаружения и характера сохранения тканей (18 , 19) . ДНК из свежей опухолевой ткани, подвергнутой ПЦР-амплификации вирусной области L1 или E7, имеет самый высокий зарегистрированный уровень обнаружения (20 , 21) . Однако в этих отчетах часто отсутствовала информация о других факторах риска, таких как употребление табака и алкоголя.Анатомические участки и характеристики пациента, такие как возраст, пол, клиническая стадия, курение и употребление алкоголя, по разным оценкам связаны с обнаружением ВПЧ. Кроме того, недавно Gillison et al. (22) и Schwartz et al. (23) обнаружили, что пациенты с HPV16-положительным статусом выживают больше, чем HPV-отрицательные пациенты.

    Наша цель состояла в том, чтобы определить присутствие подтипов ВПЧ высокого риска в образцах свежих опухолей HNSCC с использованием метода обнаружения на основе полиморфизма длины рестрикционных фрагментов с помощью ПЦР.Информация о возрасте пациента, истории болезни, статусе курения, употреблении алкоголя, клиническом ведении и последующем наблюдении была собрана из медицинских записей, запросов к базе данных и подробных анкет, заполненных пациентами. Затем мы исследовали взаимосвязь вирусного присутствия с этими демографическими и клиническими параметрами.

    МАТЕРИАЛЫ И МЕТОДЫ

    образца опухоли были получены от 89 пациентов с HNSCC, осмотренных в Онкологическом институте Дана-Фарбер, больнице Бригама и женщин и больнице Бет Исраэль Дьяконесса (Бостон, Массачусетс) в период с 1994 по 1998 год.Образцы были мгновенно заморожены в жидком азоте во время иссечения и хранили при -80 ° C до использования. Информация о поле, возрасте, курении и алкогольном анамнезе пациентов была собрана из прямых интервью с пациентами и из медицинских записей. Стадия, статус TNM и степень опухоли были получены из клинических записей, патологий и радиологических отчетов. Стадия проводилась в соответствии с рекомендациями Международного союза борьбы с раком, пятое издание (24). . Информация о последующем наблюдении была получена из истории болезни и лечащего врача.База данных индекса смерти по социальному обеспечению использовалась для подтверждения даты смерти.

    Экстракция

    ДНК из свежезамороженных образцов была выполнена с использованием набора для экстракции QIAamp (Qiagen, Valencia CA). Целостность ДНК подтверждали амплификацией β-актина из образца ДНК. Чтобы свести к минимуму перекрестное загрязнение, процедуры ПЦР проводились в отдельной лаборатории, где происходило выделение ДНК. Положительный и отрицательный контроли использовались во время всех процедур обнаружения и типирования ВПЧ.

    Образцы были проанализированы на наличие ВПЧ с помощью ПЦР с амплификацией части вирусной области L1, как ранее сообщали Тинг и Манос (25). . Реакционная смесь объемом 50 мкл состояла из 1 мкм каждого праймера, 1 мкл образца ДНК, 2 мкм каждого 2′-дезоксинуклеозид 5′-трифосфата, 2,0 мкм MgCl 2 и 2 единиц рекомбинантной полимеразы Taq (Perkin- Элмер / Китус, Норуолк, Коннектикут). Первоначальная денатурация происходила при 95 ° C в течение 5 минут, затем следовали 40 циклов 94 ° C в течение 30 секунд, 55 ° C в течение 45 секунд и 72 ° C в течение 1 минуты.Окончательное удлинение было выполнено при 72 ° C в течение 7 минут. Продукты ПЦР обрабатывали в 4% агарозном геле, окрашенном бромидом этидия. Положительным на ВПЧ считался фрагмент длиной 449–458 нуклеотидов. Вирусное типирование было достигнуто путем переваривания ампликона L1 рестрикционным ферментом эндонуклеазой рестрикции RSA1, эндонуклеазой рестрикции PST1 и Hae III (26). . В отличие от многих других типов ВПЧ, продукты ампликонов L1 ВПЧ16 и ВПЧ18 по существу не разрезаны Hae III. Расщепление рестрикционной эндонуклеазой RSA1 ампликона MY09 / 11 HPV16 демонстрирует структуру переваривания фрагментов длиной 310, 72 и 70 п.н.Этот фермент расщепляет продукт HPV18 на гораздо более мелкие отдельные фрагменты длиной 135, 125, 85, 72 и 38 п.н.

    × 2 и точный тест Фишера были использованы для изучения связи обнаружения ВПЧ с полом, первичным локализацией, стадией, статусом TNM, курением и историей употребления алкоголя. Курильщики классифицировались как нынешние, бывшие или никогда не курившие. Аналогичная система классификации использовалась для употребления алкоголя. Интенсивность потребления алкоголя измерялась в эквивалентах виски в неделю (1 эквивалент виски = 1 пиво, 1 стакан вина или 1 рюмка крепких напитков).Тест суммы рангов Вилкоксона использовался для изучения разницы по статусу ВПЧ для среднего возраста пациента, количества лет курения, количества пачек в день и количества паковок в год. Для дальнейшего изучения этих взаимосвязей была проведена логистическая регрессия для расчета P s и 95% доверительных интервалов с учетом возраста, пола, потребления табака и алкоголя. Оценки выживаемости Каплана-Мейера и модель пропорциональных рисков регрессии Кокса использовались для анализа данных о выживаемости и расчета HR. Дополнительные HR были рассчитаны с поправкой на возраст пациента и стадию заболевания.Смертность, наступившая в течение 2 месяцев после операции, подвергалась цензуре при анализе выживаемости. Все статистические данные были выполнены с помощью программного обеспечения SAS с P <0,05, считающимся значимым (Институт SAS, Кэри, Северная Каролина).

    РЕЗУЛЬТАТЫ

    Первоначальные эксперименты по определению чувствительности нашего метода использовали клетки SiHa (HPV16-позитивные с 1-2 копиями на клетку) и клетки HeLa (HPV18-позитивные с 10-50 копиями / клеткой). Эти клетки были серийно разбавлены клеточными линиями рака шейки матки Ca-33A (HPV-отрицательными) (American Type Culture Collection, Manassas VA).Нам удалось обнаружить от 1 до 50 копий ВПЧ в одной клетке на фоне 100 неинфицированных клеток. Эти клеточные линии действовали как положительный и отрицательный контроль для последующей работы.

    Было 86 плоскоклеточных карцином, которые представляли первичное заболевание, и 3 — местные рецидивы. Группа состояла из 64 мужчин (72%) и 25 женщин (28%). Средний и средний возраст исследуемой группы составлял 59 лет (таблица 1) ⇓ . Все образцы опухолей имели плоскоклеточное происхождение. ВПЧ16 был обнаружен в 17 из 89 образцов опухоли (20%).В образцах не было обнаружено ВПЧ18; был обнаружен только HPV16. Ни в одной из рецидивирующих опухолей ВПЧ не обнаружено.

    Таблица 1

    Демографические характеристики ВПЧ-положительных и ВПЧ-отрицательных пациентов

    Пятнадцать из 18 HPV16-положительных опухолей (83%) были обнаружены в ротоглотке; остальные 3 положительные опухоли (11%) были в полости рта и гортани (Таблица 2) ⇓ . Шестьдесят четыре процента опухолей миндалин ( n = 7 из 11) были положительными на ВПЧ16 ( P <0.0001).

