Анемия мкб код 10: МКБ-10, D64, другие анемии

Содержание

МКБ-10: Класс III. Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный механизм

МКБ-10: Класс III. Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный механизм

Международная классификация болезней 10-го пересмотра (МКБ-10)

Класс I Некоторые инфекционные и паразитарные болезни
Класс II Новообразования
Класс III Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный механизм
Класс IV Болезни эндокринной системы, расстройства питания и нарушения обмена веществ
Класс V Психические расстройства и расстройства поведения
Класс VI Болезни нервной системы
Класс VII Болезни глаза и его придаточного аппарата
Класс VIII Болезни уха и сосцевидного отростка
Класс IX Болезни системы кровообращения
Класс X Болезни органов дыхания
Класс XI Болезни органов пищеварения
Класс XII Болезни кожи и подкожной клетчатки
Класс XIII Болезни костно-мышечной системы и соединительной ткани
Класс XIV Болезни мочеполовой системы
Класс XV Беременность, роды и послеродовой период
Класс XVI Отдельные состояния, возникающие в перинатальном периоде
Класс XVII Врожденные аномалии (пороки крови), деформации и хромосомные нарушения
Класс XVIII Симптомы, признаки и отклонения от нормы, выявленные при клинических и лабораторных исследованиях, не классифицированные в других рубриках
Класс XIX Травмы, отравления и некоторые другие последствия воздействия внешних причин
Класс XX Внешние причины заболеваемости и смертности
Класс XXI Факторы, влияющие на состояние здоровья населения и обращения в учреждения здравоохранения

Класс III.

Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный механизм (D50—D89)

D50—D53

Анемии, связанные с питанием

D55—D59

Анемии вследствие ферментных нарушений

D60—D64

Апластические и другие анемии

D65—D69

Нарушения свертываемости крови, пурпура и другие геморрагические состояния

D70—D77

Другие болезни крови и кроветворных органов

D80—D89

Отдельные нарушения, вовлекающие иммунный механизм

Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный механизм (D50 — D89)

Исключены: аутоиммунная болезнь (системная) БДУ (M35. 9)

болезнь, вызванная вирусом иммунодефицита человека ВИЧ (B20. — B24.)
врожденные аномалии (пороки развития), деформации и хромосомные нарушения (Q00. — Q99.)
новообразования (C00. — D48.)
осложнения беременности, родов и послеродового периода (O00. — O99.)
отдельные состояния, возникающие в перинатальном периоде (P00. — P96.)
симптомы, признаки и отклонения от нормы, выявленные при клинических и лабораторных исследованиях, не классифицированные в других рубриках (R00. — R99.)
травмы, отравления и некоторые другие последствия воздействия внешних причин (S00. — T98.)
эндокринные болезни, расстройства питания и нарушения обмена веществ (E00. — E90.).

Анемии, связанные с питанием (D50-D53)

  • D50. Железодефицитная анемия
    • Включены анемии: сидеропеническая и гипохромная
    • D50.0 Железодефицитная анемия вторичная вследствие потери крови (хроническая). Постгеморрагическая (хроническая) анемия
    • D50.1 Сидеропеническая дисфагия Синдром Келли — Патерсона, Синдром Пламмера — Винсона
    • D50.8 Другие железодефицитные анемии
    • D50.9 Железодефицитная анемия неуточненная
  • D51. Витамин-В12-дефицитная анемия.
    • Исключены: дефицит витамина В12 (E53.8)
    • D51.0 Витамин-В12-дефицитная анемия вследствие дефицита внутреннего фактора. Анемия Аддисона-Бирмера, Пернициозная Анемия(врожденная), Врожденная недостаточность внутреннего фактора
    • D51.1 Витамин-В12-дефицитная анемия вследствие избирательного нарушения всасывания витамина В12 с протеинурией. Синдром Имерслунд (- Гресбека), Мегалобластная наследственная анемия
    • D51.2 Дефицит транскобаламина II
    • D51.3 Другие витамин-В12-дефицитные анемии, связанные с питанием. Анемия вегетарианцев
    • D51.8 Другие витамин-ВI2-дефицитные анемии
    • D51.9 Витамин-В12-дефицитная анемия неуточненная
  • D52. Фолиеводефицитная анемия
    • D52. 0 Фолиеводефицитная анемия, связанная с питанием. Мегалобластная алиментарная анемия.
    • D52.1 Фолиеводефицитная анемия медикаментозная
    • D52.8 Другие фолиеводефицитные анемии
  • D52.9 Фолиеводефицитная анемия неуточненная. Анемия, обусловленная недостаточным поступлением в организм фолиевой кислоты, БДУ.
  • D53. Другие анемии, связанные с питанием.
    • Включена: мегалобластная анемия, не поддающаяся лечению витамином В12 или фолатами
    • D53.0 Анемия вследствие недостаточности белков. Анемия вследствие недостаточности аминокислот. Оротацидурическая анемия.
    • Исключен: синдром Леша-Нихена (Е79.1)
    • D53.1 Другие мегалобластные анемии, не классифицированные в других рубриках. Мегалобластная анемия БДУ. Исключена: болезнь Ди Гульельмо (С94.0)
    • D53.2 Анемия, обусловленная цингой.
    • Исключена: цинга (Е54)
    • D53.8 Другие уточненные анемии, связанные с питанием. Анемия, связанная с дефицитом: меди, молибдена, цинка.
Исключена: недостаточность питания без упоминания об анемии, такие, как: дефицит меди (E61.0), дефицит молибдена (Е61 .5) дефицит цинка (Е60)
  • D53.9 Анемия, связанная с питанием, неуточнённая.
  • D55. Анемия вследствие ферментных нарушений.
    • Исключена: фермент дефицитная анемия, вызванная лекарст­венными средствами (059.2)
    • D55.0 Анемия вследствие недостаточности глюкозо-6-фосфатдегидрогеназы [Г-6-ФД], Фавизм, Г-6-ФД-дефицитная анемия
    • D55.1Анемия вследствие других нарушений глутатионового обмена. Анемия вследствие недостаточности ферментов (за исключе­нием Г-б-ФД), связанных с гексозомонофосфатным [ГМФ] шунтом метаболического пути. Гемолитическая несфероцитарная анемия (наследственная) ти­па I.
    • D55.2Анемия вследствие нарушений гликолитичес­ких ферментов. Анемия: гемолитическая несфероцитарная (наследственная) типа II, вследствие недостаточности гексокиназы, вследствие недостаточности пируваткиназы, вследствие недостаточности триозофосфатизомеразы
    • D55. 3 Анемия вследствие нарушений метаболизма нуклеотидов
    • D55.8 Другие анемии вследствие ферментных нарушений
    • D55.9 Анемия вследствие ферментного нарушения неуточненная
  • D56. Талассемия
    • D56.0 Альфа-талассемия.
    • Исключена: водянка плода, обусловленная гемолитической болезнью (Р56.-)
    • D56.1 Бета-талассемия Анемия Кули. Тяжелая бета-талассемия. Серповидно-клеточная бета-талассемия. Талассемия: промежуточная, большая
    • D56.2 Дельта-бета-талассемия
    • D56.3 Носительство признака талассемии
    • D56.4 Наследственное персистирование фетального гемоглобина [НПФГ]
    • D56.8 Другие талассемии
    • D56.9 Талассемия неуточненная. Средиземноморская анемия (с другой гемоглобинопатией). Талассемия (малая) (смешанная) (с другой гемоглобинопатией)
  • D57. Серповидно-клеточные нарушения.
    • Исключены: другие гемоглобинопатии (D58.-) серповидно-клеточная бета-талассемия (D56.1)
    • D57. 0 Серповидно-клеточная анемия с кризом, Hb-SS болезнь с кризом
    • D57.1 Серповидно-клеточная анемия без криза. Серповидно-клеточная(ое): анемия, болезнь, нарушение.
    • D57.2 Двойные гетерозиготные серповидно-клеточ­ные нарушения. Болезнь. Hb-SC. Hb-SD. Hb-SE.
    • D57.3 Носительство признака серповидно­клеточности. Носительство гемоглобина S[Hb-S]. Гетерозиготный гемоглобин S
    • D57.8 Другие серповидно-клеточные нарушения
  • D58. Другие наследственные гемолитические анемии
    • D58.0 Наследственный сфероцитоз. Ахолурическая (семейная) желтуха. Врожденная (сфероцитарная) гемолитическая желтуха. Синдром Минковского — Шоффара
    • D58.1 Наследственный эллиптоцитоз. Эллиптоцитоз (врожденный). Овалоцитоз (врожденный) (наследственный)
    • D58.2 Другие гемоглобинопатии. Аномальный гемоглобин БДУ. Врожденная анемия с тельцами Гейнца — Болезнь: НЬ-С, НЬ-D, НЬ-Е. Гемоглобинопатия БДУ. Гемолитическая болезнь, обусловленная неустойчивым гемо­глобином.
    • Исключены: семейная полицитемия (D75.0), болезнь НЬ-М (D74.0), наследственное персистирование фетального гемо­глобина (D56.4), полицитемия, связанная с высотой (D75.1), метгемоглобинемия (D74.-)
    • D58.8 Другие уточненные наследственные гемолитические анемии. Стоматоцитоз
    • D58.9 Наследственная гемолитическая анемия, неуточненная
  • D59. Приобретенная гемолитическая анемия
    • D59.0 Медикаментозная аутоиммунная гемолити­ческая анемия
    • D59.1 Другие аутоиммунные гемолитические анемии. Аутоиммунная гемолитическая болезнь (холодовый тип) (теп­ловой тип). Хроническая болезнь, вызываемая холодовыми гемагглютининами. «Холодовая агглютининовая»: болезнь, гемоглобинурия. Гемолтическая анемия: холодовой тип (вторичная) (симптоматическая), тепловой тип (вторичная) (симптоматическая). Исключены: синдром Эванса (D69.3), гемолитическая болезнь плода и новорожденного (Р55.-), пароксизмальная холодовая гемоглобинурия (D59.6)
    • D59. 2 Медикаментозная неаутоиммунная гемолитическая анемия. Медикаментозная фермент дефицитная анемия
    • D59.3 Гемолитико-уремический синдром
    • D59.4 Другие неаутоиммунные гемолитические анемии. Гемолитическая анемия: механическая, микроангиопатическая, токсическая
    • D59.5 Пароксизмальная ночная гемоглобинурия (Маркиафавы — Микели).
    • Исключена: гемоглобинурия БДУ (R82.3)
    • D59.6 Гемоглобинурия вследствие гемолиза, вызванного другими внешними причинами. Гемоглобинурия: от нагрузки, маршевая, пароксизмальная холодовая.
    • Исключена: гемоглобинурия БДУ (R82.3)
  • D59.8 Другие приобретенные гемолитические анемии
  • D59.9 Приобретенная гемолитическая анемия неуточненная. Идиопатическая гемолитическая анемия хроническая.

Апластические и другие анемии (D60- D64)

  • D60. Приобретенная чистая красноклеточная аплазия (эритробластопения).
    • Включена: красноклеточная аплазия (приобретенная) (взрос­лых) (с тимомой)
    • D60. 0 Хроническая приобретенная чистая красноклеточная аплазия
    • D60.1 Преходящая приобретенная чистая красноклеточная аплазия
    • D60.8 Другие приобретенные чистые красноклеточные аплазии
    • D60.9 Приобретенная чистая красноклеточная апла­зия неуточненная
  • D61. Другие апластические анемии.
    • Исключен: агранулоцитоз (D70.)
    • D61.0 Конституциональная апластическая анемия. Аплазия (чистая) красноклеточная: врожденная, детская, первичная. Синдром Блекфана — Даймонда. Семейная гипопластическая анемия. Анемия Фанкони. Панцитопения с пороками развития
    • D61.1 Медикаментозная апластическая анемия. При необходимости идентифицировать лекарственное средство используют дополнительный код внешних причин (класс ХХ).
    • D61.2 Апластическая анемия, вызванная другими внешними агентами. При необходимости идентифицировать лекарственное средство используют дополнительный код внешних причин (класс ХХ).
    • D61.3 Идиопатическая апластическая анемия
    • D61. 8 Другие уточненные апластические анемии
    • D61.9 Апластическая анемия неуточненная. Гипопластическая анемия БДУ. Гипоплазия костного мозга. Панмиелофтиз.
  • D62. Острая постгеморрагическая анемия.
    • Исключена: врожденная анемия вследствие кровопотери у пло­да (P61.3)
  • D63. Анемия при хронических болезнях, классифицированных в других рубриках
    • D63.0 Анемия при новообразованиях (C00 — D48)
    • D63.8 Анемия при других хронических болезнях, классифицированных в других рубриках .
  • D64. Другие анемии.
    • Исключены: рефрактерная анемия: БДУ (D46.4), с избытком бластов (D46.2), с трансформацией (D46.3), с сидеробластами (D46.1), без сидеробластов (D46.0).
    • D64.0 Наследственная сидеробластная анемия. Связанная с полом гипохромная сидеробластная анемия
    • D64.1 Вторичная сидеробластная анемия в связи с другими заболеваниями
    • D64.2 Вторичная сидеробластная анемия, вызванная лекарственными препаратами или токсинами
    • D64. 3 Другие сидеробластные анемии. Сидеробластная анемия: БДУ, пиридоксинреагирующая, не классифицированная в других рубриках
    • D64.4 Врожденная дизэритропоэтическая анемия. Дисгемопоэтическая анемия (врожденная).
    • Исключены: синдром Блекфана — Даймонда (D61.0), болезнь Ди Гульельмо (С94.0)
    • D64.8 Другие уточненные анемии. Детский псевдолейкоз. Лейкоэритробластная анемия
    • D64.9 Анемия неуточненная

Нарушения свертываемости крови, пурпура и другие геморрагические состояния (D65 — D69)

  • D65. Диссеминированное внутрисосудистое свертывание [синдром дефибринации]. Афибриногенемия приобретенная . Коагулопатия потребления. Диффузная или диссеминированная внутрисосудистая коагуляция (DJC). Фибринолитическая кровоточивость приобретенная. Пурпура: фибринолитическая, молниеносная.
    • Исключен: синдром дефибринации (осложняющий): аборт, внематочную или молярную беременность (O00 — O07, O08.1), у новорожденного (P60), беременность, роды и послеродовой период (O45. 0, O46.0, O67.0, O72.3)
  • D66. Наследственный дефицит фактора VIII. Дефицит фактора VIII (с функциональным нарушением) Гемофилия: БДУ, А, классическая.
    • Исключен: дефицит фактора VIII с сосудистым нарушением (D68.0)
  • D67. Наследственный дефицит фактора IX. Болезнь Кристмаса. Дефицит: фактора IX (с функциональным нарушением), тромбопластического компонента плазмы, Гемофилия В
  • D68. Другие нарушения свертываемости.
    • Исключены осложняющие: аборт, внематочную или молярную беремен­ность (O00-O07, O08.1), беременность, роды и послеродовой период (O45.0, O46.0, O67.0, O72.3)
    • D68.0 Болезнь Виллебранда. Ангиогемофилия. Дефицит фактора VIII с сосудистым нарушением. Сосудистая гемофилия.
    • Исключены: ломкость капилляров наследственная (D69.8), дефицит фактора VIII: БДУ (D66), с функциональным нарушением (D66)
    • D68.1 Наследственный дефицит фактора XI. Гемофилия С. Дефицит предшественника тромбопластина плазмы.
    • D68.2 Наследственный дефицит других факторов свертывания. Врожденная афибриногенемия. Дефицит: АС-глобулина, проакцелерина. Дефицит фактора: I (фибриногена), II (протромбина), V (лабильного), VII (стабильного), X (Стюарта-Прауэра), XII (Хагемана), XIII (фибринстабилизирующего). Дисфибриногенемия (врожденная). Гипопроконвертинемия Болезнь Оврена
    • D68.3 Геморрагические нарушения, обусловленные циркулирующими в крови антикоагулянтами. Гипергепаринемия Повышение содержания: антитромбина, анти-VIIIa, анти-IXa, анти-Xa, анти-XIa.
    • D68.4 Приобретенный дефицит фактора свертывания. Дефицит фактора свертывания вследствие: заболевания печени, недостаточности витамина К.
    • Исключена: недостаточность витамина К у новорожденного (P53)
    • D68.8 Другие уточненные нарушения свертываемости. Присутствие ингибитора системной красной волчанки
    • D68.9 Нарушение свертываемости неуточненное
  • D69. Пурпура и другие геморрагические состоякия.
    • Исключены: доброкачественная гипергаммаглобулинемическая пурпура (D89.0), криоглобулинемическая пурпура (D89.1), идиопатическая (геморрагическая) тромбоцитемия (D47.3), молниеносная пурпура (D65), тромботическая тромбоцитопеническая пурпура (M31.1)
    • D69.0 Аллергическая пурпура. Пурпура: анафилактоидная, Геноха( — Шенлейна), нетромбоцитопеническая: геморрагическая, идиопатическая, сосудистая. Аллергический васкулит.
    • D69.1 Качественные дефекты тромбоцитов. Синдром Бернара-Сулье (гигантских тромбоцитов), Болезнь Гланцманна, Синдром серых тромбоцитов, Тромбастения (геморрагическая) (наследственная). Тромбоцитопатия.
    • Исключена: болезнь Виллебранда (D68.0)
    • D69.2 Другая нетромбоцитопеническая пурпура. Пурпура: БДУ, сенильная, простая.
    • D69.3 Идиопатическая тромбоцитопеническая пурпура. Синдром Эванса
    • D69.4 Другие первичные тромбоцитопении.
    • Исключены: тромбоцитопения с отсутствием лучевой кости (Q87.2), преходящая неонатальная тромбоцитопения (P61. 0), синдром Вискотта — Олдрича (D82.0)
    • D69.5 Вторичная тромбоцитопения
    • D69.6 Тромбоцитопения неуточненная
    • D69.8 Другие уточненные геморрагические состояния. Ломкость капилляров (наследственная). Сосудистая псевдогемофилия.
    • D69.9 Геморрагическое состояние неуточненное

Другие болезни крови и кроветворных органов (D70 — D77)