    Таблица 2

    Клинико-патологические характеристики ВПЧ-положительных и ВПЧ-отрицательных пациентов

    Средний возраст пациентов, которые были HPV16-положительными, был на 8,4 года моложе, чем HPV-отрицательная группа (HPV16-положительные: средний возраст = 52,7 лет по сравнению с HPV-отрицательными: средний возраст = 61,1 года; P <0,01) . Когда пациенты были разделены на молодых (<59 лет) и старых (≥59 лет) на основе среднего возраста исследуемой группы, HPV16 с большей вероятностью выявлялся в более молодой группе пациентов (Таблица 1⇓ ; P = 0.009). После учета пола, курения и алкогольного анамнеза с помощью моделей логистической регрессии у субъектов старше 59 лет была меньше шансов иметь ВПЧ-положительные опухоли (OR = 0,18; 95% ДИ = 0,04, 0,88; P <0,03).

    В одномерном анализе присутствие HPV16 было тесно связано как с меньшим количеством потребляемых эквивалентов виски ( P <0,007), так и с меньшим количеством лет курения (HPV16-позитивная группа: среднее количество лет курения = 30,1 лет против HPV. -отрицательная группа: среднее количество лет курения = 36.4 года; P <0,03). Среднее количество потребляемых эквивалентов виски в день составляло 3. Логистический регрессионный анализ показал, что были некоторые противоречия; потребление> 3 порций напитка в день ( P = 0,02), но не продолжительность курения ( P > 0,05) предсказывала положительную реакцию на ВПЧ16 после учета возраста и пола. Возраст начала курения, количество выкуриваемых пачек в день и количество упакованных лет не различались по статусу ВПЧ. Двадцать три процента мужчин были положительными на ВПЧ16 по сравнению с 12% женщин.Клиническая стадия, статус TNM, курение и алкогольный статус (текущий против , бывшего против никогда) не были связаны с наличием ВПЧ.

    Пациенты с опухолями, несущими ВПЧ16, имели лучший клинический результат, чем группа с отрицательным ВПЧ. Согласно анализу Каплана-Мейера, пациенты с ВПЧ16-позитивным статусом в целом были лучше (рис. 1 A ⇓ ; Wilcoxon P = 0,01) и заболевание (рис.1 B ⇓ ; Wilcoxon P = 0,01) выживаемость. Используя модель пропорциональных рисков Кокса, нескорректированный HR для общей выживаемости был равен 0.20 ( P = 0,03), аналогично возрасту и стадии, скорректированный HR = 0,23 ( P = 0,05). Один из 18 HPV16-положительных пациентов умер от своего заболевания (5,9%) по сравнению с 33 (46%) из 71 в группе HPV-отрицательных ( P = 0,003). Трое участников исследования умерли от причин, не связанных конкретно с раком головы и шеи. В целом, у 22 (25%) из 89 пациентов был рецидив местного, регионального или отдаленного характера. Ни у одного из пациентов с ВПЧ-16-положительными опухолями не развился рецидив заболевания ( P = 0.002). Тринадцать субъектов в группе ВПЧ-отрицательных имели неконтролируемое первичное заболевание. Один из пациентов с ВПЧ16 имел неконтролируемое заболевание ( P = 0,002).

    Рис.1.

    График, изображающий оценки Каплана-Мейера общей выживаемости, измеренной в месяцах с момента постановки диагноза HNSCC, путем обнаружения ВПЧ (———, ВПЧ-отрицательный; · · · ·, ВПЧ-положительный). Данные были проанализированы на предмет смертности от всех причин ( A ; Wilcoxon P = 0,01) и смертности от конкретных заболеваний ( B ; Wilcoxon P = 0.01). Цензурированные значения отмечены знаком +.

    ОБСУЖДЕНИЕ

    В целом, 20% опухолей HNSCC в нашем исследовании дали положительный результат на ВПЧ16. В образцах не было обнаружено HPV18. В предыдущих исследованиях сообщалось о подобной частоте обнаружения среди опухолей HNSCC с 90% типов HPV, идентифицированных как HPV16 (22 , 27) . Наше обнаружение только HPV16 у наших субъектов с помощью методологии полиморфизма длины рестрикционных фрагментов ПЦР, способной выявлять> 40 различных типов вирусов HPV, могло быть связано с небольшим размером выборки или реальными различиями в исследуемой популяции.Gillison et al. (22) обнаружил HPV16 у 22%, HPV18 у 0,4%, HPV33 у 1,2% и HPV31 у 0,4% из 253 пациентов с HNSCC. Следовательно, можно ожидать выявления менее одного случая любого из этих более редких типов ВПЧ. Кроме того, инфекция HPV16 и HPV18 у пациентов с HNSCC может варьироваться в зависимости от географического положения. Например, Aggelopouloa et al. (27) Изучение рака и гиперплазии полости рта у греческого населения показало, что частота обнаружения ВПЧ18 составляет 44%, а уровень обнаружения ВПЧ16 — 22%. В исследовании 91 рака полости рта у населения Индии Balaram et al. (28) сообщили о частоте обнаружения HPV16 и HPV18 42% и 47% соответственно. Оба исследования также показывают различное распределение типов HPV16 и HPV18 по сравнению с нашим исследованием и другими исследованиями, опубликованными в Северной Америке (22 , 23 , 29) .

    В соответствии с другими отчетами, мы также обнаружили сильную связь присутствия ВПЧ с ротоглоточным участком. В 52% опухолей ротоглотки обнаруживается ВПЧ16. Более того, 64% карциномы миндалин содержали ВПЧ16. Опухоли ротоглотки ранее были связаны с 13–57% ВПЧ-положительных опухолей (22 , 30, 31, 32) .Кроме того, 21–100% образцов плоскоклеточного рака миндалин оказались положительными на ВПЧ16, ВПЧ18 или ВПЧ33 (17 , 22 , 32, 33, 34, 35) . Напротив, наличие ВПЧ опухолей полости рта регистрируется у 12–71% (22 , 30, 31, 32 , 36, 37, 38, 39) и в гортани 4–24% (27 , 31, 32, 33) . В нашем исследовании 5% опухолей полости рта содержали ВПЧ16. Эти результаты убедительно подтверждают анатомическое предпочтение инфекции HPV16 и согласуются с литературными данными (15 , 22 , 30, 31, 32, 33 , 40) .

    Наши пациенты с HPV16, обнаруживаемым в их опухолях, с большей вероятностью были моложе 59 лет по сравнению с теми, кто не имел вируса. Эта связь была замечена в модели логистической регрессии, учитывающей пол, количество лет в упаковке и употребление алкоголя. Cruz et al. (37) также сообщили о связи молодого возраста пациентов с наличием ВПЧ. Учетные записи различаются, но, по-видимому, существует общая тенденция к обнаружению ВПЧ у пациентов младше 60 лет (19). .Даже в тех исследованиях, которые не обнаружили значительного влияния возраста, сообщалось о точечных оценках среднего и медианного возраста моложе в их ВПЧ-положительной группе. Например, в исследовании 14 молодых и 18 пожилых пациентов с HNSCC, Sisk et al. (41) сообщают, что риск инфицирования ВПЧ выше на 1,25% (95% ДИ = 0,3, 5,1) среди более молодого населения. Gillison et al. (22) изучили 253 опухоли HNSCC и сообщили, что средний возраст среди ВПЧ-положительной группы составлял 60,5 лет по сравнению с 64 годами в ВПЧ-отрицательной группе.В свете роста заболеваемости раком миндалин и полости рта у молодых людей (5) , HPV может представлять собой важный этиологический фактор у этих пациентов.

    В нашем исследовании ни у одной из групп с ВПЧ16 не развился рецидив заболевания, и только один (5,6%) умер от болезни. Напротив, у 31% пациентов в группе с отрицательным результатом на ВПЧ развился рецидив, а 46% умерли от болезни. Этот вывод согласуется с данными Schwartz et al. (23) которые сообщили, что у HPV16-положительных пациентов в целом значительно снизилось (HR = 0.35) и смертность от болезней (HR = 0,17). Gillison et al. (22) сообщили, что у пациентов с ВПЧ-положительными опухолями риск смерти от рака снизился на 59% по сравнению с ВПЧ-отрицательной группой (HR = 0,41). Эти наблюдения могут повлиять на будущее клиническое ведение и в значительной степени заслуживают дополнительного исследования.

    Присутствие

    HPV16 было связано с потреблением <3 алкогольных напитков в день. Предыдущие исследования также показывают тенденцию к ассоциации HPV16 с меньшим потреблением алкоголя.Gillison et al. (22) также обнаружили, что ВПЧ-положительные опухоли реже встречаются у лиц, употребляющих алкоголь от умеренного до тяжелого (OR = 0,17; 95% CI = 0,05–0,61) и курильщиков (OR = 0,16; 95% CI = 0,02–1,4). Portugal et al. (42) в своем исследовании 58 рака полости рта и 42 рака миндалин обнаружили, что наличие ВПЧ предсказывает более низкий уровень потребления алкоголя и табака ( P = 0,09). После отбора пациентов с коэкспрессией мутантного p53 они обнаружили, что экспрессия ВПЧ сильнее связана с легким употреблением алкоголя ( P = 0.04).

    Онкогенные ВПЧ, частично или полностью блокируя функцию белка-супрессора опухоли, вероятно, устраняют необходимость в обширном воздействии канцерогенов, которое может (у неинфицированных людей) привести к мутации или делеции генов p53 и pRb . Также вероятно, что местная инфекция HPV16 может не производить широко распространенное поле клеток с измененными функциями p53 и pRb. В этом случае у субъектов, инфицированных ВПЧ16, будет меньше шансов на развитие рецидивов, чем у ВПЧ-отрицательной группы, в которой канцерогены произвели широкое поле мутантных предшественников.Наконец, если бы белки E6 и E7 только частично или временно блокировали супрессию опухоли p53, можно было бы ожидать лучшего ответа на лечение и клинических исходов у HPV16-позитивных лиц.

    В нашем исследовании 82% опухолей, положительных по отношению к ВПЧ16, возникли у мужчин. Предыдущие исследователи не обнаружили никакой связи между наличием ВПЧ и полом (22 , 33) или более высокий процент у мужчин (37 , 39) . Однако вероятность развития рака полости рта и ротоглотки у мужчин в три раза выше, чем у женщин.Premoli-De-Percoco et al. (43) изучили женщин с плоскоклеточным раком полости рта и обнаружили высокий процент образцов, положительных на ВПЧ (70%). Интересно, что в 23 случаях с положительной реакцией на ВПЧ тот же тип ВПЧ наблюдался в слизистой оболочке шейки матки пациента. Небольшой размер выборки и меньшее количество женщин-субъектов могут ограничить возможности нашего исследования и предыдущих отчетов по выявлению гендерных различий в ВПЧ-инфекции.

    В нашем исследовании мы обнаружили, что наличие HPV16 не было существенно связано с клинической стадией, размером опухоли или узловым статусом.В предыдущих исследованиях аналогичным образом сообщалось, что клиническая стадия и статус TNM не связаны с наличием ВПЧ (38 , 44) . Однако большинство серий не включают большие доли опухолей на ранних стадиях, что дает мало возможностей для выявления небольшой ассоциации стадии или статуса TNM с инфекцией ВПЧ. Наша серия, в которой> 81% опухолей классифицируются как стадия III или стадия IV, также включает преимущественно большие опухоли. Следовательно, мы не можем исключить небольшую связь клинической стадии или статуса TNM с наличием ВПЧ.

    Таким образом, наше исследование показало, что уровень обнаружения HPV16 составляет 20% у 89 пациентов с HNSCC. Орофарингеальный участок и более молодой возраст пациента были сильно связаны с наличием ВПЧ16. Кроме того, меньшее употребление алкоголя было значительно связано с инфекцией ВПЧ16. Пациенты с ВПЧ-16-позитивными опухолями имели лучшую общую и специфическую выживаемость по сравнению с ВПЧ-негативной группой. Хотя это и не является окончательным, наши результаты предполагают отчетливую картину рака головы и шеи у пациентов с инфекцией ВПЧ16.

    Благодарности

    Мы благодарим Ян Сюй за помощь в программировании.

    Сноски

    • Расходы на публикацию этой статьи были частично покрыты за счет оплаты страницы. Таким образом, данная статья должна быть помечена как реклама в соответствии с 18 U.S.C. Раздел 1734 исключительно для указания этого факта.

    • ↵1 Это исследование было поддержано грантами NIH CA78609 и ES00002.

    • ↵2. Кому следует обращаться с просьбами о перепечатке, в Департамент биологии раковых клеток Гарвардской школы общественного здравоохранения, 665 Хантингтон-авеню, здание 1, комната 207, Бостон, Массачусетс 02115-6021. Телефон: (617) 432-3313. Факс: (617) 432-0107; Эл. Почта: kelsey {at} hsph.harvard.edu

    • ↵3 Используемые сокращения: HNSCC — плоскоклеточный рак головы и шеи; ВПЧ, вирус папилломы человека; ВПЧ16, ВПЧ 16 типа; HPV18, HPV типа 18; TNM, размер опухоли, наличие узлов и классификация стадий метастазов; HR — отношение рисков в регрессионной модели пропорциональных рисков Кокса; ИЛИ — отношение шансов; ДИ — доверительный интервал; Е6, ранний ген-6 генома ВПЧ; Е7, ранний ген-7 генома ВПЧ; р53, белок-супрессор опухолей 53; pRB, белок ретинобластомы; L1, поздний ген-1 генома ВПЧ; пачка-лет — количество выкуриваемых пачек сигарет в день, умноженное на количество лет, в течение которых субъект выкуривает.

    • Получено 1 февраля 2002 г.
    • Исправление получено 19 июня 2002 г.
    • Принято 24 июня 2002 г.

    Ссылки

    1. Ферлей, Дж., Брей, Ф., Пизани, П. и Паркин, Д. М. Глобокан, 2000: Заболеваемость, смертность и распространенность рака во всем мире, версия 1.0., IARC CancerBase No. 5, издание 2001, Vol. 2001. Лион, Франция: IARC Press, 2000.

    2. Шанкаранараян Р., Масуйер Э., Сваминатан Р., Ферли Дж., Уилан С. Рак головы и шеи: глобальная перспектива эпидемиологии и прогноза. Anticancer Res., 18 : 4779-4786, 1998.

    3. Хоффман Х. Т., Карнелл Л. Х., Функ Г. Ф., Робинсон Р. А., Менк Х. Р. Отчет национальной базы данных по раку по раку головы и шеи. Arch. Отоларингол. Head Neck Surg., 124 : 951-962, 1998.

      .
    4. Гиллисон М.Л., Шах К. В. Плоскоклеточная карцинома головы и шеи, связанная с вирусом папилломы человека: растущие доказательства этиологической роли вируса папилломы человека в подгруппе рака головы и шеи. Curr. Opin. Онкол., 13 : 183-188, 2001.

    5. Майерс Дж. Н., Элкинс Т., Робертс Д., Байерс Р. М. Плоскоклеточный рак языка у молодых людей: рост заболеваемости и факторы, предсказывающие результаты лечения. Отоларингол. Head Neck Surg., 122 : 44-51, 2000.