  • D70. Агранулоцитоз. Агранулоцитарная ангина. Детский генетический агранулоцитоз. Болезнь Костманна. Нейтропения: БДУ, врожденная, циклическая, медикаментозная, периодическая, селезеночная (первичная), токсическая. Нейтропеническая спленомегалия. При необходимости идентифицировать лекарственное средство, вызвавшее нейтропению, используют дополнительный код внешних причин (класс ХХ).
    • Исключена: преходящая неонатальная нейтропения (P61.5)
  • D71. Функциональные нарушения полиморфно-ядерных нейтросфилов. Дефект рецепторного комплекса клеточной мембраны. Хронический (детский) гранулематоз. Врожденный дисфагоцитоз. Прогрессирующий септический гранулематоз.
  • D72. Другие нарушения белых кровяных клеток.
    • Исключены: базофилия (D75.8), иммунные нарушения (D80 — D89), нейтропения (D70), предлейкоз (синдром) (D46.9)
    • D72.0 Генетические аномалии лейкоцитов. Аномалия (грануляции) (гранулоцита) или синдром: Альдера, Мая — Хегглина, Пельгера — Хюэта. Наследственная лейкоцитарная: гиперсегментация, гипосегментация, лейкомеланопатия.
    • Исключен: синдром Чедиака — Хигаши (Chediak — Higashi syndrome) (- Стейнбринка) (E70.3)
    • D72.1 Эозинофилия. Эозинофилия: аллергическая, наследственная.
    • D72.8 Другие уточненные нарушения белых кровяных клеток. Лейкемоидная реакция: лимфоцитарная, моноцитарная, миелоцитарная. Лейкоцитоз. Лимфоцитоз (симптоматический). Лимфопения. Моноцитоз (симптоматический). Плазмацитоз.
    • D72.9 Нарушение белых кровяных клеток неуточ­ненное
  • D73. Болезни селезенки
    • D73.0 Гипоспленизм. Аспления послеоперационная. Атрофия селезенки.
    • Исключена: аспления (врожденная) (Q89.0)
    • D73.1 Гиперспленизм.
    • Исключены спленомегалия: БДУ (R16.1), врожденная (Q89.0).
    • D73.2 Хроническая застойная спленомегалия
    • D73.3 Абсцесс селезенки
    • D73.4 Киста селезенки
    • D73.5 Инфаркт селезенки. Разрыв селезенки нетравматический. Перекручивание селезенки.
    • Исключен: травматический разрыв селезенки (S36.0)
    • D73.8 Другие болезни селезенки. Фиброз селезенки БДУ. Периспленит. Спленит БДУ.
    • D73.9 Болезнь селезенки неуточненная
  • D74. Метгемоглобинемия
    • D74.0 Врожденная метгемоглобиемия. Врожденная недостаточность NADH-метгемоглобинредуктазы. Гемоглобиноз М (болезнь НЬ-М). Meтгeмoглобинемия наследственная
    • D74.8 Другие метгемоглобинемии. Приобретенная метгемоглобинемия (с сульфгемоглобинемией). Токсическая метгемоглобинемия
    • D74.9 Метгемоглобинемия неуточненная
  • D75. Другие болезни крови и кроветворных органов.
    • Исключены: увеличение лимфатических узлов (R59.-), гипергаммаглобулинемия БДУ (D89.2), лимфаденит; БДУ (I88.9), острый (L04.-), хронический (I88.1), брыжеечный (острый) (хронический) (I88.0)
    • D75.0 Семейный эритроцитоз. Полицитемия: доброкачественная, семейная.
    • Исключен: наследственный овалоцитоз (D58.1)
    • D75.1 Вторичная полицитемия. Полицитемия: приобретенная, связанная с: эритропоэтинами, снижением объёма плазмы, высотой, стрессом, эмоциональная, гипоксемическая, нефрогенная, относительная.
    • Исключены полицитемия: новорожденного (P61.1), истинная (D45)
    • D75.2 Эссенциальный тромбоцитоз. Исключена: эссенциальная (геморрагическая) тромбоцитемия (D47.3)
    • D75.8 Другие уточненные болезни крови и кроветворных органов. Базофилия
    • D75.9 Болезнь крови и кроветворных органов неуточненная
  • D76. Отдельные болезни, протекающие с вовлечением лимфоретикулярной ткани и ретикулогистиоцитарной системы.
    • Исключены: болезнь Леттерера — Сиве (C96.0), злокачественный гистиоцитоз (C96.1), ретикулоэндотелиоз или ретикулез: гистиоцитарный медуллярный (C96.1), лейкемический (C91.4), липомеланотический (I89.8), злокачественный (C85.7), нелипидный (C96.0)
    • D76.0 Гистиоцитоз из клеток Лангерганса, не клас­сифицированный в других рубриках. Эозинофильная гранулема. Болезнь Хенда — Шюллера — Крисчена (Hand — Schuller — Christian. Гистиоцитоз Х (хронический)
    • D76.1 Гемофагоцитарный лимфогистиоцитоз. Семейный гемофагоцитарный ретикулез. Гистиоцитозы из мононуклеарных фагоцитов, отличных от клеток Лангерганса, БДУ.
    • D76.2 Гемофагоцитарный синдром, связанный с инфекцией
    • D76.3 Другие гистиоцитозные синдромы. Ретикулогистиоцитома (гигантоклеточная). Синусный гистиоцитоз с массивной лимфаденопатией. Ксантогранулема
  • D77. Другие нарушения крови и кроветворных органов при болезнях, классифицированных в других рубриках. Фиброз селезенки при шистосомозе [бильгарциозе] (B65. -)

Отдельные нарушения, вовлекающие иммунный механизм (D80 — D89)

    • Включены: дефекты в системе комплемента, иммунодефицитные расстройства, за исключением болезни, вызванной вирусом иммунодефицита человека ВИЧ, саркоидоз.
    • Исключены: аутоиммунные болезни (системные) БДУ (M35.9), функциональные нарушения полиморфно-ядерных нейтрофи­лов (D71), болезнь, вызванная вирусом иммунодефицита человека [ВИЧ] (B20 — B24)
  • D80. Иммунодефициты с преимуществен­ной недостаточностью антител
    • D80.0 Наследственная гипогаммаглобулинемия. Аутосомная рецессивная агаммаглобулинемия (швейцарский тип). Сцепленная с Х-хромосомой агаммаглобулинемия [Брутона], (с дефицитом гормона роста).
    • D80.1 Несемейная гипогаммаглобулинемия. Агаммаглобулинемия с наличием В-лимфоцитов, несущих иммуноглобулины. Общая агаммаглобулинемия [CV Agamma]. Гипогаммаглобулинемия БДУ
    • D80.2 Избирательный дефицит иммуноглобулина А IgA
    • D80. 3 Избирательный дефицит подклассов иммуноглобулина G IgG
    • D80.4 Избирательный дефицит иммуноглобулина М IgM
    • D80.5 Иммунодефицит с повышенным содержанием иммуноглобулина M (IgM)
    • D80.6 Недостаточность антител с близким к норме уровнем иммуноглобулинов или с гипериммуноглобулинемией. Дефицит антител с гипериммуноглобулинемией.
    • D80.7 Преходящая гипогаммаглобулинемия детей
    • D80.8 Другие иммунодефициты с преимуществен­ным дефектом антител. Дефицит каппа-легких цепей
    • D80.9 Иммунодефицит с преимущественным дефектом антител неуточненный
  • D81. Комбинированные иммунодефициты.
    • Исключена: аутосомная рецессивная агаммаглобулинемия (швейцарский тип) (D80.0)
    • D80.0 Тяжелый комбинированный иммунодефицит с ретикулярным дисгенезом
    • D80.1 Тяжелый комбинированный иммунодефицит с низким содержанием Т-и В-клеток
    • D80.2 Тяжелый комбинированный иммунодефицит с низким или нормальным содержанием В-клеток
    • D80. 3 Дефицит аденозиндезаминазы.
    • D80.4 Синдром Незелофа
    • D80.5 Дефицит пуриннуклеозидфосфорилазы
    • D80.6 Дефицит молекул класса I главного комплекса гистосовместимости. Синдром «лысых лимфоцитов»
    • D80.7 Дефицит молекул класса II главного комплекса гистосовместимости
    • D80.8 Другие комбинированные иммунодефициты. Дефицит биотинзависимой карбоксилазы
    • D80.9 Комбинированный иммунодефицит неуточненный. Тяжелое комбинированное иммунодефицитное расстройство БДУ
  • D82. Иммунодефициты, связанные с другими значительными дефектами.
    • Исключена: атаксия-телеангиэктазия (синдром Луи-Бар) (G11.3)
    • D82.0 Синдром Вискотта-Олдрича (Wiscott-Aldrich syndrome). Иммунодефицит с тромбоцитопенией и экземой
    • D82.1 Синдром Ди Джорджи (Di George syndrome). Синдром дивертикула глотки. Вилочковой железы: алимфоплазия, аплазия или гипоплазия с иммунной недостаточностью.
    • D82.2 Иммунодефицит с карликовостью за счет коротких конечностей
    • D82. 3 Иммунодефицит вследствие наследственного дефекта, вызванного вирусом Эпштейна-Барр. Сцепленная с Х-хромосомой лимфопролиферативная болезнь
    • D82.4 Синдром гипериммуноглобулина Е IgE
    • D82.8 Иммунодефицит, связанный с другими уточненными значительными дефектами
    • D82.9 Иммунодефицит, связанный со значительным дефектом, неуточненный
  • D83. Обычный вариабельный иммунодефицит
    • D83.0 Общий вариабельный иммунодефицит с пре­обладающими отклонениями в количестве и функциональной активности В-клеток
    • D83.1 Общий вариабельный иммунодефицит с преобладанием нарушений иммунорегуляторных Т-клеток
    • D83.2 Общий вариабельный иммунодефицит с аутоантителами к В- или Т-клеткам
    • D83.8 Другие общие вариабельные иммунодефициты.
    • D83.9 Общий вариабельный иммунодефицит неуточненный
  • D84. Другие иммунодефициты
    • D84.0 Дефект функционального антигена-1 лимфоцитов [LFA-1]
    • D84.1 Дефект в системе комплемента. Дефицит Cl ингибитора эстеразы (C1-INH)
    • D84.8 Другие уточненные иммунодефицитные нару­шения
    • D84.9 Иммунодефицит неуточненный
  • D86. Саркоидоз
    • D86.0 Саркоидоз легких
    • D86.1 Саркоидоз лимфатических узлов
    • D86.2 Саркоидоз легких с саркоидозом лимфатических узлов
    • D86.3 Саркоидоз кожи
    • D86.8 Саркоидоз других уточненных и комбинированных локализаций. Иридоциклит при саркоидозе (h32.l), Множественные параличи черепных нервов при саркоидозе (G53.2), Саркоидная(ый): артропатия (M14.8), миокардит (I41.8), миозит (M63.3). Увеопаротитная лихорадка болезнь Герфордта
    • D86.9 Саркоидоз неуточненный
  • D89. Другие нарушения с вовлечением иммунного механизма, не классифицированные в других рубриках.
    • Исключены: гиперглобулинемия БДУ (R77.1), моноклональная гаммапатия (D47.2) неприживление и отторжение трансплантата (T86.-)
    • D89.0 Поликлональная гипергаммаглобулинемия. Гипергаммаглобулинемическая пурпура. Поликлональная гаммапатия БДУ
    • D89.1 Криоглобулинемия. Криоглобулинемия: эссенциальная, идиопатическая, смешанная, первичная, вторичная, Криоглобулинемическая(ий): пурпура, васкулит
    • D89.2 Гипергаммаглобулинемия неуточненная
    • D89.8 Другие уточненные нарушения с вовлечением иммунного механизма, не классифцирован­ные в других рубриках
    • D89.9 Нарушение, вовлекающее иммунный механизм, неуточненное. Иммунная болезнь БДУ

Ссылки

(D50-D89)] (англ.). International Statistical Classification of Diseases and Related Health Problems. 10th Revision. Version for 2007. World Health Organization (05.04.2006). Проверено 11 апреля 2009.

Wikimedia Foundation. 2010.

  • МКБ-10
  • МКБ-10: Класс G

Полезное


Смотреть что такое «МКБ-10: Класс III. Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный механизм» в других словарях:

  • МКБ-10: Класс III —   Международная классификация болезней 10 го пересмотра (МКБ 10) Класс I Некоторые инфекционные и паразитарные болезни Класс II Новообразования Класс III Болезни крови, кроветворных ор …   Википедия

  • МКБ-10: Класс XXI —   Международная классификация болезней 10 го пересмотра (МКБ 10) Класс I Некоторые инфекционные и паразитарные болезни Класс II Новообразования Класс III Болезни крови, кроветворных органов и отдельные нарушен …   Википедия

  • МКБ-10: Класс F — Список классов Международной классификации болезней 10 го пересмотра Класс I. Некоторые инфекционные и паразитарные болезни Класс II. Новообразования Класс III. Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный… …   Википедия

  • МКБ-10: Класс V Психические расстройства и расстройства поведения — Список классов Международной классификации болезней 10 го пересмотра Класс I. Некоторые инфекционные и паразитарные болезни Класс II. Новообразования Класс III. Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный… …   Википедия

  • МКБ-10 Класс F — Список классов Международной классификации болезней 10 го пересмотра Класс I. Некоторые инфекционные и паразитарные болезни Класс II. Новообразования Класс III. Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный… …   Википедия

  • МКБ-10: Класс XI —   Международная классификация болезней 10 го пересмотра (МКБ 10) Класс I Некоторые инфекционные и паразитарные болезни Класс II Новообразования Класс III Болезни крови, кроветворных органов и отдельные нарушен …   Википедия

  • МКБ-10: Класс XVI —   Это служебный список статей, созданный для координации работ по развитию темы. Его необходимо преобразовать в информационный список или глоссарий или перенести в один из проект …   Википедия

  • МКБ-10: Класс K — Международная классификация болезней 10 го пересмотра (МКБ 10) Класс I Некоторые инфекционные и паразитарные болезни Класс II Новообразования Класс III Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный механизм Класс …   Википедия

  • МКБ-10: Класс IV — Список классов Международной классификации болезней 10 го пересмотра Класс I. Некоторые инфекционные и паразитарные болезни Класс II. Новообразования Класс III. Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный… …   Википедия

  • МКБ-10: Класс E — Список классов Международной классификации болезней 10 го пересмотра Класс I. Некоторые инфекционные и паразитарные болезни Класс II. Новообразования Класс III. Болезни крови, кроветворных органов и отдельные нарушения, вовлекающие иммунный… …   Википедия


Эритропоэтин инструкция по применению: показания, противопоказания, побочное действие – описание Erythropoietin р-р д/в/в и п/к введения 500 МЕ/мл: 1 мл амп.

5 или 10 шт. (36410)

На фоне терапии эпоэтином бета следует регулярно контролировать показатели тромбоцитов, гематокрита и гемоглобина.

Следует с осторожностью применять эпоэтин бета при рефрактерной анемии при наличии бласттрансформированных клеток, эпилепсии, тромбоцитозе и хронической печеночной недостаточности.

Терапевтическая эффективность эпоэтина бета может уменьшиться при дефиците железа, фолиевой кислоты, витамина B12.

Следует исключить дефицит железа до начала лечения эпоэтином бета, а также в течение всего периода терапии. При необходимости может быть назначена дополнительная терапия препаратами железа в соответствии с клиническими рекомендациями.

Эффективность лечения уменьшается при дефиците железа в организме, при инфекционных и воспалительных заболеваниях, гемолизе.

Нельзя полностью исключить возможность влияния эпоэтина бета на рост некоторых типов опухолей, особенно на злокачественные новообразования костного мозга.

На фоне применения эпоэтина бета необходимо контролировать уровень АД, обращая внимание на возникновение или усиление необычных головных болей. При этом может потребоваться коррекция проводимой терапии или назначение антигипертензивных средств.

С осторожностью применяют при эпилепсии, тромбоцитозе, печеночной недостаточности, сосудистой недостаточности, при злокачественных новообразованиях; у пациентов с нефросклерозом, не получающим гемодиализ, поскольку возможно более быстрое ухудшение функции почек.

Решение о применении эпоэтина бета у пациентов с нефросклерозом, не получающих диализ, необходимо принимать индивидуально, так как нельзя полностью исключить возможность более быстрого ухудшения функции почек. В большинстве случаев одновременно с повышением гемоглобина снижается концентрация ферритина в сыворотке. Уровень ферритина необходимо определять в течение всего курса лечения. Если он составляет менее 100 нг/мл, рекомендуется заместительная терапия препаратами железа.

Пациенты, сдающие аутологичную кровь и находящиеся в пред- или послеоперационном периоде, также должны получать дополнительно адекватное количество железа до нормализации показателей ферритина.

причины, симптомы, диагностика и лечение

Порфирии ‒ большая группа наследственных заболеваний, характеризующихся нарушением биосинтеза гема и накоплением его токсичных метаболитов. Клинические проявления крайне разнообразны – от светочувствительности и кожных высыпаний до болей в животе, полного паралича и острых психозов. Диагностика осуществляется с помощью молекулярно-генетических тестов, специальных лабораторных методов определения порфиринов и их предшественников в моче и кале, оценки активности ферментов в крови. Лечение заключается в мероприятиях, направленных на снижение образования токсических метаболитов, их выведение из крови, проведении симптоматической терапии и хирургических вмешательств.

Общие сведения

Порфирии (от греч. «porphyreis» — пурпурный) – ряд заболеваний обмена веществ, при которых нарушается образование гема, в результате чего в организме накапливаются порфирины или их токсичные предшественники. Патологии данной группы встречаются относительно редко ‒ от 7 до 12 случаев на 100 000 человек. Отдельные нозологии имеют свою эндемичность. Так, распространенность поздней кожной порфирии в странах Южной Африки составляет 1:800, острой перемежающейся порфирии в Швеции ‒ 1:1000, вариегатной порфирии в Южной Африке ‒ 1:3000. У большинства порфирий нет гендерных различий, кроме поздней кожной формы (чаще страдают мужчины) и острой интермиттирующей (чаще болеют женщины).

Порфирия

Причины порфирий

В подавляющем большинстве случаев причиной порфирий выступают генетические мутации, обусловливающие неполноценность активности того или иного фермента, участвующего в биосинтезе гема. Исключением является поздняя кожная порфирия (спорадическая форма), которая развивается вследствие заболеваний печени (алкогольный гепатит, вирусный гепатит С) или длительной интоксикации тяжелыми металлами. Наследование порфирий происходит по аутосомно-доминантному или аутосомно-рецессивному типу. Синтезирование гема протекает в 8 последовательных этапов, за каждый отвечает свой фермент, кодируемый определенным геном. Для каждой формы порфирии существует специфичный ферментативный дефект.

Гем представляет собой комплексное соединение порфиринов с двухвалентным железом. Наибольшее количество гема образуется в печени и костном мозге. В печени гем входит в состав белков, участвующих в клеточном дыхании, расщеплении токсичных свободных радикалов и обезвреживании различных ксенобиотиков. В костном мозге гем используется для образования гемоглобина. Результатом сниженной активности ферментов является торможение синтеза гема на определенном уровне, что ведет к накоплению его токсичных промежуточных метаболитов.

Помимо генетической мутации, для развития острых порфирий необходимо воздействие провоцирующих факторов, стимулирующих выработку порфиринов. Такими факторами являются голодание, длительная инсоляция, стрессы, алкоголь, инфекции, интоксикация тяжелыми металлами (ртуть, свинец), лекарственные средства, подвергающиеся метаболизму системой цитохрома P-450 (нестероидные противовоспалительные препараты, антибиотики, антиконвульсанты, оральные контрацептивы, седативные средства). Особую роль играют колебания женских половых гормонов во время менструаций или беременности. У женщин месячные являются наиболее частым провоцирующим фактором, а беременность ассоциируется с тяжелым течением заболевания.

Патогенез

В результате неполноценности ферментов, участвующих в образовании гема, и действия провоцирующих факторов происходит увеличение концентрации его токсичных продуктов обмена. Для хронических порфирий характерно накопление протопорфирина, копропорфирина и упопорфирина. При острых формах возрастает количество порфобилиногена и дельта-аминолевулиновой кислоты (ДАЛК).

Порфирины накапливаются в коже и под действием ультрафиолетового излучения (солнечного света) запускают процесс перекисного окисления липидов, вызывая деструкцию и гибель клеток кожи. Копропорфирин и протопорфирин усиливают пигментацию кожи и ускоряют рост волос (гипертрихоз). Плохо растворимый в воде протопорфирин откладывается в клетках печени, закупоривает портальные тракты и желчные протоки. Отложение уропорфирина в эритроцитах приводит к их ускоренному разрушению в селезенке (гемолиз). Предшественники порфиринов (ДАЛК и порфобилиноген), накапливаясь в нервной ткани, вызывают демиелинизацию и аксональную дегенерацию нервных волокон.

Классификация

В основу разных классификаций порфирий положены различные критерии: клиническая симптоматика, локализация нарушения метаболизма порфиринов или тканевая тропность. Наиболее целесообразно выделять следующие виды порфирий:

  • Эритропоэтические. К ним относятся врожденная эритропоэтическая порфирия (ВЭП, болезнь Гюнтера), эритропоэтическая протопорфирия (ЭПП). Основной клинический признак – поражение участков кожи, которые подвергаются воздействию прямых солнечных лучей (фотосенсибилизация). Данные патологии являются наиболее тяжелыми и имеют самый высокий процент летальности.
  • Острые печеночные. Сюда включены острая перемежающаяся порфирия (ОПП), вариегатная порфирия (ВП), наследственная копропорфирия (НКП). Острые порфирии характеризуются приступообразным течением. Преимущественно страдает нервная система. При ВП и НКП также встречаются признаки фотосенсибилизации.
  • Хронические печеночные. К ним относят позднюю кожную порфирию (ПКП), которая имеет наследственную и приобретенную формы. Это наиболее благоприятный вид порфирии.

Симптомы порфирий

Спектр клинических проявлений очень широк. Порфирии могут протекать в виде острых атак или хронически. Различия наблюдаются также в возрасте дебюта заболевания. Так, эритропоэтические порфирии манифестируют уже в дошкольном детстве (3-5 лет), острые порфирии — после полового созревания (14-16 лет), а спорадическая (приобретенная) форма ПКП — после 40 лет.

При острых порфириях развиваются сильные боли в животе, задержка стула, учащение сердцебиения, повышение артериального давления, изменение цвета мочи (от розового до красно-бурого). Тяжесть состояния пациента в основном обусловлена неврологическими симптомами – болью по всему телу, снижением чувствительности, прогрессирующей мышечной слабостью, иногда достигающей полного паралича, судорожными припадками, различными психическими расстройствами (тревожность, психомоторное возбуждение, бред, галлюцинации).

При поздней кожной форме возникает гиперпигментация участков кожи, подвергающихся постоянному воздействию солнечного света (лицо, шея, ушные раковины, верхняя часть груди, кисти рук). Кожа приобретает землистый или бронзовый оттенок. Также характерны гипертрихоз лобно-височной области лица, фотосенсибилизация, проявляющаяся повышенной ранимостью кожи и образованием пузырей с жидкостным содержимым. После вскрытия пузырей формируются эрозии. На местах разрешения эрозий образуются атрофические рубцы.

При эритропоэтических порфириях наблюдаются более выраженные признаки светочувствительности, чем при ПКП (ранимость, пузыри, эрозии). При длительном нахождении на свету появляется покраснение и сильное жжение кожи. Обширные эрозии оставляют после себя грубые рубцы на лице, что приводит к обезображиванию внешнего вида больного. В результате множественных рубцов на коже кистей рук развиваются контрактуры суставов, что значительно затрудняет их движения. Моча становится красной или розовой, а зубы окрашиваются в красно-коричневый цвет (эритродонтия). Из-за увеличенной селезенки могут появиться тяжесть или ноющие боли в левом подреберье. Специфический признак ЭПП – утолщение, огрубение и уплотнение кожи вокруг рта и глаз, на крыльях и спинке носа, на тыльных поверхностях кистей.

Осложнения

Диагностика

При подозрении на порфирию пациента направляют к врачу-гематологу. При постановке диагноза учитывается наличие заболевания у близких родственников, возраст больного, обстоятельства возникновения симптомов (инсоляция, прием лекарств или алкоголя, голодание, инфекции, менструации, беременность). Лабораторная диагностика порфирий следующая:

  • Клинико-биохимические анализы. При болезни Гюнтера в общем и биохимическом анализах крови выявляются признаки гемолиза (пойкилоцитоз, анизоцитоз, сфероцитоз, ретикулоцитоз, повышение непрямого билирубина и сывороточного железа), увеличение печеночных трансаминаз. У больных с острыми порфириями отмечается снижение уровня глюкозы и натрия, при ПКП — увеличение сывороточного железа и ферритина. Также у 80% с ПКП выявляются положительные маркеры вируса гепатита С.
  • Специфические исследования. Для диагностики острых порфирий широко используется скрининговая проба Эрлиха (при смешивании специального реактива с мочой она окрашивается в красный цвет). Для ОПП характерно повышение ДАЛК и порфобилиногена в моче, для ВП — протопорфирина в кале, для НКП – копропорфирина в кале и моче. При ПКП в моче увеличено содержание уропорфирина, в кале – копропорфирина. При ЭПП наблюдается высокая концентрация протопорфирина в эритроцитах и кале, при ВЭП — уропорфирина в моче, кале и эритроцитах. При люминесцентной микроскопии плазма дает красное флуоресцирование при ПКП и эритропоэтических порфириях.

Также для подтверждения диагноза проводится определение уровня ферментов цикла биосинтеза гема в эритроцитах, лимфоцитах или плазме — порфобилиногендезаминазы (ОПП), копропорфириноген-оксидазы (НКП), протопорфириноген-оксидазы (ВП), уропорфириногенсинтетазы (ВЭП), уропорфириногендекарбоксилазы (ПКП), феррохелатазы (ЭПП). Заключительным этапом диагностики является молекулярно-генетическое тестирование для выявления мутаций генов, кодирующих перечисленные выше ферменты. Данные исследования особенно эффективны для распознавания асимптомных форм порфирий.

Эритропоэтические порфирии дифференцируют с дерматологическими заболеваниями (буллезным пемфигоидом, вульгарной пузырчаткой), с гематологическими патологиями, протекающими со спленомегалией (лейкозами, лимфомами, аутоиммунными гемолитическими анемиями) с болезнями почек. ПКП дифференцируют с заболеваниями печени, гемохроматозом, надпочечниковой недостаточностью. Острые порфирии следует дифференцировать с хирургическими заболеваниями, сопровождающимися сильной болью в животе, неврологическими и психиатрическими патологиями.

Лечение порфирий

Пациентов с острыми и эритропоэтическими порфириями необходимо госпитализировать отделение гематологии. Лечение ПКП возможно как в стационаре, так и в амбулаторных условиях. На сегодняшний день не существует эффективных методов, полностью ликвидирующих нарушения обмена порфиринов. Основной упор делается на патогенетическую и симптоматическую терапию, а также на устранение провоцирующих факторов. Способы лечения зависят от вида порфирий:

  • Острые. Для подавления образования порфобилиногена и ДАЛК применяют гем-аргинат, производные АТФ (аденил, рибоксин) и большие дозы глюкозы с дальнейшим переходом на высокоуглеводную диету. Для купирования вегетативной симптоматики используют октреотид, для ускорения восстановления миелина в нервных волокнах — витамины группы В. При менструалозависимых атаках эффективна овариосупрессивная терапия. С этой целью назначают агонисты гонадотропин-рилизинг гормона.
  • Эритропоэтические. Данные порфирии очень плохо поддаются терапии. Основное лечение – это защита кожных покровов от солнечного света (окна со стеклом, не пропускающим ультрафиолет, закрытая одежда, фотозащитные кремы, прием бета-каротина). Необходимо обрабатывать эрозии антисептическими растворами для профилактики инфекционных осложнений. При выраженном гемолизе показана спленэктомия. В некоторых случаях болезни Гюнтера эффективной оказывается трансплантация костного мозга. При ЭПП дополнительно назначаются гепатопротекторы (урсодезоксихолевая кислота, адеметионин) и антицирротическая терапия.
  • ПКП. С целью удаления порфиринов и избытка железа проводят плазмаферез и флеботомию (кровопускания). При противопоказаниях к данным процедурам назначаются аминохинолиновые (хлорохин) и комплексообразующие (дефероксамин) препараты. Для уменьшения всасывания порфиринов в желудочно-кишечном тракте применяют энтеросорбенты (активированный уголь). Также используются солнцезащитные кремы. При наличии гепатита С необходима противовирусная терапия интерфероном-альфа и рибавирином.

Прогноз и профилактика

В большинстве случаев порфирии являются тяжелыми заболеваниями с неблагоприятным прогнозом. При эритропоэтических формах продолжительность жизни составляет около 30 лет, смерть наступает от интеркуррентных инфекций. ЭПП часто приводит к циррозу печени. При атаках острых порфирий летальный исход наблюдается в 15-20%, основная причина смерти – паралич дыхательных мышц. При ПКП прогноз благоприятный, тяжелых осложнений не происходит. Для предупреждения рецидивов рекомендуется избегать провоцирующих факторов – инфекций, голодания, стрессов, длительной инсоляции, употребления алкоголя и определенных лекарственных средств. Людям, у которых в семье есть больной порфирией, необходимо определять активность ферментов цикла синтеза гема и проводить ДНК-диагностику для выявления генетических мутаций.

МКБ-10 | МКБ-10 | DSM IV: D60-D64 Апластические и другие анемии


Глава III

Заболевания крови и кроветворных органов и некоторые нарушения, связанные с иммунным механизмом
(D50-D89)

Апластические и другие анемии
(D60-D64)

D60 Приобретенная аплазия чистых эритроцитов [эритробластопения]
Latin: Anemia aplastica acquisita
Включает: (приобретенная эритроцитарная аплазия) ) (с тимомой)
D60.0 Хроническая приобретенная чистая аплазия эритроцитов
D60.1 Временная приобретенная чистая аплазия красных кровяных телец
D60.8 Другая приобретенная чисто красная клеточные аплазии
D60.9 Приобретенная чистая аплазия эритроцитов, неуточненная
D61 апластические анемии
Latin: Anemia aplastica alia
Исключено: агранулоцитоз (D70)
D61.0 Конституциональная апластическая анемия
Аплазия, (чистая) эритроцитов:
· врожденная
· младенцы
· первичная
синдром Блэкфана-Даймонда
Семейная гипопластическая анемия

Анемия Фанкони с пороками развития
D61.1 Апластическая анемия, вызванная лекарственными средствами
Используйте дополнительный код внешней причины (глава XX), чтобы идентифицировать лекарство.
D61.2 Апластическая анемия, вызванная другими внешними агентами
Используйте дополнительный код внешней причины (Глава XX), если хотите, для определения причины.
D61.3 Идиопатическая апластическая анемия
D61.8 Другие уточненные апластические анемии
D61.9 Апластическая анемия неуточненная
Гипопластическая анемия БДУ
Медуллярная гипоплазия
Панмиелофтис
11 11
Острая постгеморрагическая анемия
Latin: Anemia posthaemorrhagica acuta
Исключено: врожденная анемия вследствие кровопотери плода (P61.3)
D63 * Анемия при хронических заболеваниях, классифицированных в других рубриках
Latin: Анемия при хроническом заболевании aliis
D63.0 * Анемия при опухолевых заболеваниях (C00-D48 +)
D63.8 * Анемия при других хронических заболеваниях, классифицированных в других рубриках
Использование
D64 Другие анемии
Latin: Anaemiae aliae
Исключено: рефрактерная анемия:
.4)
· с избытком бластов (D46.2)
· с трансформацией (D46.3)
· с сидеробластами (D46.1)
· без сидеробластов (D46.0)
D64.0 Наследственная сидеробластная анемия
Гипохромная сидеробластная анемия, связанная с полом
D64.1 Вторичная сидеробластная анемия, вызванная заболеванием
Дополнительный код , при желании, выявить болезнь.
D64.2 Вторичная сидеробластная анемия, вызванная лекарствами и токсинами
Используйте дополнительный код внешней причины (Глава XX), если хотите, для определения причины.
D64.3 Другие сидеробластные анемии
Сидеробластная анемия:
· NOS
· пиридоксин-зависимая анемия NEC
D64.4 Врожденная дизеритропоэтическая анемия
Дисгематопоэтическая анемия (врожденная)
Исключено: Болезнь Даймонд-Даймонда (D61.0) C94.0)
D64.8 Другие уточненные анемии
Детская псевдолейкемия
Лейкоэритробластная анемия
D64.9 Анемия неуточненная

Версия МКБ-10: 2016 г.

Справка по расширенному поиску

Расширенный поиск позволяет выполнять поиск по выбранным свойствам классификации. Ты возможность поиска по всем свойствам или только по выбранному подмножеству

Во-первых, вам нужно введите ключевые слова в поле Search Text , затем проверьте свойства, которые вы хотите включить в поиск.

Система будет искать ключевые слова в свойствах, которые вы проверили и оценили результаты аналогично поисковой системе

Результаты будут отображены на панели результатов поиска. Если поисковый запрос дает более 200 результатов, то только первые 200 будут отображается.

Если вы укажете более одного ключевого слова, система поиск товаров, в которых есть все ключевые слова.

Подстановочные знаки: Вы также можете использовать подстановочный знак *. см. примеры ниже.

Оператор ИЛИ : можно получить результаты, которые либо то, либо другое ключевое слово. См. Пример 4.

Примеры:

1. Поисковый текст: диабет {находит все слова «диабет» в поля поиска}

2.Текст для поиска: diabet * {находит все слова, начинающиеся с «диабет»}

3. Поиск по тексту: diabet * mellitus {находит все слова, в которых есть начинается с «диабет» и также содержит слово «сахарный диабет»}

4. Поиск по тексту: tubercul * (легкое ИЛИ гортань) {находит все слова, в которых есть начинается с «туберкулеза» и затем включает в себя легкое ИЛИ гортань

Результаты поиска

После поиска результаты отображаются в правом нижнем углу экрана.Здесь в программе перечислены названия категорий МКБ, в которых выполняется поиск. ключевые слова найдены.

Нажав на любой результат, вы попадете в эту категорию

Вы можете закрыть окно расширенного поиска, щелкнув X в верхнем левом углу окна.

Размер панели результатов поиска можно изменить, перетащив горизонтальную линию над ней.