    6. Кох В. М., Ланго М., Сьюэлл Д., Захурак М., Сидрански Д. Рак головы и шеи у некурящих: отдельная клиническая и молекулярная сущность. Ларингоскоп, 109 : 1544-1551, 1999.

    7. Вершуур Х. П., Айриш Дж. К., О’Салливан Б., Гох К., Гуллейн П. Дж., Пинтили М. Сравнительное контрольное исследование результатов лечения молодых пациентов с плоскоклеточным раком головы и шеи.Ларингоскоп, 109 : 249-258, 1999.

    8. Mendez P., Maves M. D., Panje W. R. Плоскоклеточный рак головы и шеи у пациентов в возрасте до 40 лет. Arch. Отоларингол. Head Neck Surg., 111 : 762-764, 1985.

    9. Walboomers J. M. M., Jacobs M. V., Manos M. M., Bosch F. X., Kummer J. A., Shah K. V., Snijders P. J. F., Peto J., Meijer C. J. L.М., Муньос Н. Вирус папилломы человека — необходимая причина инвазивного рака шейки матки во всем мире. J. Pathol., 189 : 12-19, 1999.

    10. zur Hausen H. Папилломавирусы, вызывающие рак: уклонение от контроля клеток-хозяев на ранних этапах канцерогенеза. J. Natl. Cancer Inst. (Bethesda), 92 : 690-698, 2000.

    11. Bjørge T., Hennig E. M., Skare G. B., Søreide O., Торесен С. Ø. Вторичный первичный рак у пациентов с карциномой in situ шейки матки. Норвежский опыт 1970–1992 гг. Int. J. Cancer, 62 : 29-33, 1995.

    12. Рабкин С. С., Биггар Р. Дж., Мелби М., Кертис Р. Э. Вторичные первичные злокачественные опухоли после карциномы анального канала и шейки матки: доказательства общих этиологических факторов. Являюсь. J. Epidemiol., 136 : 54-58, 1992.

    13. Лёнинг Т., Икенберг Х., Беккер Дж., Гиссман Л., Хёпфер И., Цур Хаузен Х. Анализ оральных папиллом, лейкоплакий и инвазивных карцином на ДНК, относящуюся к типу вируса папилломы человека. J. Investig. Dermatol., 84 : 417-420, 1985.

    14. van Houten VMM, Snijders PJF, van den Brekel MWM, Kummer JA, Meijer CJLM, van Leeuwen B., Denkers F., Smeele LE, Snow GB, Brakenhoff RH Биологические доказательства того, что вирусы папилломы человека этиологически вовлечены в подгруппу головы и плоскоклеточный рак шеи.Int. J. Cancer, 93 : 232-235, 2001.

    15. Zumbach K., Hoffman M., Kahn T., Bosch F., Gottschlich S., Görögh T., Rudert H., Pawlita M. Антитела к онкопротеинам E6 и E7 вируса папилломы человека 16 и 18 типов у пациентов с головной плоскоклеточный рак шеи. Int. J. Cancer, 85 : 815-818, 2000.

    16. Андл Т., Кан Т., Пфул А., Никола Т., Erber R., Conradt C., Klein W., Helbig M., Dietz A., Weidauer H., Bosch F. X. Этиологическое участие онкогенного вируса папилломы человека в плоскоклеточных карциномах миндалин без контроля клеточного цикла ретинобластомы. Cancer Res., 58 : 5-13, 1998.

    17. Wilczynski S.P., Lin B.T-Y., Xie Y., Paz I.B. Обнаружение ДНК вируса папилломы человека и сверхэкспрессия онкопротеина связаны с различными морфологическими паттернами плоскоклеточного рака миндалин.Являюсь. J. Pathol., 152 : 145-156, 1998.

    18. Миллер С., Джонстон Б. М. Вирус папилломы человека как фактор риска плоскоклеточного рака полости рта: метаанализ, 1982–1997. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod., 91 : 622-635, 2001.

    19. Маккейг Р. Г., Барик Р. С., Ольшан А. Ф. Вирус папилломы человека и рак головы и шеи: эпидемиология и молекулярная биология.Голова Шея, 20 : 250-265, 1998.

    20. Харниш Д. Г., Белланд Л. М., Шейд Э., Рохан Т. Е. Оценка консенсусных праймеров вируса папилломы человека для обнаружения ВПЧ с помощью полимеразной цепной реакции. Мол. Клетка. Probes, 13 : 9-21, 1999.

    21. Херрингтон С. С., Андерсон С. М., Бауэр Х. М., Тронконе Б., де Анжелис М. Л., Ноелл Х., Химера Дж. А., Ван Эйк С.L., McGee J. O’D. Сравнительный анализ обнаружения вируса папилломы человека с помощью ПЦР и неизотопной гибридизации in situ с . J. Clin. Патол. (Лондон), 48 : 415-419, 1995.

    22. Gillison ML, Koch WM, Capone RB, Spafford M., Westra WH, Wu L., Zahurak ML, Daniel RW, Viglione M., Symer DE, Shah KV, Sidransky D. Доказательства случайной связи между вирусом папилломы человека и разновидность рака головы и шеи.J. Natl. Cancer Inst. (Bethesda), 92 : 709-720, 2000.

    23. Шварц С. Р., Юэ Б., Макдугалл Дж. К., Далинг Дж. Р., Шварц С. М. Инфекция вируса папилломы человека и выживаемость при плоскоклеточной карциноме полости рта: популяционное исследование. Отоларингол. Head Neck Surg., 125 : 1-9, 2001.

      .
    24. Собин Л. Х., Виттекинд К. UICC, Международный союз борьбы с раком TNM Классификация злокачественных опухолей Под ред.5 Wiley-Liss, Inc., Нью-Йорк, 1997.

    25. Тинг Ю., Манос М. М. Обнаружение и типирование генитальных вирусов папилломы человека Innis М. А. Гельфанд Д. Х. Снински Дж. Дж. Уайт Т. Дж. Ред. . Протоколы ПЦР: Руководство по методам и приложениям, Academic Press, Сан-Диего, Калифорния, 1990.

    26. Бернард Х.-У., Чан С.-Й., Манос М. М., Онг С. К., Вилла Л. Л., Делиус Х., Пейтон К. Л., Бауэр Х. М., Уиллер К.М. Идентификация и оценка известных и новых вирусов папилломы человека с помощью амплификации полимеразной цепной реакции, полиморфизма длины рестрикционных фрагментов, нуклеотидной последовательности и филогенетических алгоритмов. J. Infect. Дис., 170 : 1077-1085, 1994.

    27. Nishioka S., Fukushima K., Nishizaki K., Gunduz M., Tominaga S., Fukazawa M., Monden N., Watanage S., Masuda Y., Ogura H. Вирус папилломы человека как фактор риска для головы и рак шеи: исследование случай-контроль.Acta Otolaryngol. Дополнение (Stockh.), 540 : 77-80, 1999.

    28. Баларам П., Налинакумари К. Р., Абрахам Э., Балан А., Хариендран Н. К., Бернард Х-У., Чан С.-Й. Вирусы папилломы человека в 91 раке полости рта у индийских жевателей бетель-квид — высокая распространенность и множественность инфекций. Int. J. Cancer, 61 : 450-454, 1995.

      .
    29. Смит Э. М., Хоффман Х. Т., Саммерсгилл К.С., Киршнер Х. С., Турек Л. П., Хауген Т. Х. Вирус папилломы человека и риск рака полости рта. Ларингоскоп, 108 : 1098-1103, 1998.

    30. Mork J., Lie AK, Glattre E., Hallmans G., Jellum E., Koskela P., Møller B., Pukkala E., Schiller JT, Youngman L., Lehtinen M., Dillner J. Папилломавирусная инфекция человека как фактор риска плоскоклеточного рака головы и шеи. N. Engl. J. Med., 344 : 1125-1131, 2001.