A Фаза 3, многоцентровое, рандомизированное, двойное слепое, плацебо-контролируемое, исследование динатрия фостаматиниба в лечении wAIHA — Просмотр полного текста

57311 [email protected] 85435 [email protected] 905 Пиманова, д.м.н. 905 [email protected][email protected]5 905 Больница Vall d’Hebron 9214 [email protected]6481 [email protected]
Banner MD Anderson Cancer Center
Гилберт, Аризона, США, 85234
Контактное лицо: Лиза Бисмарк 480-256-5463 Лиза[email protected]
Контактное лицо: Андреа Винкль 480-256-3421 [email protected]
Клиника Майо Больница
Феникс, Аризона, США, 85054
Контактное лицо: Ayodele Adeyemi 480-342-6066 [email protected]
Главный исследователь: Leslie Padrnos, MD
Arizona Oncology, Arizona Oncology PC
Тусон, Аризона, США, 85711
Контактное лицо: Ричард Розенберг, MD 520-668-5678 Стейси[email protected]
Главный исследователь: Ричард Розенберг, доктор медицины
Moores UC San Diego Cancer Center
Ла-Хойя, Калифорния, США,
Контактное лицо: Брэндон Палугод 858-822-2974 [email protected]
Контактное лицо: Лен Лазаро 858-822-3708 llazaro @ health.ucsd.edu
Главный исследователь: Шрила Гопал, доктор медицины
Университет Южной Калифорнии
Лос-Анджелес, Калифорния, США,
Контактное лицо: Кэролайн Пиатек, MD 323-865-3950 [email protected]
Контактное лицо: Никко Грабб 323-865-0579 ngrubb @ usc.edu
Главный исследователь: Кэролайн Пиатек, доктор медицины
Гавань Калифорнийского университета в Лос-Анджелесе — Институт Лундквиста
Торранс, Калифорния, США,
Контактное лицо: Эмили Онг Эмили[email protected]
Контактное лицо: Кэти Лабарбера [email protected]
Главный исследователь: Сара Томассетти, доктор медицины
Институт надежды и инноваций онкологии
Уиттиер, Калифорния, США,
Контактное лицо: Ричи Агаджанян, доктор медицины 562-693-4477 kbettino @ airesearch.us
Главный исследователь: Ричи Агаджанян, MD
Banner MD Anderson Cancer Center at North Colorado Medical Center
Грили, Колорадо, США, 80538
Контактное лицо: Самуэль Шелански, MD 970-810-3894 [email protected]
Контактное лицо: Мэнди Гарза 970-451-1412 BMDACCResearchCOMailbox @ bannerhealth.com
Джорджтаунский университет
Вашингтон, округ Колумбия, США, 20007
Контактное лицо: Кэтрин Брум, доктор медицины 202-444-8240 [email protected]
Контактное лицо: Хелена Джейкобс 202-687 -4868 [email protected]
Главный исследователь: Кэтрин Брум, MD
Онкологи из Северной Флориды
Джексонвилл, Флорида, США, 32256
Контактное лицо: Дженни Баххофер, CHRC 904-363-7462 доб. 1179 Дженни[email protected]
Контактное лицо: Тара Колдуэлл 904-519-2727 [email protected]
Институт рака Пьемонта
Атланта, Джорджия, США, 30318
Контактное лицо: Тревор Файнштейн, MD 404-350-9853 [email protected]
Контактное лицо: Кэти Адамс 678-298-3238 KAdams @ piedmontcancerinstitute.com
Главный исследователь: Trevor Feinstein, MD
Аффилированные онкологи
Chicago Ridge, Illinois, United States, 60415
Контактное лицо: Эми Берч, RN, BSN, OCN 708-634-4786 [email protected]
Контактное лицо: Дженнифер Баркер (708) 424 -9710 [email protected]
Медицинский центр Джона Хопкинса Бэйвью
Балтимор, Мэриленд, США, 21205
Контактное лицо: Rakhi Naik, MD 410-955-3616 [email protected]
Контактное лицо: Йетунде Олагбаджу 410-955-3616 [email protected]
Главный исследователь: Rakhi Naik, MD
Массачусетская больница общего профиля
Бостон, Массачусетс, США, 02114
Контактное лицо: Дэвид Кутер, MD 617-726-8033 dkuter @ partners.org
Главный исследователь: Дэвид Кутер, MD
Комплексные онкологические центры Невады
Лас-Вегас, Невада, США, 89169
Контактное лицо: Мелисса Викунья, RN 702-540-0721 [email protected]
Контактное лицо: Кхин Вин 702-952-3834 khin.win @ usoncology.com
Главный исследователь: Кларк Джин, доктор медицины
Рутгерс — Медицинская школа Роберта Вуда Джонсона
Нью-Брансуик, Нью-Джерси, США, 08901
Обращаться: Shuang Guo, MD 732-235-7115 [email protected]
Контактное лицо: Ким Уайт 732-235-7115 [email protected]
Главный исследователь: Шуанг Го, MD
Медицинский центр Монтефиоре
Бронкс, Нью-Йорк, США, 10461
Контактное лицо: Ирина Мураховская, MD 718-430-2748 hinguyen @ montefiore.org
Контактное лицо: Хиеу Нгуен Крауч
Главный исследователь: Ирина Мураховская, MD
Duke Cancer Network
Клейтон, Северная Каролина, США, 27520
Контактное лицо: Айви Алтомаре, MD 919-419-5410 [email protected]
Контактное лицо: Ким Уорд, RN 919-419-5410 kim [email protected]
Главный исследователь: Ivy Altomare, MD
Медицинский университет Южной Каролины
Чарльстон, Южная Каролина, США, 29425
Контактное лицо: Чарльз Гринберг, MD 843-792-4271 [email protected]
Контактное лицо: Daniel Reuben, MD 843-792-4271 reubend @ musc .edu
Главный исследователь: Чарльз Гринберг, MD
Техасский онкологический центр — Центр рака Саммонса
Даллас, Техас, США, 75246
Контактное лицо: Джонатан Ханцингер 214-370-1942 [email protected]
Контактное лицо: Хьюстон Холмс, Мэриленд (214) 370-1000
Главный исследователь: Houston Holmes, MD
Clear Lake Specialties
Вебстер, Техас, США, 77598
Контактное лицо: Амир Салам, Мэриленд 281-316-0247 angel @ omniclinicalresearch.com
Главный исследователь: Амир Салам, MD
Шведский институт рака
Сиэтл, Вашингтон, США, 98104
Контактное лицо: Ливия Хегерова, доктор медицины 206-991-2040 [email protected]
Контактное лицо: Нил Бейли 206-215-1471 neil.bailey @ swedish.org
Главный исследователь: Ливия Хегерова, доктор медицины
Вашингтонский университет
Сиэтл, Вашингтон, США, 98109
Контактное лицо: Андрей Шустов, 98109 206-606-7679 ashustov @ seattlecca.org
Контактное лицо: Коди Хаммер 206-606-6984 [email protected]
Главный исследователь: Терри Герншаймер, MD
Versiti, Wisconsin
Милуоки, Висконсин, США, 53226
Контактное лицо: Стивен Фраймарк 414-937-6814 [email protected]
Контактное лицо: Стефани Джонс 414-937-6821 sjones2 @ versiti.org
Главный исследователь: Джошуа Филд, MD
Онкологический центр Клиники Маршфилда — Стивенс Пойнт
Стивенс Пойнт, Висконсин, США, 54482
Контактное лицо: Стефани Энгелиен, RN 715-295-3049 [email protected]
Контактное лицо: Барби Гилдензопф, RN 715-393-1433 [email protected]
Главный исследователь: Adedayo Onitilo, MD
Общая больница Concord Repatriation
Сидней, Новый Южный Уэльс, Австралия, 2139
Контактное лицо: Салман Момин +61 2 97677786 [email protected]
Главный исследователь: Илона Каннингем, Мэриленд
Отделение онкологических исследований
Брисбен, Квинсленд, Австралия, 4201
Контактное лицо: Роберт Берд, Мэриленд +61 7 3176 6826 Джейсон[email protected]
Контактное лицо: Джейсон Келли [email protected]
Главный исследователь: Роберт Берд, доктор медицины
Больница Альфреда
Мельбурн, Виктория, Австралия, 3004
Контактное лицо: Huyen Tran, MD +61 408780 785 [email protected]
Главный исследователь: Huyen Tran, MD
Royal Perth Больница
Перт, Западная Австралия, Австралия, 6000
Контактное лицо: Лиза Форсайт +61 9 9224 8478 Лиза[email protected]
Главный исследователь: Питер Тан, MD
Universitätsklinik Innsbruck — Innere Medizin V
Инсбрук, Австрия, 6020
Контактное лицо: Доминик Вольф, доктор медицины +43512504 24003 [email protected]
Контактное лицо: Эльке Адамски-Кондерт +43512504 80308 elke [email protected]
Universitätsklinikum Salzburg, 3.Medizin / Onkologie
Зальцбург, Австрия, 5020
Контактное лицо: Ричард Грейл, MD +43 5 7255 25801 [email protected]
Контактное лицо: Михаэла Шахнер +43 5 7255 25823 [email protected]
Венский медицинский университет
Вена, Австрия, 1090
Контактное лицо: Ulrich Jaeger, MD +43 1 40 400 44100 [email protected]
Контактное лицо: Филипп Стабер +43 1 40 400 44100 [email protected]
Hanusch-Krankenhaus
Вена, Австрия, 1140
Контактное лицо: Майкл Филлитц, MD +431
Контактное лицо: Барбара Диксер +43 1
Витебская областная клиническая больница
Витебск, Беларусь, 210037
Контактное лицо: Сергей Пиманов, MD +375297130840 [email protected]
Контактное лицо: Леонид Сапеха, MD +375333055489 [email protected]
Витебский областной клинический онкологический диспансер
Витебск, Беларусь, 210603
Контактное лицо: Татьяна Михайлова, MD +375336751504 lenusja-78 @ mail.ru
Контакт +375797188691 [email protected]
Главный исследователь: Татьяна Михайлова, доктор медицины
Ziekenhuis Network Antwerp, Stuivenberg
Антверпен, Бельгия, 2060
Контактное лицо: Том Эйкманс, MD +32 32177448 [email protected]
Контактное лицо: Ка Лунг Ву +32 32177448 калунг[email protected]
Университетская клиника Антверпена
Edegem, Бельгия, 2650
Контактное лицо: Кирстен Саевелс, MD +32 38323193 [email protected]
Контактное лицо: Zwi Berneman, MD +32 3-821 3915 [email protected] быть
AZ Николаас
Синт-Никлас, Бельгия, 9100
Контактное лицо: Изабель Ванде Брук, доктор медицины +32 3-7602861 [email protected]
Контактное лицо: Griet Huysmans +32 037607873 [email protected]
«Университетская многопрофильная больница активного лечения — доктор Георгий Странски» EAD, Плевен, Клиника клинической гематологии
Плевен, Болгария, 5800
Контактное лицо: Николай Цветков, MD +359 64 886 392 tzvetkovn @ yahoo.com
Главный исследователь: Николай Цветков, д.м.н.
«Университетская многопрофильная больница активного лечения» Свети Георги «ЕАД, г. Пловдив, Клиника медицинской онкологии
Пловдив, Болгария, 4002
Контактное лицо: Иванка Ненова, доктор медицины +359 885 612 061 [email protected]
Главный исследователь: Иванка Ненова, доктор медицины
«Специализированная больница активного лечения Гематологические болезни »ЕАД, София, Клиника клинической гематологии
София, Болгария, 1756
Контактное лицо: Мартин Дончев, MD +359 877 676 134 [email protected]
Главный исследователь: Мартин Дончев, MD
ЕАД «Университетская многопрофильная больница активного лечения» Света Марина «, Варна, Клиника клинической гематологии
Варна, Болгария, 9010
Контактное лицо: Розен Рачев, доктор медицины +359 888 817 873 [email protected]
Главный исследователь: Розен Рачев, доктор медицины
Гамильтонские медицинские науки — Университет Макмастера Медицинский центр
Гамильтон, Онтарио, Канада, L8S 4K1
Обращаться: Дональд Арнольд, MD 905-525-9140 доб. 28603 jamulae @ mcmaster.ca
Контактное лицо: Эрин Джамула 905-525-9140 доб. 26800 [email protected]
Главный исследователь: Дональд Арнольд, MD
Больница Оттавы
Оттава, Онтарио, Канада, K1H8L6
Контактное лицо: Алан Тинмаут, MD 613-737-8899 [email protected]
Контактное лицо: Хизер Ланглуа 613-737-8899 hlanglois @ ohri.ок.
Главный исследователь: Алан Тинмаут, MD
Госпиталь Св. Михаила
Торонто, Онтарио, Канада, M5B 1W8
Контактное лицо: Видуши Сваруп, MSc 416-864-6060 доб 2408 [email protected]
Главный исследователь: Мишель Шольцберг, MD
Fakultni nemocnice Brno Interni hematologicka a onkologicka klinika
Брно, Чехия, 625 00
Контактное лицо: Иржи Майер, доктор медицины, доктор философии +420 532 233 642 майер[email protected]
Контактное лицо: Libor Cervinek, MD, PhD +420 532 232 215 [email protected]
Главный исследователь: Jiri Mayer, MD
Fakultni nestramatva Kölnica
Острава, Чехия, 70852
Контактное лицо: Яромир Гумулец, доктор медицины +420 597 372296 яромир[email protected]
Контактное лицо: Jana Zuchnicka, MD +420 597 372217 [email protected]
Главный исследователь: Jaromir Gumulec, MD
Ustav Hematologie
Прага, Чехия, 128 00
Контактное лицо: Ярослав Чермак, доктор медицины, доктор философии +420 221 977 320 [email protected]
Контактное лицо: Жаклин Соукупова Маалуфова, доктор медицины +420221977315 [email protected]
Главный исследователь: Ярослав Чермак, доктор медицины
Ольборгский университет Хопитал
Ольборг, Дания, 9000
Контактное лицо: Peter-Diedrich Jensen, MD +45 97 66 38 84 pdmj @ rn.dk
Контактное лицо: Санне Кьер +45 97 66 38 84 [email protected]
Главный исследователь: Петер-Дидрих Йенсен, MD
Больница Херлев и Гентофте
Херлев, Дания, DK-2730
Контактное лицо: Андреас Глентхой, MD: +45 38 68 63 65 [email protected]
Контактное лицо: Лиза Гулдхаммер +45 38 68 64 10 лиза[email protected]
Главный исследователь: Андреас Глентхой, MD
CHU Angers
Анже, Франция, 49100
Контактное лицо: Corentin Orvain, MD +33 2 41 35 44 75 [email protected]
Контактное лицо: Мелани Ле Ван Суу +33 2 41 35 67 26 [email protected]
Главный исследователь: Корентин Орвэн, MD
Institut d’hématologie de Basse Normandie, CHU Caen
Кан, Франция, 14033
Контактное лицо: Стефан Шез, доктор медицины +33 2 31 29 72 60 [email protected]
Контактное лицо: Эммануэль Жирар +33 2 31 27 26 79 girard [email protected]
Главный исследователь: Стефан Шез, MD
CHU Estaing
Клермон-Ферран, Франция, 63003
Контактное лицо: Марк Руивар, доктор медицины +33 4 73 75 00 85 mruivard @ chu-clermontferrand.fr
Контактное лицо: Céline Feugère +33 4 73 75 51 27 [email protected]
Главный исследователь: Marc Ruivard, MD
CHU Henri Mondor
Кретей, Франция,
Контактное лицо: Марк Мишель, MD +33 1 49 81 20 76 [email protected]
Контактное лицо: Николас Лимал, MD +33 1 49 81 20 76 nicolas [email protected]
Главный исследователь: Марк Мишель, MD
Hôpital Saint Antoine
Париж, Франция, 75012
Контактное лицо: Оливер Файн, MD +33 1 71 97 05 84 [email protected]
Контактное лицо: Delphine Gobert, MD +33 1 71 97 07 64 delphine .gobert @ aphp.fr
Главный исследователь: Oilver Fain, MD
CHU de Bordeaux — GH Sud- Hôpital Haut Lévêque Service Médecine Interne et Maladies Infectieuses
Пессак, Франция, 33603
Контактное лицо: Жан-Франсуа Виалар, доктор медицины +33 5 57 65 64 83 Жан-Франсуа[email protected]
Контактное лицо: Ирен Машеларт, доктор медицины +33 5 57 65 64 83 [email protected]
Главный исследователь: Жан-Франсуа Виаллар, доктор медицины
CHU Toulouse, IUCT Oncopôle
Тулуза, Франция, 31100
Контактное лицо: Thibault Comont, MD +33 5 41 15 62 66 [email protected]
Контакт +33 5 31 15 63 57 [email protected]
Главный исследователь: Тибо Комонт, MD
Гематологический центр М. Зоделава, Тбилиси
Тбилиси, Грузия, 0112
Контактное лицо: Мамия Зоделава, MD +995 322-253-044 iro111 @ yahoo.co.uk
Контактное лицо: Ирине Датикашвили-Давид, MD [email protected].uk
Главный исследователь: Мамия Зоделава, MD
LTD Многопрофильная клиника Consilium Medulla
Тбилиси, Грузия, 0186
Контактное лицо: Магдана Бетанели, MD +995 322-122-002 [email protected]
Контактное лицо: Елена Долмазашвили [email protected]
Главный исследователь: Магдана Бетанели, доктор медицины
Universitätsklinikum Essen
Эссен, Германия, 45147
Контактное лицо: Александр Рет, доктор медицинских наук +49 201 723-84219 [email protected]
Контактное лицо: Феррас Алашкар, доктор медицинских наук +49 204723-84684 ferras [email protected]
Медицинский центр Лейпцигского университета, медицинское отделение I — гематология и клеточная терапия, медицинская онкология, гемофилия
Лейпциг, Германия, 04103
Semmelweis Egyetem, Általános Orvostudományi Kar, I.sz. Belgyógyászati ​​Klinika, Haematológiai Osztály,
Будапешт, Венгрия, 1083
Контактное лицо: Zsolt Nagy, MD, PhD + 36 20 825 8660 [email protected]
Контактное лицо: Пал Дьёрдь Надь + 36 20 943 6465 [email protected]
Сабольч-Сатмар- Берег Мегей Корхазо-Эгосат египет 26
Ньиредьхаза, Венгрия, 4400
Контактное лицо: Ласло РЕЙТО, доктор медицинских наук, + 36 70 316 3930 [email protected]
Контактное лицо: Жолт Хорват +36 20 998 5123 horvathzmail.com
Pécsi Tudományegyetem, Klinikai Központ, I.számú Belgyógyászati ​​Klinikai, Hematológiai Tanszék
Печ, Венгрия, 7624
Контактное лицо: Агнес Надь, доктор медицины, доктор философии + 36 30 359 5067 [email protected]
Контактное лицо: Габор Коллар + 36 30 542 4314 [email protected]
ASST degli Spedali Civili di Brescia, Ematologia UOC
Брешиа, Италия, 25123
Fondazione IRCCS Ca’Granda — Ospedale Maggiore Policlinico di Milano — UO Ematologia
Милан, Италия, 20122
Контактное лицо: Wilma Barcellini, MD 0255033256 [email protected]
Контактное лицо: Джулия Милези, MD 0255033050 [email protected]
Главный исследователь: Вильма Барчеллини, MD
SCDU Ematologia de AOU «Maggiore»
Новара, Италия, 28100
Контактное лицо: Андреа Патриарка, MD 03213732709 Андреа[email protected]
Контактное лицо: Клара Де Амброджи де Амброджи 03213732709 [email protected]
Главный следователь: Андреа Патриарка, MD
Ospiversedale Maggiore, Университет Азитарматариа Джулиано Исонтина
Триест, Италия, 34125
Контактное лицо: Francesco Zaja, MD 0039 04039
Главный исследователь: Francesco Zaja, MD
ULSS8 Berica Ospedale San Bortolo — Unità Operativa Complessa di Ematologia
Виченца, Италия, 36100
Контактное лицо: Эрос Ди Бона, MD +39 0444753518 [email protected]
Контактное лицо: Джузеппе Карли +39 0444753679 г[email protected]
Главный исследователь: Eros Di Bona, MD
Academic Medical Center Amsterdam
Амстердам, Нидерланды
Контактное лицо: секретарь гематологии +31 (0) 20-5665785 [email protected]
Главный исследователь: Жозефина Вос, доктор медицины
Госпиталь при университете Хаукеланда
Берген, Норвегия, 5021
Контактное лицо: Tor Henrik Anderson Tvedt, MD +47 92 40 19 13 [email protected]
Контактное лицо: Анита Бёттер-Бревик +47 55 97 53 62 [email protected]
Главный исследователь: Тор Хенрик Андерсон Тведт, MD
Østfold Hopital
Grålum, Норвегия, 1714
Контактное лицо: Waleed Ghanima, MD +47 69 86 00 00 [email protected]
Контактное лицо: Anne Marie Halstensen +47 994 11 928 [email protected]
Главный исследователь: Waleed Ghanima, MD
Больница Олесунна
Олесунн, Норвегия, 6017
Контактное лицо: Кристоффер Эксенвог Санд, MD +47 92 85 92 69 [email protected]
Контактное лицо: Элизабет Теннёй Бьеркан +47 70 10 61 52 Элизабет[email protected]
Главный исследователь: Кристоффер Эксенвог Санд, доктор медицины
Клиническая больница Колтеа
Бухарест, Румыния, 030171
Контактное лицо: Габриэла Борсару, MD 0040 744 150 652 [email protected]
Главный исследователь: Габриэла Борсару, MD
Университетская больница скорой помощи Бухарест
Бухарест, Румыния, 050098
Контактное лицо: Ана Мария Владареану, MD 0040 722 715 556 anamariavladareanu @ yahoo.com
Главный исследователь: Ана Мария Владареану, MD
Институт онкологии им. профессора Иона Чирикута Клуж-Напока
Клуж-Напока, Румыния, 400015
Контактное лицо: Делия Моника Дима, MD 0040 722 957 677 [email protected]
Контактное лицо: Daniela Dragancea, MD 0040752773029 Daniela6 @ yahoo.com
Главный исследователь: Делия Моника Дима, MD
Национальный исследовательский центр гематологии
Москва, Российская Федерация, 125167
Контакт: Кира Лукина +7 1 91 39 [email protected]
Московская городская клиническая больница им. Боткина
Москва, Российская Федерация, 125284
Контактное лицо: Елена Адо +7 917 394 19 25 адо[email protected]
Государственное бюджетное учреждение здравоохранения города Москвы «Городская клиническая больница № 40 Департамента здравоохранения города Москвы»
Москва, Российская Федерация, 129301
Контактное лицо: Наталья Чернова, д.м.н. +7 916 660 27 63 7
Государственное бюджетное учреждение здравоохранения Новосибирской области «Городская клиническая больница №2»
Новосибирск, Россия, 630051
Контактное лицо: Любовь Шпагина, д.м.н. +7 383279 01 65 мкб-2 @ яндекс.ru
Контактное лицо: Евгений Локтин, д.м.н. +7 383 278 81 18 [email protected]
Главный исследователь: Любовь Шпагина, д.м.н. Здравоохранение Краснодарского края
Сочи, Российская Федерация, 354057
Контактное лицо: Наталья Шаповалова +7 918 611 38 55 sochitrials @ gmail.com
Контактное лицо: Светлана Ильина +7 988 415 84 40 [email protected]
Главный исследователь: Дмитрий Удовица, д.м.н.
Областное государственное автономное учреждение здравоохранения «Томская областная клиническая больница»
Томск, Россия, 634063
Контактное лицо: Екатерина Буданкова, д.м.н. +7 903 953 17 31 budfed83 @ mail.ru
Контактное лицо: Анастасия Егорова, д.м.н. +7 382263 00 64 [email protected]
Главный исследователь: Екатерина Буданкова, д.м.н.
Белград, Сербия, 11080
Контактное лицо: Оливера Маркович, доктор медицинских наук, +381638585244 [email protected]
Контактное лицо: Данка Вагич +381113010707 [email protected]
Клинический центр Ниш, Гематологическая клиника
Ниш, Сербия, 18000
Контактное лицо: Иван Тиянич, доктор медицины, доктор философии +38164 1198 028 [email protected]
Контактное лицо: Зоран Радованович, доктор медицины, доктор философии +38118506906 kcnissrb @ gmail.com
Клинический центр Воеводины, Гематологическая клиника
Нови-Сад, Сербия, 21000
Контактное лицо: Ивана Урошевич, доктор медицины, доктор философии +38169 747 557 [email protected]
Контактное лицо: Дусица Кременович +381214872214 [email protected]
Барселона, Испания, 08035
Контактное лицо: Дэвид Валькарсель, MD +349348 доб. 6417 DVALCARCEL @ VHIO.NET
Контактное лицо: Елена Санчес 34 60 00 доб. 4976 [email protected]
Госпиталь Clinic de Barcelona
Барселона, Испания, 08036
Контактное лицо: Джоан Сид, MD +34 93 277 5448 [email protected]
Контактное лицо: Ракель Хименес +34
Больница Университарио Грегорио Мараньон
Мадрид, Испания, 28009
Обращаться: Ана Перес-Корраль, MD +34 8014 apcorral @ salud.madrid.org
Контактное лицо: Вероника Агилар [email protected]
Больница Universitario Puerta de Hierro de Majadahonda
Мадрид, Испания, 28222
Контактное лицо: Изабель Сальседо де Диего + 34
Больница Universitario Virgen del Rocio
Севилья, Испания, 41013
Контактное лицо: Мария Эва Мингот-Кастеллано, доктор медицины +34 955-013277 memingot @ gmail.com
Контактное лицо: Мария Альварес-Оссорио Лопес +34 955-013277 [email protected]
Больница Universitario y Politecnico La Fe
Валенсия, Испания, 46026
Контактное лицо: Исидро Ярке, MD +34 96-386-27-45 [email protected]
Контактное лицо: Ева Домингес Мальфейто +34 616 929 448 Dominguez_eva @ gva.эс
Черкасский областной онкологический диспансер, гематологический центр
Черкассы, Украина, 18009
Контактное лицо: Галина Пилипенко, д.м.н. +380472319418
Главный научный сотрудник: Галина Пилипенко, д.м.н.
Городская клиническая больница № 4, Гематологический центр
Днепр, Украина, 49102
Контакты: Ганна Усенко, д.м.н. +380562580155 hemcenter81 @ укр.net
Ответственный исполнитель: Усенко Ганна, д.м.н.
Киевская городская клиническая больница №9, гематологическое отделение №1
Киев, Украина, 04112
Контактное лицо: Ульяна Мельник, доктор медицины +380444400311
Главный исследователь: Ульяна Мельник, доктор медицины
Центр гемофилии Восточного Кента, Кент и Кентерберийская больница
Кентербери, Кент, Соединенное Королевство, CT1 3NG
Контактное лицо: Джиллиан Эванс, MD 01227 783157 [email protected]
Контактное лицо: Сара Пиготт Пиготт 01227 784066 [email protected]
Главный исследователь: Джиллиан Эванс, MD
Бристольский центр гемофилии
Бристоль, Великобритания, BS2 8ED
Контактное лицо: Эндрю Харви 0117 3421872 [email protected]
Контактное лицо: Эмма Харви 0117 3421873 [email protected]
Центр гемостаза и тромбоза Роальда Даля, Больница Королевского Ливерпульского университета, Больницы Ливерпульского университета NHS Foundation Trust
Ливерпуль, Великобритания, L7 8XP
Контактное лицо: Дэвид Симкокс, MD 0151 706 3397 [email protected]
Контактное лицо: Микко Уилкинсон +44 0151 706 3397 [email protected]
Главный исследователь: Дэвид Симкокс, MD
Больница Royal Free, Фонд Royal Free London NHS Foundation Trust
Лондон, Великобритания, NW3 2QG
Контактное лицо: Маллика Сехар, MD 020 7472 6495 [email protected]
Контактное лицо: Эльза Арадом 0207794 0500 доб 33768 [email protected]
Главный исследователь: Маллика Сехар, MD
Больница Хаммерсмит
Лондон, Соединенное Королевство, W12 0HS
Контактное лицо: Camelia Vladescu, MD 020 331 34306 [email protected]
Контакт 020 331 34306 [email protected]
Больница Хаммерсмит
Лондон, Великобритания
Контактное лицо: Camelia Vladescu, MD 020331 34306 [email protected]
Контактное лицо: Zainab Alashe [email protected]
Главный исследователь: Camelia Vladescu, MD
The Royal London Hospital, Bart’s Health NHS Trust
Лондон, Великобритания
Контактное лицо: Frederick Chen, MD 02032460261 RLHHaemResearch @ bartshealth.nhs.uk
Контактное лицо: Atiqa Miah 02032460261 [email protected]
Главный исследователь: Frederick Chen, MD
NHS Trust Сэндвелл и Западного Бирмингема
Вест Бромвич, Соединенное Королевство, B71 4HJ
Контактное лицо: Фарук Вандру, MD 0121 507 3095 доб. 5358 Фарук[email protected]
Контактное лицо: Сесиль Ахмед 0121 507 3622 [email protected]
Главный исследователь: Фарук Вандру, MD

Диагностические траектории предшествующей множественной заболеваемости позволяют прогнозировать смертность от сепсиса3

9000 Общая цель состояла в том, чтобы оценить прогностическую ценность предыстории пациентов с сепсисом, используя их полный спектр других предшествующих диагнозов. Для этого типа анализа множественных заболеваний популяция пациентов должна быть большой, чтобы получить статистически значимое описание временного анамнеза диагнозов.Поэтому мы использовали регистр для всего населения, включающий 6,6 миллиона пациентов.

Последовательное определение когорты пациентов с сепсисом

Точное определение группы пациентов с сепсисом является ключевым шагом для того, чтобы в конечном итоге получить значимую оценку риска смертности. В литературе было предложено несколько подходов для определения групп пациентов с сепсисом на основе данных в медицинских записях, закодированных в терминологии МКБ-9 и МКБ-10 7,8,9 . Ангус и др. .предложил один метод, при котором пациенты с диагнозом «инфекция и органная дисфункция» классифицируются как пациенты с сепсисом 8 . Это широко используемый метод, однако недавнее исследование показало, что определение связано с неоптимальным положительным прогнозным значением 10 . Альтернативный подход, предложенный Ибрагимом и др. . имел значительно более высокую производительность 7,10 . Этот подход включает большинство пациентов с диагнозом A40 («стрептококковый сепсис») или A41 («другой сепсис»).В датской терминологии МКБ-10 сепсис охватывает девятнадцать диагнозов (дополнительная таблица 1), причем A41 («другой сепсис») является наиболее часто используемым (см. Дополнительные сведения в дополнительном тексте). В нашей более ранней работе по анализу самых сильных траекторий болезни с самым высоким относительным риском в будущем в датской популяции по широкому спектру заболеваний, A41 появлялся часто, фактически он был включен в 217 из 1171 повторяющихся траекторий, рассчитанных для 6,2 миллиона человек 5 .Поэтому мы изначально выбрали диагноз A41 для определения нашей популяции с сепсисом. NPR содержал группу из около 120 000 пациентов с сепсисом, у которых уровень 30-дневной смертности составлял 25% (eFig. 1). При подсчете наших пациентов, использующих «реализацию Ибрагима», 119 727 пациентов с сепсисом были разделены между нашим методом и «реализацией Ибрагима», наше определение охватывало еще 112 пациентов, тогда как «реализация Ибрагима» охватывала еще 6839, и этот простой подход является поэтому очень похож на «реализацию Ибрагима».Следовательно, он будет иметь очень похожие свойства при анализе чувствительности. В этом типе работы наиболее важно убедиться, что все пациенты, классифицируемые как пациенты с сепсисом, действительно имеют сепсис, в то время как это не повлияет на результаты каким-либо существенным образом, если мы потенциально пропустим небольшое количество пациентов, у которых также был сепсис (в качестве контрольной население без сепсиса составляет более 6 миллионов человек).

Смертность от сепсиса изменилась из-за 231 диагноза

Перед анализом риска, связанного с множественными диагнозами, мы исследовали, в какой степени отдельные диагнозы в предшествующей истории болезни пациентов с сепсисом значительно повлияли на 30-дневную смертность.Из 1051 диагноза трех уровней по МКБ-10 (с минимальным количеством пациентов, необходимым для статистического анализа, см. Методы) 231 диагноз значительно изменил относительный риск смерти от сепсиса ( RR умерло от сепсиса, ). См. EFig. 2 и дополнительный текст для более подробной информации.

Различные временные траектории заболевания, наблюдаемые в популяции сепсиса

Анализ корреляций между многими более ранними диагнозами, очевидно, может дать лучшее представление о состоянии здоровья пациента.Мы исследовали, как последовательности последовательных диагнозов (траектории болезни) изменили RR sepsis dead , чтобы получить более полное понимание связи между предшествующей историей болезни и риском смерти от сепсиса. Траектории временного заболевания были построены путем поиска всех значимо связанных диагнозов в парах и путем выбора диагнозов с временным направлением (где одно заболевание возникало значительно чаще, чем другое). Затем эти временные пары болезней были объединены в траектории временных последовательных заболеваний.В случае четырех стадий болезни, когда болезнь A предшествовала болезни B, B предшествовала C, а C предшествовала D, у нас были бы три временные пары болезней и траектория болезни, содержащая болезни A, B, C и D в этом порядке ( см. Методы).

В нашей популяции сепсиса, состоящей примерно из 120 000 пациентов, мы обнаружили 2 279 таких траекторий заболевания, состоящих из четырех последовательных заболеваний, при которых минимум 20 пациентов следовали всей траектории. На всех этих траекториях сепсис появился исключительно как четвертый и последний диагноз, подразумевая, что существует множество путей заболевания к сепсису.Однако в рамках примененных пороговых значений мы не обнаружили никаких траекторий, продолжающихся после сепсиса, что указывает на гораздо менее систематический характер сопутствующих заболеваний, возникающих после сепсиса.

Из 120 000 пациентов с сепсисом в нашей когорте 28 484 пациента следовали по крайней мере по одной из 2279 зависимых от времени траекторий болезни. Поскольку между временем клинического представления и датой постановки диагноза может быть некоторое несоответствие, следование траекториям в строгом хронологическом порядке может исключить пациентов с очень похожим течением заболевания.Ослабление критерия таким образом, чтобы определенные пары диагнозов могли появляться в разном порядке (пока сепсис был последним диагнозом) 40 247 пациентов с сепсисом следовали по крайней мере по одной из этих траекторий.

Подмножество 56 временных траекторий болезни предсказало более плохое состояние здоровья

Мы подсчитали RR умерших от сепсиса для пациентов, следующих хотя бы по одной траектории, по сравнению с пациентами с сепсисом, не следовавшими какой-либо траектории, чтобы исследовать прогностическую ценность траекторий смертности у этих пациентов .RR погибших при сепсисе был рассчитан с использованием метода Кокрана-Мантеля-Хензеля, который позволяет нам скорректировать возраст и пол. RR умерших от сепсиса для 28 484 пациентов, следовавших хотя бы по одной траектории строго в правильном порядке, составило 1,32 (p = 1,88 · 10 −77 ). RR погибших при сепсисе было 1,30 (p = 2,46 · 10 −82 ) для 40 247 пациентов, следующих траекториям диагнозов в расслабленном порядке, что указывает на способность траекторий заболевания прогнозировать более плохое состояние здоровья у пациента с сепсисом.Возраст пациентов, следующих по траектории, был значительно выше как для строгого, так и для расслабленного порядка (отношение шансов = 2,3 и 2,4 соответственно, p-значение <2,3 · 10 -308 для обоих, поправка на возраст при анализе смертности). Впоследствии мы создали сеть, основанную на всех траекториях, которая значительно изменила риск смерти (Бенджамини Хохберг скорректировал значение p <0,05), уменьшив количество траекторий с 2279 до 56 (рис. 1). Сеть состоит из 97 уникальных пар болезней (и соединяющих их ребер), которые появляются на любом из шагов 56 траекторий.Все индивидуальные траектории увеличились RR , умерло сепсиса, что явно подчеркивает способность траекторий предсказывать худший исход. Из 56 значимых траекторий 25 начинались со злоупотребления алкоголем, девять — с сахарным диабетом, а восемнадцать — с сердечно-сосудистыми диагнозами.

Рисунок 1

Сеть траекторий, которые значительно изменили RR сепсис погиб .

Сеть была построена из 56 значимых траекторий сепсиса и одновременно иллюстрирует количество пациентов, которым был поставлен конкретный диагноз (размер узла), и повышенный риск смерти от сепсиса в течение 30 дней на разных этапах траектории, соединяющих два диагноза (ширина стрелки).42 узла окрашены в соответствии с их отношениями к главам МКБ-10. Обратите внимание, что A41 был увеличен до 33% от его фактического размера, что соответствует 120 000 пациентов. Ширина стрелок указывает на средневзвешенное значение RR погибших при сепсисе для конкретного шага (на основе всех траекторий, содержащих этот шаг).

Злоупотребление алкоголем, диабет и анемия являются ключевыми диагнозами в сети траекторий сепсиса

На Рисунке 1 показаны все 56 значимых траекторий к сепсису в одной сети.Он имеет три основных отправных точки, упомянутых выше: «злоупотребление алкоголем», «инсулинозависимый сахарный диабет» (NIDDM) и сердечно-сосудистые диагнозы («стенокардия», «острый инфаркт миокарда» и «гипертония»). Часто появляется ряд других диагнозов, включая «другие анемии». В сети не появилось ни одного диагноза рака, хотя RR умерших от сепсиса для пациентов, имевших какие-либо новообразования (доброкачественные или злокачественные) до постановки диагноза сепсиса, составлял 1,24 (p = 1,2⋅10 −60 ) при подсчете на 120000 пациентов и 1 .18 (p = 4,97⋅10 −30 ) для пациентов, имевших какой-либо рак до сепсиса (таблица 1). Пациенты могут быть здоровыми до тех пор, пока не будет диагностирован рак 11 , который затем может спровоцировать сепсис. Следовательно, их общая история болезни может быть менее похожей по сравнению с пациентами с диабетом, что может объяснить отсутствие точных траекторий рака четырех заболеваний. Однако мы обнаружили семнадцать траекторий рака из 310 траекторий, состоящих только из трех заболеваний с сепсисом в качестве последнего диагноза.Сеть раковых заболеваний этих траекторий также показала, что анемия была главной связью между раком и сепсисом (рис. 2). Это также указывает на то, что отсутствие четырех траекторий рака было связано с отсутствием общей истории болезни, а не с незначительным влиянием на смертность от сепсиса.