    31. Франчески С., Муньос Н., Бош X. Ф., Снейдерс П. Ф. Дж., Уолблумерс Дж. М. М. Вирус папилломы человека и рак верхних отделов пищеварительного тракта: обзор эпидемиологических и экспериментальных данных. Cancer Epidemiol. Биомарк. Пред., 5 : 567-575, 1996.

    32. Брандсма Дж. Л., Абрамсон А. Л. Ассоциация вируса папилломы с раком головы и шеи. Arch.Отоларингол. Head Neck Surg., 115 : 621-625, 1989.

    33. Паз И. Б., Кук Н., Одом-Марион Т., Се Ю., Вильчински С. П. Вирус папилломы человека (ВПЧ) при раке головы и шеи. Связь ВПЧ 16 с плоскоклеточным раком миндалин Вальдейера. Cancer (Phila.), 79 : 595-604, 1997.

      .
    34. Снайдерс П. Дж. Ф., Кромм Ф. В., ван ден Брюле А. Дж. К., Schrinjnemakers H. F. J., Snow G. B., Meijer C. J. L. M., Walboomers J. M. M. Распространенность и экспрессия вируса папилломы человека в карциномах миндалин, что указывает на возможную вирусную этиологию. Int. J. Cancer, 51 : 845-850, 1992.

    35. Niedobitek G., Pitteroff S., Herbst H., Sheperd P., Finn T., Anagnostopoulos I., Stein H. Обнаружение ДНК вируса папилломы человека типа 16 в карциномах небной миндалины. J. Clin. Патол. (Лондон.), 43 : 918-921, 1990.

    36. Schwartz SM, Daling JR, Doody DR, Wipf GC, Carter JJ, Madeleine MM, Mao EJ., Fitzgibbons ED, Huang S., Beckmann AM, McDougall JK, Galloway DA Риск рака полости рта в связи с сексуальным анамнезом и доказательствами папилломавирусная инфекция. J. Natl. Cancer Inst. (Bethesda), 90 : 1626-1636, 1998.

    37. Круз И.Б. Ф., Снайдерс П. Дж. Ф., Стинберген Р. Д. М., Мейер К. Дж. Л. М., Сноу Г. Б., Уолблумерс Дж. М. М., Ван дер Вааль И. Возрастная зависимость присутствия ДНК вируса папилломы человека в плоскоклеточных карциномах полости рта. Евро. J. Cancer B Oral Oncol., 32B : 55-62, 1996.

    38. Brandwein M., Zeitlin J., Nuovo G. J., MacConnell P., Urken M., Biller H. Обнаружение ВПЧ с использованием полимеразной цепной реакции «горячего старта» у пациентов с раком полости рта: клинико-патологическое исследование с участием 64 пациентов.Мод. Pathol., 7 : 720-727, 1994.

    39. Миллер С., Зейсс М. С., Уайт Д. К. Обнаружение ДНК ВПЧ в карциноме полости рта с использованием полимеразной цепной реакции вместе с гибридизацией in situ и . Oral Surg. Oral Med. Oral Pathol., 77 : 480-486, 1994.

      .
    40. Fouret P., Monceaux G., Temam S., Lacourreye L., Lacau-St Guily J. Вирус папилломы человека при плоскоклеточном раке головы и шеи у некурящих.Arch. Отоларингол. Head Neck Surg., 123 : 513-516, 1997.

    41. Sisk EA, Bradford CR, Jacob A., Yian CH, Staton KM, Tang G., Harris MO, Carey TE, Lancaster WD, Gregoire L. Инфекция вируса папилломы человека у «молодых» и «старых» пациентов с плоскоклеточной карциномой головы и шеи. Голова Шея, 22 : 649-657, 2000.

    42. Португалия L.Г., Гольденберг Дж. Д., Вениг Б. Л., Феррер К. Т., Нодзенски Э., Сабнани Дж. Б., Хавьер К., Вейксельбаум Р. Р., Вокс Э. Э. Экспрессия вируса папилломы человека и мутации гена p53 при плоскоклеточной карциноме. Arch. Отоларингол. Head Neck Surg., 123 : 1230-1234, 1997.

    43. Премоли-Де-Перкоко Г., Рамирес Дж. Л., Галиндо И. Корреляция между типами ВПЧ, связанными с плоскоклеточным раком полости рта, и цитологией шейки матки.Исследование гибридизации in situ и . Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod., 86 : 77-81, 1998.

    44. Снайдерс П. Дж. Ф., Скоулз А. Г. М., Харт С. А., Джонс А. С., Воган Э. Д., Вулгар Дж. А., Мейер К. Дж. Л. М., Уолблумерс Дж. М. М., Филд Дж. К. Распространенность мукозотропных вирусов папилломы человека в плоскоклеточных карциномах головы и шеи. Int. J. Cancer, 66 : 464-469, 1996.

    ACCURUN® серии 381 мРНК ВПЧ типа 16 и 18 Положительный контроль 20 x 1.0 мл

    Контрольные и стандартные образцы

    Номер материала 2025-0060

    Размер 20 x 1,0 мл

    Статус инвентаря В наличии

    Ед. изм EA

    Положительный контроль на мРНК ВПЧ

    ACCURUN 381 типа 16 и 18 разработан для использования с диагностическими тестами in vitro и , которые обнаруживают мРНК ВПЧ в образцах шейки матки человека.Этот продукт производится из культивируемых человеческих клеток, инфицированных ВПЧ типа 16 или 18, которые интегрированы в клеточный геном. Клетки несут мРНК, транскрибируемую с вирусных генов, и хранятся в забуференном растворе метанола. Контроль «готов к использованию» в анализах, которые определяют мРНК ВПЧ высокого риска вирусных генов E6 и E7.

    ACCURUN 381

    • Может помочь вам контролировать анализ мРНК ВПЧ 16 и 18 типов с помощью надежного источника положительного материала;
    • Обеспечивает дополнительную уверенность в результатах тестирования вашей лаборатории.
    • Постоянный и надежный источник положительных материалов; помогает соблюдать нормативные требования.
    • Включенные аналиты: мРНК ВПЧ 16 и 18

    ACCURUN Молекулярные средства контроля используются во многих лабораториях мирового класса для обеспечения эффективности анализа. Для использования in vitro в диагностике . Нормативный статус: IVD, CE

    Номер ссылки: A381

    ACCURUN 381 мРНК ВПЧ типов 16 и 18 Положительный контроль

    ACCURUN 381 мРНК ВПЧ типов 16 и 18 Положительный контроль

    ACCURUN 381 мРНК ВПЧ типов 16 и 18 Положительный контроль

    ACCURUN SDS-ACRN-08

    Тип документа

    Паспорт безопасности

    ACCURUN 381 Положительный контроль мРНК ВПЧ 16 и 18

    ACCURUN 381 мРНК ВПЧ типов 16 и 18 Положительный контроль

    ACCURUN 381 Положительный контроль мРНК ВПЧ 16 и 18

    ACCURUN 381 мРНК ВПЧ типов 16 и 18 Положительный контроль

    Вирус папилломы человека 16 типа блокирует рост естественных клеток-киллеров при ранних поражениях шейки матки

    Механизм патогенеза вируса папилломы человека (ВПЧ) в шейке матки интенсивно исследовался.Однако подробные различия в распределении и функции клеток врожденного иммунитета между типами ВПЧ высокого риска, особенно во время фазы хронического воспаления, полностью не описаны. В этом исследовании результаты гистологической патологии 245 женщин только с ВПЧ типа 16 (ВПЧ 16 + ) или только типа 18 (ВПЧ 18 + ) были проанализированы ретроспективно с января 2015 года по ноябрь 2016 года. Более серьезные поражения шейки матки наблюдались в HPV16 + женщин по сравнению с HPV18 + женщин.В общей сложности с декабря 2016 по декабрь 2018 года у женщин, страдающих хроническим воспалением, HPV16 + или HPV18 + , было собрано 212 образцов цервикальной щетки. Анализ проточной цитометрии показал, что в большом количестве были обнаружены NK-клетки вместе с аберрантными Treg-клетками. Шейка матки, инфицированная ВПЧ16. Количественная ПЦР в реальном времени продемонстрировала, что более высокие уровни экспрессии IFN- γ , но приглушенная экспрессия IL-2 и KLRG-1 была обнаружена в шейке матки пациентов с HPV16 + по сравнению с HPV18 + , что было дополнительно подтверждено с помощью 20 парафиновых срезов ткани шейки матки.Эксперимент по цитотоксичности ex vivo показал, что цитотоксичность NK-клеток была значительно снижена в шейке матки пациентов с ВПЧ16 + по сравнению с таковой у пациентов с ВПЧ 18 + . В совокупности наши результаты предполагают, что HPV16 отключает увеличение количества NK-клеток в раннем поражении шейки матки, что указывает на то, что местная иммунная система шейки матки гипореактивна к инфекции HPV16, и это может объяснить ее склонность к злокачественной трансформации.

    1. Введение

    По последним данным, иммунной системе большинства людей, инфицированных ВПЧ, требуется не менее трех лет для уничтожения вируса.Помимо неадекватного гуморального иммунного ответа, подавление иммунных клеток в местной цервикальной среде является еще одной важной причиной этой статистики [1]. ВПЧ проникает в плоский эпителий влагалища, а также в недифференцированные базальные клетки в переходной зоне эпителия цервикального канала [2]. К настоящему времени идентифицировано более 100 типов ВПЧ, среди которых 15 типов (например, ВПЧ типов 16, 18, 31 и 45) считаются типами высокого риска, которые с большей вероятностью могут быть канцерогенными [3]. Недавнее всестороннее исследование во всем мире показало, что до половины случаев заболевания шейкой матки вызывается ВПЧ типа 16 (ВПЧ16), а вместе взятые ВПЧ16 и ВПЧ 18 (ВПЧ18) составляют до 80% [4, 5].

    Исследования предоставили убедительные доказательства молекулярных механизмов, с помощью которых ВПЧ проникает в местные иммунные клетки. NK-клетки являются важными биологическими барьерами, которые находятся в шейке матки. Они могут быстро идентифицировать инфицированные вирусом или трансформированные вирусом клетки с помощью путей, не требующих пресенсибилизации, и убивать их. Сообщалось, что NK-клетки появляются на ранней стадии в поражениях, инфицированных ВПЧ [6]. Однако ВПЧ может заставить активировать NK-клетки к утрате своих мембранных рецепторов, что приведет к их нарушению, что может привести к канцерогенезу [7].Изменение соотношения CD4 + / CD8 + и маркерное увеличение количества Treg-клеток, которые являются репрезентативными иммунодепрессивными клетками, также были показаны в перекрестном взаимодействии между клетками рака шейки матки и вирусом [8, 9 ]. Тем не менее, до сих пор нет сообщений, посвященных профилям этих инфильтрированных иммунных клеток в тканях, инфицированных различными типами ВПЧ. Целью этого исследования было сравнить распределение и функциональный статус врожденных NK-клеток в ткани, инфицированной двумя типами ВПЧ высокого риска (16 и 18), и обсудить возможные механизмы исходной болезни ВПЧ с другой точки зрения.

    2. Материалы и методы
    2.1. Характеристики пациента

    Подходящие пациенты были замужними женщинами в возрасте от 25 до 65 лет без гистологически или цитологически подтвержденных других заболеваний репродуктивной системы (включая влагалище, матку и яичники), но только с хроническим воспалением шейки матки. Это исследование было санкционировано этическим комитетом Первой дочерней больницы Нанкинского медицинского университета (Нанкин, Китай).

    2.2. Сбор образцов

    Мы использовали зеркало, чтобы обнажить цервикальный канал, и когерентную массу ткани очистили с помощью ватного тампона.Шейную щетку вводили в цервикальный канал примерно на 1-1,5 см и осторожно вращали в том же направлении 5 раз. Затем шейную щетку медленно извлекали, а отслоившиеся клетки сохраняли в пробирке для сбора образцов Roche® для определения типа или в среде для культивирования клеток 1640, содержащей 10% FBS. В общей сложности с декабря 2016 года по декабрь 2018 года было собрано 212 образцов цервикальной щетки для анализа проточной цитометрии, определения цитотоксичности ex vivo и количественной ПЦР в реальном времени.

    2.3. Обнаружение ДНК ВПЧ и идентификация типа

    Обнаружение ДНК ВПЧ и идентификация типа были выполнены с использованием системы экстракции ядерной кислоты cobas® x480 и анализатора cobas® z480 с использованием набора для подготовки жидкой цитологии системы cobas® 4800 в соответствии с инструкциями производителя (Roche, США). ). Образцы с HPV16 или HPV18, соответственно, сохранялись как группа HPV16 + или группа HPV18 + . В качестве контроля использовали образцы, полученные от женщин с хроническим воспалением и отрицательных на ВПЧ.

    2.4. Сортировка клеток с активацией флуоресценции (FACS)

    Сохраненные образцы трижды промывали PBS перед тем, как дважды пропустить через сетчатый фильтр 40 мкм мкм (STEMCELL Technologies, Канада). Оставшиеся клетки конъюгировали с CD3, CD4, CD56 / CD16 (Beckman Coulter) и антителами к CD16 или CD25 в комбинации (Biolegend, США) и подвергали проточной цитометрии (CD56 / 16 с Beckman, другие с BD FACSCalibur, США). Результаты FACS показывают процентное содержание каждого указанного типа иммунных клеток.

    2,5. Экстракция РНК и количественная ПЦР в реальном времени

    Суммарную РНК образцов цервикальной щетки экстрагировали с использованием реагента TRIzol (Grand Island, США) в соответствии с инструкциями производителя. Двадцать парафиновых срезов ткани конизации шейки матки подвергали количественной ПЦР в реальном времени. Неокрашенные срезы депарафинизировали с использованием стандартной процедуры ксилола и этанола. РНК экстрагировали с использованием наборов RNeasy FFPE (QIAGEN) в соответствии с инструкциями производителя.

    Реакцию обратной транскрипции с 1 мкл г матрицы РНК проводили с использованием набора для синтеза первой цепи кДНК (TOYOBO, Япония). Количественную ПЦР в реальном времени проводили с использованием SYBR Green Real-time PCR Master Mix (TOYOBO, Япония) и детектировали с помощью системы ПЦР в реальном времени LightCycler 480 II (Roche, США). Уровень экспрессии анализировали и нормализовали до β -актина в образцах кДНК. Кратность изменения экспрессии гена рассчитывали с использованием метода 2 -ΔΔCT .Последовательности праймеров перечислены в Таблице 1.