Рисунок 2

Сеть рак-сепсис из трех траекторий, которые значительно изменили RR сепсис мертв .

Сеть была создана из шестнадцати трех траекторий сепсиса, каждая из которых содержит как минимум одно заболевание из блока МКБ-10 «Рак (C00-C96)» из главы 2 МКБ-10: Новообразования.Узлы окрашены в соответствии с их главой в МКБ-10. Их размер соответствует количеству больных сепсисом, которым поставлен конкретный диагноз. Ширина стрелок указывает на сепсис RR для конкретного шага на траектории.

Мы исследовали «злоупотребление алкоголем», «сахарный диабет» и анемию более подробно, извлекая траектории, содержащие эти конкретные диагнозы (рис. 3). Из-за ограниченного количества траекторий, представленных на рисунках 3, мы показали точную траекторию для всей группы пациентов, имея один (изогнутый) край, соединяющий все четыре заболевания.Мы наблюдали несколько альтернативных путей от диабета до сепсиса через пролежни, пневмонию, анемию и истощение объема (рис. 3а). Все траектории в диабетической сети начинались с NIDDM, за которым следовали две дополнительные сопутствующие патологии до сепсиса. Самый высокий риск был связан с «другими полинейропатиями», за которыми следовала «пневмония», но также с атеросклерозом, а впоследствии с ХОБЛ, предполагавшим высокий риск смерти от сепсиса (рис. 3а).

Рисунок 3

Подсети сепсиса из траекторий, которые значительно изменили RR сепсис мертв .

Три сети были построены из 56 значимых траекторий сепсиса, описанных на рис. 1. Непрерывная линия показывает группу пациентов, следующих по определенной многоступенчатой ​​траектории. Сюда входят все траектории, содержащие либо ( a ) инсулинозависимый или инсулиннезависимый сахарный диабет, либо ( b ) другие анемии или анемии при хронических заболеваниях, классифицированных в других рубриках, или ( c ) психические и поведенческие расстройства, вызванные употребление алкоголя.Узлы окрашены в соответствии с их главой МКБ-10. Ширина стрелок указывает на погибшего сепсиса RR для конкретной траектории.

Временные траектории заболевания в сети, начиная с «злоупотребления алкоголем», были гораздо более разнообразными, чем в сети диабетиков. Многие из этих путей включали общие осложнения алкоголизма, такие как «заболевания пищеварительной системы», «эпилепсия», «церебральный инфаркт» и полинейропатии (рис. 3b).

Анемия часто встречается у женщин в пременопаузе, однако распределение по возрасту и полу исключает это как основную причину в нашей популяции (eFig.3). Для всех траекторий в сети анемии анемия была последним диагнозом перед сепсисом. Сеть анемии-сепсиса выявила тот же образец отправных точек, что и полная сеть сепсиса, включая сосудистые заболевания, диабет и злоупотребление алкоголем. Траектории, включающие сосудистые заболевания, также имели два диагноза анемии до сепсиса. Траектории диабета имели сопутствующие диабетические заболевания до анемии и последующего сепсиса. Наконец, одна из траекторий, начавшаяся со «злоупотребления алкоголем», имела анемию до «печеночной недостаточности».

Сопутствующие заболевания объяснили различия в смертности от сепсиса при диабете

RR умерших от сепсиса для пациентов с диабетом недавно обсуждалось в литературе с исследованиями, указывающими как на более высокий, так и на более низкий риск смертности 12,13,14,15 . В нашем исследовании «инсулинозависимый сахарный диабет» (ИЗСД) увеличивал риск (RR умерших от сепсиса = 1,13, p = 1,77 · 10 −30 ), тогда как NIDDM не оказал никакого эффекта (RR умерших от сепсиса = 1,11, p = 0.15). При объединении IDDM и NIDDM, RR умерших от сепсиса составил 1,11 (p = 5,71 · 10 -9 ), что подчеркивает важное различие в силе ассоциации IDDM и NIDDM в отношении выживаемости при сепсисе.

Наши траектории включали девять траекторий диабета, которые значительно изменили RR умерших от сепсиса , восемь траекторий NIDDM, одну траекторию диабета IDDM и одну, содержащую как IDDM, так и NIDDM. Все девять траекторий увеличили риск смерти с RR, умершими от сепсиса, между 1.45 и 3.01. Помимо диабета, «злоупотребление алкоголем» и «другие анемии» были двумя другими основными диагнозами в нашей сети (рис. 1). Мы подсчитали RR погибших при сепсисе, связанных с любыми траекториями заболевания, содержащими определенные специфические диагнозы (рис. 4a). Траектория развития сахарного диабета была связана с умершим от сепсиса, равным 1,59 (значение p = 6,27 · 10 −23 ), но в сочетании с траекторией злоупотребления алкоголем или анемией RR умерших от сепсиса увеличилось до 2.44 (p = 5,83 · 10 −4 ) и 1,48 (p = 1,98 · 10 −4 ) соответственно. Если пациент следовал всем трем типам траекторий, RR умерших от сепсиса, было 3,11 (p = 4,44 · 10 −6 ). Разделение диабета на IDDM и NIDDM показало более высокую степень синергизма между анемией и NIDDM (RR умерших от сепсиса, = 2,80), чем анемия и IDDM (RR , умерших от сепсиса, = 1,84) (рис. 4b).

Рис. 4

Диаграммы Венна выбранных траекторий сепсиса, которые значительно изменили RR sepsis dead .

Диаграммы Венна показывают значимые значения RR , умерших от сепсиса, для групп пациентов, следующих по траекториям, содержащим сахарный диабет (E10, E11), злоупотребление алкоголем (F10) и / или анемию (D64), соответственно. Цветные цифры (внутри и снаружи трех эллипсоидов) указывают на то, что RR sepsis погиб в результате следования по траектории, содержащей этот конкретный диагноз, независимо от того, по какой из других траекторий следует пациент. Эллипсоиды без значений не имеют значения.

Независимая репликация с использованием шведского браузера коморбидности

Мы сравнили сопутствующие заболевания сепсиса, обнаруженные в наших данных, с не зависящим от времени браузером коморбидностей, созданным Даляньисом и др. . 16 . Браузер основан на 600 000 шведских пациентов и также использует терминологию МКБ-10 16 . Хотя браузер предоставлял доступ только к данным суммарного уровня (а не к данным индивидуального уровня), мы воспроизвели все три основные отправные точки в основной сети значимых траекторий, оба типа сахарного диабета, все четыре сердечных заболевания (I20, I21, I25 и I50), а также злоупотребление алкоголем были сопутствующими заболеваниями сепсиса в шведском исследовании (рис.5). Мы также подтвердили два кода анемии (D63 и D64), наблюдаемые в сети. Кроме того, мы подтвердили, что несколько видов рака были в значительной степени ассоциированы с сопутствующими заболеваниями, хотя количество пациентов с каждым отдельным раком в популяции сепсиса также было относительно небольшим в шведском наборе данных, что снова может объяснить отсутствие длины четырех траекторий рака-заболевания в нашем наборе данных. данные. В целом наши основные наблюдения сопутствующих заболеваний подтвердились в этой независимой когорте.

Рисунок 5

Сопутствующие заболевания сепсиса в шведском исследовании.

Этот рисунок показывает значительные сопутствующие заболевания в шведском исследовании Dalianis et al . 16 . Размер узла соответствует количеству пациентов в шведской когорте с этим кодом. Ширина стрелки указывает процент субпопуляции сепсиса с определенной коморбидностью. Длины расходящихся стрелок произвольны.

Классический путь комплемента опосредует микроглиозависимое ремоделирование спинномозговых моторных цепей во время развития и в SMA

02 Кат. RRID: AB_578478 545–148; RRID: AB_2340472 43, инъекции) N 02 2 Набор для экспресс-экстракции 26 6J

общий прямой 9260 Cremer 9260 общий прямой 9260 GGATGCTTGCCGAAGATAAGAGTG

Антитела
Козьи поликлональные анти-ChAT Millipore Cat # AB144P; RRID: AB_2079751
Кролик моноклональный анти-C1q Abcam Каталожный номер ab182451; RRID: AB_2732849
Кролик поликлональный античеловеческий C1q Agilent Кат. № A013602 RRID: AB_578496
Кролик поликлональный анти-C3d Dako
Крысиный моноклональный анти-CD45 Millipore Каталожный номер 05–1416, RRID: AB_10562966
Крысиный моноклональный анти-CD68 AbD Serotec Кат. RRID: AB_324217
Кроличьи поликлональные анти-GFAP Dako Кат. № Z0334; RRID: AB_10013382
Мышиный моноклональный анти-GFAP Sigma-Aldrich Кат. № G3893; RRID: AB_477010
Кроличьи поликлональные анти-Iba1 Wako Кат. № 019–19741; RRID: AB_839504
Козий поликлональный анти-Iba1 Abcam Каталожный номер ab5076; RRID: AB_2224402
Кроличьи поликлональные антитела против нейрофиламента Millipore Каталожный номер AB1987; RRID: AB_
Куриный поликлональный анти-парвальбумин Этот документ Н / Д
Мышиный моноклональный анти-SMN BD Biosciences Cat # 610646; RRID: AB_397973
Поликлональный анти-синаптофизин для морских свинок Synaptic Systems Каталожный № 101 004; RRID: AB_1210382
Мышиные моноклональные антитела против TMEM119 Лаборатория Беннета Н / Д
Мышиные моноклональные антитела против альфа-тубулина Sigma-Aldrich Кат. № T9026; RRID: AB_477593
Поликлональные анти-VGAT для морских свинок Synaptic Systems № по кат. 131004; RRID: AB_887873
Поликлональные анти-VGluT1 у морских свинок Эта статья НЕТ
Alexa Fluor 488 против козлов осла Jackson ImmunoResearch Cat # 705–540–003
Alexa Fluor 488 осел против кролика Jackson ImmunoResearch Cat # 711–545–152, RRID: AB_2313584
Alexa Fluor 488 осел против морских свинок Jackson ImmunoResearch #
Alexa Fluor 488 против цыплят осла Jackson ImmunoResearch Cat # 703–545–155; RRID: AB_2340375
Alexa Fluor 488, антимышиный осел Jackson ImmunoResearch Cat # 715–545–150; RRID: AB_2340846
Осел против Cy5 IgG Jackson ImmunoResearch Кат. № 706–175–148; RRID: AB_2340462
Осел анти-кроличий IgG к Cy5 Jackson ImmunoResearch Кат. № 711–175–152; RRID: AB_2340607
Ослиный анти-мышиный Cy5 IgG Jackson ImmunoResearch Кат. № 715–175–151; RRID: AB_2340820
Ослиный анти-кроличий IgG к Cy3 Jackson ImmunoResearch Кат. № 711–165–152; RRID: AB_2307443
Осел анти-крысиный Rhodamine Red-X IgG Jackson ImmunoResearch Cat # 712–295–153; RRID: AB_2340676
Ослиный анти-Cy3 IgG Jackson ImmunoResearch Кат. № 705–165–147; RRID: AB_2307351
Ослиный анти-мышиный Cy3 IgG Jackson ImmunoResearch Кат. № 715–165–150; RRID: AB_2340813
Осел против Cy3 IgG Jackson ImmunoResearch Кат. № 706–165–148; RRID: AB_2340460
Peroxidase AffiniPure Goat Anti-Mouse IgG Jackson ImmunoResearch Cat # 115–035–003, RRID: AB_10015289
Щелочной IgG козьего связывания AffciniPure фрагмент анализ, 1: 2000) Jackson ImmunoResearch Кат. № 115–055–071; RRID: AB_2338535
TSA Plus Cyanine 5 System PerkinElmer Кат. № NEL745E001KT
Мышиные анти-C1q-антитела — ANX-M1 (C1q-нейтрализующие антитела, in vivo,
Н / Д
Химические вещества, пептиды и рекомбинантные белки
α-Бунгаротоксин, конъюгат Alexa Fluor 555 (окрашивание NMJ, 1: 500) Thermo Fisher Scientific Cat # {«type»: » entrez-nucleotide «,» attrs «: {» text «:» B35451 «,» term_id «:» 2534820 «,» term_text «:» B35451 «}} B35451; RRID: AB_2617152
Субъединица B холерного токсина (рекомбинантный), конъюгат Alexa Fluor 555 (мышечные инъекции, Invitrogen, Thermo Fisher Scientific Cat # {«type»: «entrez-нуклеотид», «attrs»: { «text»: «C34776», «term_id»: «2370917», «term_text»: «C34776»}} C34776
Dextran, Alexa Fluor 488; 10 000 MW, Anionic, Fixable (инъекции в мышцы, Invitrogen, Thermo Fisher Scientific Cat # {«type»: «entrez-nucleotide», «attrs»: {«text»: «D22910», «term_id»: «426835», «term_text»: «D22910»}} D22910
Декстран, Техасский красный, 10000 МВт, нейтральный Invitrogen, Thermo Fisher Scientific Кат. № D1828
Окраска DAPI (IHC, 1: 10000) Thermo Fisher Scientific Кат. № D3571; RRID: AB_2307445
Мышь на мыши (M.OM) Блокирующий реагент Vector Laboratories Кат. № MKB-2213
Человеческий C1q Complement Technology Inc. Кат. № A099 / A100
CDP-star Applied Biosystems, Thermo Fisher Scientific Cat # T2214
Power SYBR Green PCR Master Mix Applied Biosystems, Thermo Fisher Scientific Cat # 4367659
Amersham ECL Prime Western Blotting Реагент для обнаружения GE Healthcare Life Sciences RP
ProLong Gold Antifade Mountant с DAPI Invitrogen, Thermo Fisher Scientific Кат. № {«type»: «entrez-protein», «attrs»: {«text»: «P36931», «term_id»: «2506707 «,» term_text «:» P36931 «}} P36931
PLX5622 ( инъекций in vivo ) Plexxikon N / A
Критические коммерческие анализы 90 026
Набор для выделения общей РНК водной и микроорганизмов Invitrogen, Thermo Fisher Scientific Номер по каталогу AM1931
Набор для синтеза первой цепи кДНК RevertAid Invitrogen, Thermo Fisher Scientific K1622 K1622 KAPA Biosystems Кат. № KK7103
Набор мультиплексных флуоресцентных реагентов для РНКскопа V2 Расширенная диагностика клеток Кат. № 323110
Экспериментальные модели: организмы / штаммы
Лаборатория Джексона Кат. № JAX: 000664; RRID: IMSR_JAX: 000664
Мышь: Smn +/− / SMN2 + / + / SMNΔ7 + / + : FVB.Cg-Grm7Tg (SMN2) 89Ahmb Smn1tm1Msd Tg (SMN2 * delta7) 4299Ahmb / J Лаборатория Джексона Кат. № JAX: 005025; RRID: IMSR_JAX: 005025
Мышь: PV cre : B6; 129P2-Pvalbtm1 (cre) Arbr / J The Jackson Laboratory Cat # JAX: 008069; RRID: IMSR_JAX: 008069
Мышь: C1qKO Доктор М. Ботто (Имперский колледж Лондона, Великобритания) Н / Д
Мышь: C3KO: B6; 129S4-C3tm1Crr / J Джексон Лаборатория Кат. № JAX: 003641; RRID: IMSR_JAX: 003641
Олигонуклеотиды
Нокаут-аллель C1q, прямой праймер: GGGGATCGGCAATAAAAAGAC N / A N / A
GCC аллель C1GC1 прямой праймер GCC
GCC C1G дикий праймер A Н / Д
Обратный праймер аллеля C1q дикого типа: ACCAATCGCTTCTCAGGACC Н / Д Н / Д
неинвертированный Smn Res Прямой праймер: ACGCGTACCGTTCGTAT2 / A
неинвертированный Smn Res обратный праймер: TGAGCACCTTCCTTCTTTTTG N / A N / A
инвертированный Smn Res прямой праймер: N / ACCAGTTAAGTATGAGAAT 9260
инвертированный Smn Res обратный праймер: GTTTGCAGAAGCGGTGGG N / A N / A
PV Cre дикий тип al lele обратный праймер: CGAGGGCCATAGAGGATGG N / A N / A
PV Cre аллель обратный праймер: GCGGAATTCTTAATTAATCAGCG N / A N / A
N / A N / A
Праймеры для RT-qPCR в реальном времени можно найти в таблице S1. Н / Д Н / Д
Канал 3 датчиков C1qa Расширенная диагностика ячеек Кат. № 441221-C3
Программное обеспечение и алгоритмы
LAS X (Leica Application Suite X) Leica Microsystems https://www.leica-microsystems.com/products/microscope-software/details/product/leica-las-x-ls
ImageJ NIH https: // imagej. net / Welcome
Clampex V10 Molecular Devices https: // www.Moleculardevices.com/
Clampfit V10 Molecular Devices https://www.moleculardevices.com/
GraphPad Prism 6.04 Программное обеспечение GraphPad https://www.graphpad.com/scientific -программное обеспечение / призма /

Легочная артериовенозная мальформация | Postgraduate Medical Journal

Прямые коммуникации между ветвями легочной артерии и легочными венами без промежуточного легочного ложа, вероятно, являются наиболее частыми аномалиями легочного сосудистого дерева и по-разному называются легочно-артериовенозной фистулой, легочной артериовенозной мальформацией (ПАВМ). , легочная артериовенозная аневризма (PAVA), легочная ангиома, артериовенозный ангиоматоз, кавернозные гемангиомы и легочные гамартомы. 1, 2 Поражения обычно представляют собой врожденные пороки развития, за исключением очень редких приобретенных случаев, и не имеют злокачественного потенциала; следовательно, последние четыре термина не представляют эту сущность должным образом. Кроме того, термин PAVA предпочтительно обозначает поражения, связанные с ограниченной дилатацией легочной артерии или вены, которые видны при ангиографии или макроскопическом осмотре. Термины легочный артериовенозный свищ и ПАВМ с артериовенозным шунтом могут использоваться как синонимы.ПАВМ — предпочтительный термин, поскольку он представляет собой дефект развития.