    + + + + 91 024 + + + + + + Р: agcttaaactctagtctttgg
    + 91 028 β-актина Р: ctcaggaggagcaatgatcttg +
    91 028

    Название гена Праймер

    IFN- γ 5ggtg 910ag30 910ag30 : cgacagttcagccatcactt

    Ил-2 F: gccacagaactgaaacatct
    Р: gccttacctttagttccagaa

    IL-6 F: agatttgagagtagtgaggaa
    Р: actgtctttgagcctgtctt
    +
    GM-CSF F: gccactacaagcagcactg
    Р: tgtctgcctcctctctgga
    +
    CCL-3 F: taactcttcctcccttctcc
    Р: tggacccctcaggcactca

    CCL-5 F: atcctccctcttcttctcct
    R: ttcaggttcaaggactctcc
    +
    KLRG-1 F: tcaactccttttctgtgcatg
    R: catctatcaaagtctgacctt

    CD56 F: atgatgggtgaagagaaccg
    R: aatgagatgtgtgtgtgtgc

    CD27 F: gccttcagatgtgccctat
    R: cagtgggtagagagagtcc

    DNAM-1 F : gaagtcccatctctaccagt
    +
    +
    F: tcatgaagtgtgacgtggacat
    +
    2.6.
    Ex vivo Эксперименты по цитотоксичности иммунных клеток

    Клетки линии рака шейки матки HeLa метили CFSE (0,5 мк M, Invitrogen). CD56 + NK-клетки CD16 + были выделены из образцов цервикальной кисти женщин, инфицированных HPV16 или HPV18, с помощью FACS (BD FACSAria II, США). NK-клетки совместно культивировали с CFSE-HeLa в определенных соотношениях в 24-луночных планшетах и ​​инкубировали при 37 ° C в инкубаторе в течение 4-6 часов. Клетки собирали, окрашивали 7-AAD (BD Pharmingen, США) и подвергали проточной цитометрии (BD FACSCalibur, США).Данные анализировали с помощью программного обеспечения FlowJo 6.0 (Tree Star).

    2.7. Статистический анализ

    Статистический анализ выполняли с использованием PRISM 7.01 (GraphPad Software Inc., Сан-Диего, Калифорния). Данные представлены как. Все данные были проанализированы с использованием критерия Стьюдента, который считался статистически значимым. Поправка Бонферрони использовалась для множественных сравнений.

    3. Результаты
    3.1. Общие профили гистологической патологии женщин, инфицированных ВПЧ

    Мы ретроспективно проанализировали результаты гистологической патологии 245 женщин, инфицированных ВПЧ16 или ВПЧ18, с января 2015 года по ноябрь 2016 года.Как показано в таблице 2, более тяжелые поражения (≥CIN 2) были статистически представлены у женщин с инфекцией HPV16 по сравнению с женщинами HPV18 + .

    Возраст (средний) ) 0.

    Характеристики HPV16 + HPV18 + значение

    930 0, средний возраст (1025
    Гистологический диагноз <0.0001
    Воспаление 54 (26,6) 27 (64,3)
    CIN 1 22 (10,8) 8 (19,0) CIN 14,3) 3 (7,1)
    CIN 3 98 (48,3) 4 (9,5)
    Всего 203 4210910

    CIN: цервикальная интраэпителиальная неоплазия; ВПЧ: вирус папилломы человека.

    3.2. Инфильтрация NK-клеток в шейку матки, инфицированную ВПЧ16

    И ВПЧ16, и ВПЧ18 относятся к типам ВПЧ высокого риска, которые с высокой вероятностью могут вызвать инвазивную карциному шейки матки. Мы задавались вопросом, были ли шаблоны распределения CD56 + CD16 + , представляющие NK-клетки, подобными между этими двумя типами вирусов. Всего было собрано 48 образцов цервикальной щетки, включая 16 контрольных пациентов с хроническим воспалением, 16 случаев HPV16 + и 16 случаев HPV18 + .Как показано на Фигуре 1 (а), по сравнению с контролем хронического воспаления, NK-клетки CD56 + , CD16 + были активированы как на шейных поверхностях HPV16 + , так и на HPV18 + . Интересно, что это соотношение было даже больше в группе HPV16 + , чем в группе HPV18 + (CD56 + CD16 + NK-клетки против;). Исследование мазка клеток также показало относительно высокую плотность NK-клеток, подобных жареному яйцу, в группе HPV16 + .

    Вторая партия образцов цервикальной щетки состояла из 25 контрольных образцов хронического воспаления, 22 случаев HPV16 + и 15 случаев HPV18 + , которые были собраны для оценки шести растворимых цитокинов, которые представляли иммунный статус, связанный с NK-клетками, в шейном отделе матки. микросреда. Как показано на Фигуре 1 (b), уровень транскрипции IFN- γ был относительно выше в группе HPV16 + , чем в группе HPV18 + , что согласуется с повышенным количеством местных NK-клеток.Но, несмотря на вирусные типы, инфекция HPV вызвала тенденцию к снижению транскрипции IFN- γ на шейной поверхности. IL-2 является важным цитокином при микробной инфекции и связывает врожденную и адаптивную иммунные системы организма. Мы обнаружили, что уровни IL-2 были значительно ниже в группе HPV16 + , что указывает на то, что местный иммунный ответ не может быть дополнительно стимулирован вирусной инфекцией. Напротив, инфекция HPV18 могла. Другие протестированные цитокины, такие как IL-4, GM-CSF, CCL-3 и CCL-5, не показали значительной разницы между инфекциями двумя типами HPV.Чтобы проверить эти изменения в образцах цервикальной щетки, мы снова обследовали женщин, которым был поставлен патологический диагноз хронического воспаления шейки матки, и собрали парафиновые срезы конизирующей ткани шейки матки у лиц, инфицированных ВПЧ16 (10 случаев) или ВПЧ18 (10 случаев). Как показано на Фигуре 1 (c), тенденции разницы в экспрессии IFN-, γ и IL-2 между двумя группами были идентичными. Взятые вместе, шейка матки HPV16 + характеризуется увеличенной популяцией NK-клеток и характерным микроокружением шейки матки.

    3.3. NK-клетки проявляют дискордированный эффект в шейке матки HPV16
    +

    Мы также протестировали четыре типичных клеточных мембранных маркера NK-клеток во второй партии образцов. KLRG-1 активируется в клетках, обозначенных как яркие NK-клетки, обладающие цитотоксическим эффектом. Но его экспрессия была тусклой в группе HPV16 + (рис. 2 (а)), что указывает на то, что он не реагирует, когда вирус созревает и переходит к следующему биологическому циклу на шейной поверхности. Этот результат был также подтвержден на парафиновых срезах (рис. 2 (б)).Уровни транскрипции CD56 обеих групп HPV были аналогичными или немного выше, чем в контроле (рис. 2 (а)). Это не согласуется с результатами исследований проточной цитометрии (рис. 1 (а)). Учитывая, что комбинированное антитело CD56 / CD16, используемое на рисунке 1, было разработано только для клинического использования, мы выбрали другое коммерческое антитело CD16. Анализ проточной цитометрии третьей партии образцов цервикальной щетки (16 случаев в каждой группе) показал, что клетки CD16 + были заметно увеличены в группе HPV16 + (HPV16 + vs.контроль и HPV18 + ; Рисунок 2 (в)).

    Treg-клетки играют важную роль в «самоконтроле» регуляторного иммунного ответа, и существует компромисс между ними и NK-клетками, которые, как полагают, вносят большой вклад в индуцированный ВПЧ канцерогенез [10]. Чтобы выяснить, означает ли повышенная инфильтрация NK-клеток рецессию Treg, с помощью проточной цитометрии было проанализировано 48 образцов цервикальной щетки. Как и ожидалось, соотношение клеток CD4 + CD25 + Treg в группе HPV16 + было самым низким среди трех групп (HPV16 + vs.контроль и HPV18 + ; Рисунок 2 (г)). Была определена цитотоксичность NK-клеток, экстрагированных из 3 женщин HPV16 + и 3 женщин HPV18 + . Как показано на рисунке 3, соотношение раковых клеток, меченных CFSE + 7-AAD + , не увеличивалось в дальнейшем, когда десятикратные ex vivo NK-клетки добавляли для сокультивирования, что указывает на то, что инфильтрированные NK-клетки не обладают эквивалентным действием. функция для устранения трансформированных клеток.