ИСТОРИЧЕСКАЯ СПРАВКА

Первое описание PAVM было сообщено Churton в 1897 году. 3 Он сообщил о случае 12-летнего мальчика, у которого были эпизоды носового кровотечения, кровохарканья и громкого систолического шума в легких; при патологоанатомическом исследовании выявлена ​​множественная двусторонняя ПАВМ. В 1917 году Уилкинс описал результаты аутопсии у 23-летней женщины с цианозом, дубинкой, телеангиэктазией и двусторонними подмышечными ушибами, которые умерли от гемоторакса после разрыва PAVA в плевральную полость. 4 В 1938 году Родс обнаружил связь между телеангиэктазиями и ПАВА. 5 Смит и Хортон в 1939 г. поставили первый клинический диагноз ПАВМ у 40-летнего мужчины, страдавшего цианозом, клубникой, шумом и полицитемией. 6 В 1942 году Хепберн и Дофини сообщили о первом случае успешного хирургического удаления легочной гемангиомы с исчезновением полицитемии и булавы у пациента после пневмонэктомии. 7 Альтернатива резекции паренхимы легкого была описана Паккардом и Уорингом в 1945 году, которые успешно вылечили 31-летнего мужчины с ПАВА путем перевязки легочной артерии. 8 Хирургические методы были дополнительно усовершенствованы до лобэктомии вместо пневмонэктомии в 1950 году и до местного иссечения в 1959 году. 9, 10 Хирургия оставалась основой лечения до 1978 года, когда Тейлор и его коллеги сообщили о первом успешном случае чрескожного вмешательства. катетеризация и эмболизация ПАВМ. 11

ЭТИОЛОГИЯ

С момента первого зарегистрированного случая в 1897 году в литературе было зарегистрировано более 500 случаев. 1, 12– 16 Естественная история этого редкого существа до конца не изучена. ПАВМ могут быть как врожденными, так и приобретенными. Более 80% ПАВМ являются врожденными, и из них 47–80% связаны с болезнью Ослера-Вебера-Рендера или наследственной геморрагической телеангиэктазией (НГТ). 13– 16 И наоборот, по оценкам, в целом 5–15% населения с ГГТ имеют ПАВМ. 13– 17 Ясно, что стигматы любой из этих двух сущностей должны предупреждать клинициста о возможности их сосуществования.У пациентов с ГГТ телеангиэктазии кожи и слизистой оболочки полости рта, носа и конъюнктивы проявляются во втором и третьем десятилетии жизни. Наличие HHT у пациента с PAVM может иметь прогностическое значение, поскольку у пациента с сосуществующим HHT, как правило, наблюдается худшая симптоматика, множественные артериовенозные мальформации, быстрое прогрессирование заболевания и более высокая частота осложнений. 13– 16

Частота возникновения ПАВМ, по-видимому, варьируется в зависимости от конкретных генных изменений. 18, 19 Генетические этиологические связи с HHT расположены на хромосоме 9 (9q 33–34 или OWR-1) в некоторых семьях и на хромосоме 12 (12q или OWR-2) в других. 18, 19 Ген HHT на хромосоме 9q3 кодирует эндоглин, связывающий мембранный гликопротеин эндотелиальных клеток сосудов в артериолах, венулах и капиллярах. 18 Мутация гена эндоглина может вызывать дисплазию сосудов и чаще встречается у пациентов с генетической связью с хромосомой 9q3. 19

О вторичных или приобретенных ПАВМ, хотя и очень редко, сообщалось в литературе. Причины вторичной ПАВМ включают травму грудной клетки, торакальную операцию, длительный цирроз печени, метастатическую карциному, митральный стеноз, инфекции (актиномикоз, шистосомоз) и системный амилоидоз. 12, 20– 24 Беременность связана с повышенной скоростью роста ПАВМ и связанными с этим осложнениями. 25– 28 Повышенная скорость роста PAVM была связана с увеличением объема крови и сердечного выброса, что приводит к увеличению легочного кровотока, предпочтительно через PAVM с низким сопротивлением. 25 Увеличенный кровоток через ПАВМ вызывает ее расширение. Во-вторых, повышенная растяжимость вен, вторичная по отношению к эффекту прогестерона, вызывает дальнейшее увеличение кровотока и приводит к увеличению размера ПАВМ. Увеличение синтеза стероидных гормонов, связанное с беременностью, приводит к увеличению частоты спонтанного гемоторакса, вторичного по отношению к внутриплевральному разрыву ПАВМ. 25, 27, 28

ПАТОЛОГИЯ

Заболеваемость ПАВМ составляет 2–3 случая на 100 000 населения. 17 Соотношение самцов и самок колеблется от 1: 1,5 до 1,8 в нескольких сериях. 13– 15 Возраст первого обращения колеблется от новорожденного до 70 лет, но в большинстве случаев диагноз диагностируется в первые три десятилетия жизни. 1, 12– 14 PAVM могут быть одиночными или множественными, а частота одиночных PAVM колеблется от 42% до 74%. 10, 13, 14, 29 Большинство одиночных ПАВМ видны в двусторонних нижних долях, причем наиболее часто встречается левая нижняя доля, за ней следуют правая нижняя доля, левая верхняя доля, правая средняя доля и правая верхняя доля. 10, 14, 29 Большинство множественных PAVM также ограничены двусторонними нижними долями; частота двусторонних ПАВМ колеблется от 8% до 20%. 10, 12

Все ПАВМ имеют афферентное питание, обычно от одной или нескольких ветвей легочной артерии. Однако иногда афферентное питание частично или полностью происходит из большого круга кровообращения; источник системного питания включает аорту, межреберные и бронхиальные артерии. 10, 12 Эфферентная конечность артериовенозной мальформации дренируется в одну или несколько ветвей легочной вены; иногда аномальные эфферентные сосуды могут стекать прямо в левое предсердие или нижнюю полую вену, а не в легочную вену. 30 ПАВМ обычно обнаруживаются в непосредственной близости от висцеральной плевры или внедряются во внешнюю треть паренхимы легкого. В исследовании 110 пациентов с одним PAVM, 89 (81%) поражений были либо субплевральными, либо частично внедрялись в паренхиму легкого. 10

Классификация ПАВМ, включая эмбриологию и анатомические вариации, была рассмотрена Анабтави и его коллегами. 30 Они разделили ПАВМ на пять групп (вставка 1), и эта классификация основана на эмбриологическом развитии легких и легочной сосудистой сети. Они предполагают, что раздельное эмбриональное развитие легочной артериальной, капиллярной и венозной систем допускает аномалии легочного кровообращения в этих системах либо в сочетании, либо в виде изолированного поражения.Дополнительно изолированное аномальное развитие капилляров может привести к артериовенозному шунтированию без видимых пороков развития. Кули и Макнамара были первыми, кто описал случай микроскопической ПАВМ, диагностированной с помощью открытой биопсии легкого у цианозного пациента с нормальными рентгенограммами грудной клетки и легочной ангиограммой. 31 Наиболее часто встречающаяся сосудистая аномалия — это примитивное венозное сплетение с сохранением крупных сосудистых каналов аневризматических размеров, которые мы распознаем как ПАВМ.

Вставка 1:

Анатомическая классификация ПАВМ (на основе Anatwabi et al. 30 )

Группа I

Группа II

III группа

  • Большая артериовенозная аневризма (центральная).

  • Большая артериовенозная аневризма с аномальным венозным оттоком.

  • Множественные мелкие артериовенозные свищи с аномальным венозным оттоком.

  • Группа IV

  • Большая венозная аневризма с системным артериальным сообщением.

  • Аневризма венозная большая без свища.

  • Группа V

    ПАТОФИЗИОЛОГИЯ

    В отличие от системной артериовенозной мальформации, ПАВМ не влияют на гемодинамику сердца. 12, 13, 16 Сердечный выброс, сердечный индекс, давление заклинивания легочных капилляров, частота сердечных сокращений, артериальное давление и электрокардиограмма обычно находятся в пределах нормы.Основной дефект — это шунт справа налево из легочной артерии в легочную вену, степень шунтирования — это то, что определяет клиническое воздействие на пациента. 12, 16 Если шунтирование минимально, симптомы обычно подострые или даже отсутствуют. Если шунт справа налево превышает 20% системного сердечного выброса или наблюдается снижение гемоглобина более чем на 50 г / л, у пациента будет очевидный цианоз, клубникообразование и полицитемия. В некоторых случаях HHT цианоз может быть скрыт анемией, вызванной носовым кровотечением или желудочно-кишечной кровью.Масса эритроцитов и объем крови обычно увеличиваются, тогда как объем плазмы в норме. 6, 12 Периферическое насыщение кислородом низкое и, как ожидалось, не нормализуется при 100% кислороде.

    КЛИНИЧЕСКИЕ ВЫВОДЫ

    Точный анализ клинических данных, полученных с помощью PAVM, затруднен, потому что многие из опубликованных серий частично совпадают с видами болезни; поэтому записанные данные, относящиеся к PAVM, неоднородны и часто являются неполными. Бессимптомные пациенты являются обычным явлением и составляют от 13% до 55% пациентов в разных сериях. 13– 15, 25 Таким образом, отсутствие симптомов не исключает диагноза ПАВМ. Наиболее частым симптомом является одышка при физической нагрузке, которая наблюдается у 31–67% пациентов (вставка 2). 1, 13– 17 Тяжесть одышки зависит от степени гипоксемии и величины шунта. Большинство пациентов с ПАВМ очень хорошо переносят гипоксемию и относительно или полностью бессимптомны, если артериальное давление кислорода не ниже 8.0 кПа (60 мм рт. Ст.). Носовое кровотечение, мелена и неврологические симптомы должны предупреждать врача о возможности сосуществования HHT. Носовые кровотечения относительно чаще встречаются у пациентов с ГГТ. 14, 15, 17 У значительного числа пациентов (43–67%) неврологические симптомы в анамнезе, такие как головная боль, головокружение, парез, онемение, парестезия, обморок или спутанность сознания, могут быть найденным. 15, 17 В одном исследовании классическая триада, состоящая из одышки, цианоза и клубочков, была обнаружена только у 10% пациентов с ПАВМ. 32

    Вставка 2:

    Клинические особенности ПАВМ

    Симптомы

    • Одышка.

    • Носовое кровотечение.

    • Кровохарканье.

    • Сердцебиение.

    • Боль в груди.

    • Кашель.

    Знаки

    • Брут / острые ощущения.

    • Клубы.

    • Цианоз.

    • Телеангиэктазия.

    • Полицитемия.

    • Анемия.

    Осложнения

    • Гипоксемия.

    • Интрабронхиальный разрыв, кровохарканье.

    • Внутриплевральный разрыв, гемоторакс.

    • Парадоксальная эмболизация.

    • Полицитемия.

    • Легочная гипертензия.

    • Эндокардит.

    • Преходящая ишемическая атака.

    • Цереброваскулярное нарушение.

    • Мигрень.

    • Абсцесс головного мозга.

    • Застойная сердечная недостаточность.

    Тщательное медицинское обследование позволяет выявить отклонения от нормы у 75% пациентов. 32 Наиболее частыми физическими симптомами являются цианоз, тупость и шум сосудов легких (вставка 2). 1, 13, 15 Классически шум в легких увеличивается за счет вдоха и маневра Мюллера (форсированный вдох с закрытой голосовой щелью после полного выдоха), это вызвано увеличением легочного кровотока и уменьшается выдох и маневр Вальсальвы за счет уменьшения венозного возврата в легкие.О кожно-слизистых телеангиэктазиях сообщалось почти у двух третей пациентов с ГГТ с ПАВМ. 15, 17 Массивное кровохарканье после внутрибронхиального разрыва поражения или гемоторакс после разрыва субплеврального поражения редко, но потенциально является фатальным осложнением ПАВМ. 25, 27 Наличие симптомов обычно коррелирует с размером поражения, одиночный ПАВМ менее 2 см в диаметре на рентгенограмме грудной клетки обычно не вызывает симптомов. 13, 14

    Наиболее часто сообщаемые осложнения связаны с центральной нервной системой, и частота встречаемости варьирует в разных сериях от 19% до 59%. 15, 17, 25, 33 В одном исследовании сообщенная частота различных неврологических событий была следующей: мигрень 43%, транзиторная ишемическая атака 37%, инсульт 18%, абсцесс 9% и судороги 8 %. 33 Наиболее вероятным механизмом этих неврологических событий является парадоксальная эмболия через PAVM или через сосуществующую церебральную артериовенозную мальформацию у пациентов с HHT. Менее распространенные, но опасные для жизни осложнения включают кровохарканье и гемоторакс.Кровохарканье может быть результатом внутрибронхиального разрыва ПАВМ или эндобронхиальной телеангиэктазии, тогда как гемоторакс может быть результатом разрыва субплевральной ПАВМ. В исследовании 143 пациентов с ПАВМ, которые были направлены на эмболотерапию, 11 (8%) имели в анамнезе массивное кровохарканье или гемоторакс. 27 Легочное кровотечение было характерным симптомом у девяти из 11 пациенток, семь из 11 пациенток были женщинами, у трех из которых симптомы наблюдались во время беременности. 27

    ДИАГНОСТИКА

    Рентгенография грудной клетки — важный диагностический инструмент не только для диагностики, но и для последующего наблюдения за пациентами с ПАВМ.Обычная рентгенограмма грудной клетки показывает аномалии примерно у 98% пациентов. 13– 15 Классические рентгенологические признаки ПАВМ — это округлая или овальная резко очерченная масса однородной плотности, часто дольчатая и размером от 1 до 5 см в диаметре; две трети расположены в нижних долях (рис. 1 и 2). 10, 12, 13 Обычная рентгенограмма грудной клетки может показать соединительный сосуд, исходящий от ворот. 13, 14 Томография грудной клетки, хотя обычно не используется, более точна для определения соединительных сосудов и ПАВМ. 13

    Рисунок 1

    Задне-передняя рентгенограмма грудной клетки, показывающая большую одиночную ПАВМ в правой нижней части гемиторакса.

    Рисунок 2

    Боковой рентгеновский снимок грудной клетки показывает большую одиночную ПАВМ в правом нижнем отделе гемиторакса.

    Фракция шунта, доля сердечного выброса, которая шунтируется справа налево через PAVM, повышается у 88% до 100% выбранных пациентов с PAVM. 13– 15, 34 Фракция шунта наиболее точно измеряется методом 100% кислорода, который включает измерения насыщения кислородом и давления артериального кислорода после дыхания 100% кислородом в течение 15–20 минут. Доля шунта, равная или превышающая 5% при использовании этого метода, считается ненормальной. В исследовании с участием 32 пациентов фракция шунта варьировала от 3,5% до 35%, а более высокая фракция шунта наблюдалась у пациентов с множественной ПАВМ. 34

    Контрастная эхокардиография включает инъекцию взволнованного физиологического раствора или красителя в периферическую вену; он чрезвычайно чувствителен при обнаружении шунта слева направо, но не дает количественных или анатомических деталей шунта.У пациентов без шунта справа налево пузырьки воздуха или краситель могут быстро появиться в правом предсердии, а затем постепенно исчезнуть, поскольку пузырьки застревают в малом круге кровообращения. 12 В случае внутрисердечного шунта пузырьки будут визуализироваться в левом предсердии в течение одного сердечного цикла после их появления в правом предсердии. 35 Напротив, PAVM продемонстрирует задержку от трех до восьми сердечных циклов до того, как пузырьки будут визуализированы в левом предсердии. 35 Иногда, если пузырьки или контраст можно увидеть, попадая в левое предсердие через единственную легочную вену, это подтверждает ипсилатеральную анатомическую локализацию ПАВМ. Кроме того, контрастная эхокардиография позволяет оценить эффективность эмболотерапии и полезна для исключения наличия ПАВМ у членов семей пациентов с ГГТ. 36

    Радионуклидное перфузионное сканирование легких является полезным дополнением в диагностике и количественной оценке ПАВМ. 36 Однако, как и в случае контрастной эхокардиографии, положительный результат не является специфическим для ПАВМ, тогда как отрицательный результат по существу исключает диагноз.Радионуклидное сканирование также позволяет количественно оценить величину шунта, результаты которого сопоставимы с методом расчета 100% кислородного шунта. 36 Как и контрастная эхокардиография, сканирование легких с радионуклидной перфузией не дает информации об анатомических деталях PAVM. Несмотря на высокую отрицательную прогностическую ценность, радионуклидное перфузионное сканирование легких обычно не используется.

    Компьютерная томография с контрастным усилением — ценный инструмент в диагностике и определении анатомии сосудов ПАВМ (рис. 3). 37 Remy и др. сравнили полезность компьютерной томографии с контрастным усилением и селективной ангиографии легких и обнаружили, что сканирование компьютерной томографии было значительно лучше, чем обычная ангиография в обнаружении PAVM (98 против 60%). 37 Однако ангиография была лучше способна определить ангиоархитектуру отдельных PAVM, чем компьютерная томография. Превосходство компьютерной томографии в обнаружении ПАВМ объясняется отсутствием наложения поражений на изображениях трансаксиальной компьютерной томографии.Трехмерная (3-D) спиральная компьютерная томография, относительно новый метод, который не является широко доступным, также используется для диагностики поражений легочных сосудов. В сравнительном исследовании трехмерная спиральная компьютерная томография позволила полностью проанализировать 76% ПАВМ по сравнению с 32% при обычной односторонней легочной ангиографии. 37 Использование трехмерной спиральной компьютерной томографии ограничено временем, длительной задержкой дыхания и невозможностью визуализировать большие ПАВМ. 38 Кроме того, были сообщения о случаях ложноположительного диагноза PAVM с помощью компьютерной томографии. 39 Таким образом, компьютерная томография с контрастным усилением является полезным и широко доступным диагностическим инструментом у пациентов с аномальной рентгенографией грудной клетки, подозрительной на ПАВМ, а также для исключения любого сопутствующего процесса.

    Рисунок 3

    Сечение компьютерной томограммы демонстрирует хорошо описанную плотность в правой нижней доле, соединенной кровеносным сосудом.