    4. Обсуждение

    Целью данного исследования было проспективное изучение закономерностей распределения инфильтрированных иммунных клеток, в частности NK-клеток, и микросреды шейной поверхности, инфицированных ВПЧ16 и ВПЧ18, и выявление возможных ВПЧ высокого риска. патогенетический механизм с новой точки зрения путем выделения функциональных несоответствий между этими двумя типами клеток.Мы обнаружили, что NK-клетки CD16 + были в изобилии в группе женщин с HPV16 + , у которых наблюдалась повышенная секреция IFN- γ . CD16 — это жизненно важный мембранный белок, обнаруженный на NK-клетках, который может индуцировать эндоцитоз HPV-VLP с последующей дегрануляцией и секрецией цитокинов (таких как IFN-γ и фактор некроза опухоли (TNF)) [6, 11]. Взаимодействие CD16 с NK-клетками приводит к активации его ADCC [12, 13]. Эти результаты предполагают, что индуцированный хроническим воспалением антителозависимый путь активен в цервикальных NK-клетках.

    Однако эти увеличенные NK-клетки все же не смогли устранить зрелый вирус HPV в условиях, когда Treg-клетки были ограничены локально. Вероятно, это происходит из-за неадекватной продукции IL-2, который, как сообщается, положительно регулирует цитотоксическую функцию NK-клеток и последующую дифференцировку [14], а также индуцированную вирусом экспрессию KLRG-1. KLRG-1 принадлежит к суперсемейству C-лектинов и, как известно, является ингибиторным рецептором NK-клеток. NK-клетки KLRG-1 хорошо пролиферируют, но у них отсутствует зрелый фенотип [15].Тем не менее, недавние исследования подчеркнули, что «образование NK-клеток», которое является частью их функциональной модификации, в основном осуществляется через сигнальный путь ITIM / SHP1 / SHP2 / SHIP [16]. KLRG-1 связан с рекрутированием SHIP, а нарушение KLRG / SHIP делает NK-клетки гипореактивными и необразованными [17, 18]. Поскольку эффекторные Т-клетки CD8 + также экспрессируют KLRG-1, мы не можем исключить роль истощенных Т-клеток CD8 + в шейке матки, инфицированной ВПЧ [19]. Мы также обнаружили, что инфекция ВПЧ снижает транскрипцию IFN- γ иммунными клетками, и это согласуется с другими исследованиями.Сообщалось, что продукты ранних генов, E6 и E7, регулируют локальную экспрессию цитокинов и хемокинов, например, подавление IFN- γ и других компонентов, связанных с путем передачи сигнала, против вирусной инфекции [20].

    Наше исследование имеет некоторые ограничения: (1) цитокины были протестированы с помощью количественной ПЦР в реальном времени, и это может быть проблематичным. Некоторые исследователи собирали жидкость с помощью цервиковагинального лаважа, чтобы обнаружить секреторные белки с помощью ELISA.Это возможно только в том случае, если предварительно исключить заболевания влагалища; (2) количество собранных образцов было небольшим. Мы включили женщин, инфицированных HPV16 или HPV18, но у значительной части женщин с HPV была комбинированная инфекция наряду с другими типами низкого риска. В частности, частота самого HPV18 была низкой в ​​Восточном Китае. Дальнейшая работа будет сосредоточена на оценке других цитокинов-кандидатов (которые в настоящем исследовании показали тенденцию к изменению, но не имели статистической значимости), таких как IL-6, GM-CSF, CCL-5 и мембранный белок DNAM-1 в ВПЧ. инфекционное заболевание; (3) при смешивании образцов для анализа проточной цитометрии, согласно исследованию Хуберта [21], количество NK-клеток в биоптатах шейки матки было слишком низким, чтобы их можно было подсчитать, и их можно было подсчитать только в строме.Поэтому 4 образца от разных пациентов были смешаны для получения образца для анализа проточной цитометрии. Каждую группу повторяли независимо четыре раза.

    Одна из вакцин против ВПЧ для профилактики рака шейки матки — Церварикс ™ — в настоящее время разрешена для использования в Европе и США. Он состоит из вирусных компонентов более позднего периода экспрессии генов, таких как продукт L1 HPV16 и HPV18 и адъювант AS04. Несмотря на то, что он оказывает определенное положительное влияние на предотвращение повторного заражения вирусом, его низкая концентрация в цервикальной среде по-прежнему является неприятной проблемой, и ее нельзя игнорировать.Что еще более важно, это далеко от лечения болезни [22]. Другим лекарственным средством, используемым против типов ВПЧ высокого риска в Канаде, является четырехвалентная вакцина против ВПЧ (Гардасил, Мерк), эффективность которой недавно была подтверждена на 30-50% против поражений, вызванных всеми типами ВПЧ [23]. За последнее десятилетие многие исследователи посвятили время и усилия разработке терапевтической вакцины. Некоторые из них добились удовлетворительных результатов на животных моделях, но эти вакцины все еще применяются в лабораторных условиях.Клинические наблюдения также показывают, что антитела у пациентов с хронической инфекцией в большинстве своем отрицательны. Следовательно, сомнительно, можно ли использовать гуморальный иммунный статус в качестве индикатора регресса какой-либо инфекции. Эффективность терапевтических вакцин тесно связана с ответом Т-клеток, секрецией цитокинов Th2, локальной инфильтрацией Т-клеток CD4 + и CD8 + и функцией NK-клеток в шейке матки [24]. Основываясь на этом исследовании, мы поднимаем еще один вопрос: будут ли такие терапевтические вакцины обладать одинаковой способностью убивать клетки рака шейки матки, ранее инфицированные HPV16 или HPV18? Мы считаем, что лекарственные препараты / вакцины, нацеленные на определенный тип ВПЧ, станут новым многообещающим направлением лечения ВПЧ.

    5. Выводы

    Таким образом, наши данные продемонстрировали, что количество NK-клеток было увеличено, но их цитотоксическая функция была аномальной в шейке матки, инфицированной ВПЧ16. Это первое исследование, подчеркивающее уникальные иммунные профили микросреды шейки матки между двумя типами ВПЧ высокого риска. Задействованные механизмы могут частично раскрыть причину, по которой HPV16 с наибольшей вероятностью вызывает рак шейки матки, и могут предоставить новые потенциальные стратегии для его клинического лечения.

    Сокращения
    5 9 Натуральные киллеры γ CCL 910G ITIM-иммунорецептор на основе ингибиторного мотива
    ВПЧ: Вирус папилломы человека
    CIN: Цервикальная интраэпителиальная неоплазия
    γ NK-клетки:
    IL: Интерлейкин
    GM-CSF: Гранулоцитарно-макрофагальный колониестимулирующий фактор
    CCL: 1igand
    CCL
    Член G подсемейства лектинподобных рецепторов киллерных клеток
    DNAM-1: Дополнительная молекула ДНКX-1
    ADCC: Антитело-зависимая клеточная цитотоксичность
    SHP: протеинтирозинфосфатаза, содержащая Sh3-домен
    SHIP: Инозитол-5-фосфатаза, содержащая Sh3-домен
    Treg: Регуляторные Т-клетки.
    Leave a Reply

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    2021 © Все права защищены.