    Использование магнитно-резонансной томографии для диагностики ПАВМ ограничено по сравнению с компьютерной томографией. 40, 41 Большинство поражений в легких имеют относительно длительное время релаксации и дают сигналы средней или высокой интенсивности. Напротив, ПАВМ и аневризмы с быстрым кровотоком в поражении приводят к потере сигнала и дают сигналы низкой интенсивности. 42 Дополнительные поражения с низкой интенсивностью сигнала включают воздушную кисту, кальцинированное поражение, фиброзный рубец, кистозное поражение и гематому. Эти поражения затрудняют дифференциацию ПАВМ от этих поражений с помощью стандартной техники магнитно-резонансной томографии, поэтому было предложено применение дополнительных методов для визуализации поражений легочных сосудов. 40, 41 Имеются сообщения об отдельных случаях успешной диагностики ПАВМ с помощью магнитно-резонансной ангиографии, исключающей необходимость в легочной ангиографии. 42 Основными причинами, ограничивающими использование магнитно-резонансной ангиографии для рутинного использования, являются ограниченная доступность, относительная стоимость и потребность в высокоспециализированном персонале для интерпретации данных.

    Несмотря на все достижения в методах, упомянутых до сих пор, легочная ангиография остается золотым стандартом в диагностике ПАВМ (рис. 4). 1, 12, 14, 16 Легочная ангиография оправдана для подтверждения диагноза практически во всех случаях. Легочная ангиограмма не только идентифицирует PAVM, но также дополнительно определяет ангиоархитектуру легочной сосудистой сети, которая необходима перед терапевтической эмболизацией или хирургической резекцией. Ангиографию следует выполнять на всех участках легкого для поиска любых непредвиденных ПАВМ и источника внутригрудных или внегрудных сосудистых коммуникаций.Компьютерная томография и магнитно-резонансная ангиография для диагностики ПАВМ должны быть зарезервированы для тех пациентов, которые не могут пройти ангиографию, или для последующего наблюдения за пациентами с доказанной ПАВМ.

    Рисунок 4

    Ангиограмма, показывающая большую одиночную ПАВМ правой нижней доли с единственной артерией.

    У некоторых пациентов с нормальной рентгенограммой грудной клетки наличие гипоксемии означает наличие небольшого PAVM, вызывающего шунт.Компьютерная томография с контрастным усилением может показать несколько небольших ПАВМ, которые иногда не видны на легочной ангиографии из-за их ангиографически малого размера. Клиническое значение этих небольших PAVM в настоящее время неясно.

    В нашем учреждении компьютерная томография с контрастным усилением выполняется при обнаружении аномалии рентгенограммы грудной клетки, подозрительной на ПАВМ. Контрастная эхокардиография проводится для определения наличия шунта справа налево, а фракция шунта определяется методом 100% кислорода.Наконец, если пациент подходит для дальнейшего вмешательства, проводится ангиография легких для определения анатомических деталей поражения.

    ЛЕЧЕНИЕ

    Хотя о первой успешной хирургической резекции ПАВМ было сообщено в 1942 г., 7 единого мнения относительно лечения ПАВМ достигнуто не было; Одна из причин — неопределенность естественной истории ПАВМ. Нет ни одного проспективного исследования пациентов, которые были рандомизированы для лечения по сравнению только с наблюдением.Имеются данные о том, что ПАВМ прогрессивно увеличиваются с течением времени, и частота прогрессирования выше у пациентов с нелеченым ПАВМ. 1, 13, 15, 32 Заболеваемость, связанная с ПАВМ, составляла до 50% у нелеченных пациентов по сравнению с 3% у пациентов, получавших лечение. 13, 15, 32 В более ранних исследованиях наблюдалось значительное совпадение случаев, что затрудняет оценку смертности. 1, 13– 17 В этих исследованиях показатель смертности колеблется от 0% до 55%. 1, 13, 15, 32 Несмотря на ограниченную информацию о естественном течении ПАВМ, имеющиеся данные предполагают, что лечение должно быть предложено всем симптомным пациентам и бессимптомным пациентам с поражениями менее 2 см в диаметре. рентгенография грудной клетки. 14 Цель лечения — профилактика неврологических осложнений, прогрессирующей гипоксии и ее последствий, сердечной недостаточности с высоким выбросом.

    С момента первой успешной резекции ПАВМ в 1942 году хирургическое вмешательство было единственным доступным лечением до 1978 года, когда Taylor и др. сообщили о первой успешной чрескожной эмболизации. 7, 11 В настоящее время предпочтительным лечением для большинства пациентов с ПАВМ является чрескожная эмболотерапия с использованием спиралей или баллонов; этот метод во многом заменил хирургическое вмешательство. 33, 34, 43– 45 Эмболотерапия, будучи менее инвазивной и легко повторяемой, имеет определенные преимущества перед хирургическим вмешательством.Для эмболизации использовались два метода — баллоны и металлические спирали. У каждого метода есть свои преимущества, недостатки и сложности. 33, 34, 43, 44 Оба метода включают локализацию ПАВМ с помощью ангиографии с последующей избирательной катетеризацией питающей артерии. 33, 43 При спиральной эмболизации кончик катетера располагается как можно ближе к шейке ПАВМ, стальная спираль продвигается через катетер и освобождается в этой точке. 43 Затем повторяют ангиографию, чтобы убедиться в правильном положении спирали и прекращении кровотока через ПАВМ (рис. 5 и 6). При баллонной эмболизации после локализации ПАВМ с помощью ангиографии баллонный катетер заменяют по проволочному проводнику и помещают на шейку сосуда для кормления. 33 Баллон надувают и повторяют ангиографию, чтобы убедиться в окклюзии сосуда. Если нет потока через PAVM, баллон отсоединяется.

    Рисунок 5

    Рентгенограмма грудной клетки показывает полную окклюзию ПАВМ после спиральной эмболизации.

    Рисунок 6

    Ангиограмма, показывающая скопление катушек, вызывающее полную окклюзию ПАВМ.

    Результаты эмболизации представлены в таблице 1; Всего было закрыто 808 ПАВМ у 288 пациентов. Спиральная эмболизация применялась несколько чаще, чем баллонная. Общий показатель успеха составил более 99% (808 попыток из 803 закрытых ПАВМ). В этих сериях не было зарегистрировано летальных исходов. 33, 34, 43– 45 Наиболее частым осложнением была самоограничивающаяся плевритная боль в груди, которая наблюдалась у 13% пациентов. 33, 43, 46 Частота плевритной боли в груди была выше (31%) у пациентов с большими ПАВМ (питающий сосуд> 8 мм). 44 Инфаркт легкого рентгенологически наблюдался у 3% пациентов. 33, 45 Воздушная эмболия во время эмболизации встречается редко, но может вызывать преходящие симптомы, такие как стенокардия, брадикардия и периоральные парестезии. 33 Другие сообщенные осложнения включают миграцию устройства, разрыв миокарда, нарушение мозгового кровообращения, сосудистое повреждение, раннее сдутие баллона, тромбоз глубоких вен и легочную гипертензию. 33, 46, 47 Таким образом, современные методы эмболизации с минимальной заболеваемостью и отсутствием смертности делают радиологическое вмешательство первой линией лечения ПАВМ. Эмболотерапия является подходящей альтернативой хирургическому вмешательству у пожилых людей, которые не подходят для хирургического вмешательства, у пациентов с множественными поражениями и пациентов, которые отказываются от операции. В нашем учреждении все пациенты с ПАВМ проходят обследование интервенционным радиологом на предмет эмболотерапии перед тем, как быть допущены к операции.

    Стол 1

    Исход пациентов, перенесших эмболизацию по поводу ПАВМ

    Хирургическая резекция ПАВМ показана пациентам, которые не прошли эмболотерапию, у которых развилось серьезное кровотечение, несмотря на эмболотерапию, у которых имеется внутриплевральный разрыв ПАВМ или имеется неизлечимая аллергия на контраст и поражения, не поддающиеся эмболотерапии. Были использованы различные хирургические методы, включая местное иссечение, сегментарную резекцию, лобэктомию, лигирование и даже пневмонэктомию.По возможности предпочтительным методом является легкосохраняющая резекция, местная резекция или сегментэктомия. При обширной двусторонней ПАВМ выполнялись этапные двусторонние торакотомии. 48 В последнее время при резекции небольшой ПАВМ применялась торакоскопия с использованием видео. 49 ПАВМ-хирургия имеет такой же риск, как и любая другая торакальная хирургическая процедура, но при правильном выполнении у хорошо отобранных пациентов она приводит к минимальной заболеваемости и смертности. 10, 13, 15 Зарегистрированная смертность в серии случаев, опубликованной после 1960 г., равна нулю. 13– 15, 34 Таким образом, хирургическая резекция ПАВМ является приемлемым вариантом для тех пациентов, которые не поддаются эмболотерапии. Это связано с минимальной смертностью и заболеваемостью и требует пребывания в больнице.

    Смертность и заболеваемость при нелеченных ПАВМ показана в таблице 2.

    Стол 2

    Смертность и заболеваемость при нелеченных ПАВМ

    ЗАКЛЮЧЕНИЕ

    ПАВМ — необычная клиническая проблема.Классическая триада, состоящая из одышки при физической нагрузке, цианоза и клубов, должна предупреждать клинициста о возможности ПАВМ. Между PAVM и HHT существует сильная связь. Все пациенты с ПАВМ должны быть обследованы на предмет церебральной артериовенозной мальформации с помощью компьютерной томографии головы с контрастным усилением или магнитно-резонансной томографии. Рентгенограмма грудной клетки часто предполагает диагноз ПАВМ, а компьютерная томография с контрастным усилением или легочная ангиография обычно являются диагностическими. Контрастная эхокардиография подтверждает наличие шунта справа налево, и фракция шунта может быть измерена методом 100% кислорода или сканированием перфузии легких с помощью радионуклидов.Перед эмболотерапией или хирургическим вмешательством необходима легочная ангиография, чтобы задокументировать количество и расположение всех поражений. Упрощенный подход к диагностике и / или последующему наблюдению за ПАВМ представлен на рис. 7. Эмболотерапия, если таковая доступна, является относительно безопасной и эффективной процедурой и предпочтительным методом лечения ПАВМ. Сохраняющая резекция легких является оптимальным вариантом для пациентов с симптомами, у которых эмболотерапия оказалась безуспешной или технически неосуществимой. Риск серийного роста скрытых очагов поражения и реканализации ранее эмболизированной ПАВМ диктует необходимость регулярного наблюдения за пациентами.

    Рисунок 7

    Подход к пациентам с подозрением на ПАВМ или для последующего наблюдения за пациентами с ПАВМ.

    ССЫЛКИ

    1. Стрингер С.Дж. , Стэнли А.Л., Бейтс Р.К., и др. . Легочные артериовенозные свищи. Am J Surg1955: 89: 1054–80.

    2. Ле Ру ВТ . Легочные гамартомы. Thorax1964; 19: 236–43.

    3. Чертон Т . Множественные аневризмы легочной артерии. BMJ1897; я: 1223.

    4. Wilkins GD . Ein Fall von multiplen pulmonalis anerysmen. Бейтр Клинис Tuberk1917; 38: 1–10.

    5. Родос CB . Кавернозные гемангиомы легкого с вторичной полицитемией. JAMA1938; 110: 1914–5.

    6. Smith HL , Horton BT.Артериовенозный свищ легкого, связанный с истинной полицитемией; отчет о случае, в котором диагноз был поставлен клинически. Am Heart J1939; 18: 589–92.

    7. Hepburn J , Dauphinee JA. Успешное удаление гемангиомы легкого с последующим исчезновением полицитемии. Am J Med Sci, 1942; 204: 681–7.

    8. Packard GB , Waring JJ. Артериовенозный свищ легкого лечится перевязкой легочной артерии.Arch Surg1945; 56: 724–40.

    9. Lindskog EE , Liebow AA, Lausel H, и др. . Легочная артериовенозная аневризма. Энн Сург 1950; 132: 591–600.

    10. Bosher LH , Blake DA, Byrd BR. Анализ патологической анатомии легочных артериовенозных аневризм с особым упором на применимость местного иссечения. Хирургия, 1959; 45: 91–104.

    11. Тейлор Б.Г. , Кодкерилл Е.М., Манфреди Ф., и др. .Лечебная эмболизация легочной артерии при легочно-артериовенозной фистуле. Am J Med1978; 64: 360–5.

    12. Prager RL , Law KH, Bender HW Jr. Артериовенозный свищ легкого. Энн Торак Сург, 1983; 26: 231–9.

    13. Dines DE , Arms RA, Bernatz PE, и др. . Легочные артериовенозные свищи. Mayo Clin Proc, 1974; 49: 460–5.

    14. Dines DE , Deward JB, Bernatz PE.Легочный артериовенозный свищ. Mayo Clin Proc, 1983; 58: 176–81.

    15. Sluiter-Eringa H , Orie NGM, Slutier HJ. Легочный артериовенозный свищ: диагностика и прогноз у пациентов без жалоб. Am Rev Respir Dis1969; 100: 177–84.

    16. Monsour KA , Hatcher CR Jr, Logan WD, и др. . Легочный артериовенозный свищ. Am Surg1970; 37: 203–8.

    17. Hodgson CH , Kaye RL.Легочный артериовенозный свищ и наследственная телеангиэктазия. Dis Chest, 1963; 43: 449–55.

    18. Марчук Д.А. . Молекулярно-генетические наследственные геморрагические телеангиэктазии. Chest1997; 111: 79–82S.

    19. Porteous MEM , Curtis A, Williams O, et al . Генетическая гетерогенность наследственной геморрагической телеангиэктазии. J Med Genet1994; 31: 925–6.

    20. Symbas PN , Goldman M, Erbesfeld MH, и др. .Легочный артериовенозный свищ, аневризма легочной артерии и другие сосудистые изменения легкого в результате проникающей травмы. Энн Сург 1980; 191: 336–40.

    21. Мур JW , Кирби WC, Мэдден WA, и др. . Развитие легочных артериовенозных мальформаций после операции по модифицированному Фонтану. J. Thorac Cardiovasc Surg, 1989; 98: 1045–50.

    22. Пирс Дж. А. , Рейган В.П., Кимбалл Р.В.Необычные случаи легочных артериовенозных свищей, причиной которых является рак щитовидной железы. N Engl J Med1959; 260: 901–7.

    23. LeRoux T , Gibb BH, Wainwright J. Легочный артериовенозный свищ с бильгарциальной легочной гипертензией. Br Heart J1970; 32: 571–4.

    24. Kamei K , Kusumoto K, Suzuki T. Легочный амилоидоз с легочной артериовенозной фистулой.Chest1989; 96: 1435–6.

    25. Esplin MS , Varner MW. Прогрессирование легочной артериовенозной мальформации во время беременности. Obstet Gynecol Surv, 1997; 52: 248–53.

    26. Hoffman R , Robins R. Развивающийся легочный узел: множественные легочные артериовенозные свищи. AJR Am J Roentgenol 1974; 120: 861–4.

    27. Ference BA , Shannon TM, White RI Jr, et al. Опасное для жизни легочное кровотечение с легочными артериовенозными мальформациями и наследственной геморрагической телеангиэктазией. Chest1994; 106: 1387–90.

    28. Мур Б.П. . Легочные артериовенозные свищи. Thorax1969; 24: 381.

    29. Schumaker HB , Waldhausen JA. Легочные артериовенозные свищи у детей. Энн Сург, 1963; 158: 713–20.

    30. Anabtawi IN , Ellison RG, Ellison LT.Легочные артериовенозные аневризмы и свищи. Энн Торак Сург, 1965; 1: 277–85.

    31. Cooley DA , McNamara DG. Легочная телеангиэктазия: отчет о случае, подтвержденном биопсией легких. J Thorac Surg1954; 27: 614–22.

    32. Puskas JD , Allen MS, Moncure AC, и др. . Легочные артериовенозные мальформации: варианты лечения. Ann Thorac Surg 1993; 56: 253–8.

    33. White RI Jr , Lynch-Nyhan A, Terry P, и др. . Легочные артериовенозные мальформации: методы и отдаленные результаты эмболотерапии. Радиология 1988; 169: 663–9.

    34. Haitjema TJ , Overtoom TTC, Westermann CJJ, и др. . Эмболизация легочных артериовенозных мальформаций: результаты и наблюдение у 32 пациентов. Thorax1995; 50: 719–23.

    35. Барзилай Б . Wagoner AD, Spesset C, и др. . Двумерная контрастная эхокардиография при дефекте и динамическом наблюдении врожденных легочных артериовенозных мальформаций. Am J Cardiol1991; 68: 1507–10.

    36. Уайт MKB , Петерс AM, Хьюз JMB, и др. . Количественная оценка шунта справа налево в покое и во время упражнений у пациентов с легочными артериовенозными мальформациями.Thorax1992; 47: 790–6.

    37. Remy J , Remy-Jardin M, Wattinne L, и др. Легочная артериовенозная мальформация: оценка с помощью КТ грудной клетки до и после лечения. Радиология, 1992; 182: 809–16.

    38. Реми Дж. , Реми-Жардин М., Жиравд Ф., и др. . Ангиоархитектура легочных артериовенозных мальформаций: клиническое применение трехмерной спиральной компьютерной томографии.Радиология 1996; 191: 657–64.

    39. Halbsguth A , Schlze W, Ungeheuer E, и др. . Ловушка в КТ-диагностике легочных артериовенозных мальформаций. J Comput Assist Tomogr1983; 7: 710–2.

    40. Сильверман Дж. М. , Джубиен П.Дж., Херкенс Р.Дж., и др. . Оценка легочной артериовенозной мальформации с помощью магнитно-резонансной томографии. Chest1994; 106: 1333–8.

    41. Rotondo AM , Scialpi M, Scialpic C. PAVM: оценка с помощью МР-ангиографии. AJR Am J Roentgenol1997; 168: 847–9.

    42. Коричневый JJ , Гилберт Т., Гамсу Г., и др. . МРТ поражений легких с низкой интенсивностью сигнала: с использованием чувствительных к потоку методов. J Comput Assist Tomogr 1988; 12: 560–64.

    43. Dutton JAE , Jackson JE, Huges JMB, и др. .Легочные артериовенозные мальформации: результаты лечения спиральной эмболизацией у 53 пациентов. AJR Am J Roentgenol1995; 165: 1119–25.

    44. Saluja S , Sitko L, Lee RW, et al. Эмболотерапия АВМ легочной артерии съемными баллонами: долговечность и эффективность. J Vasc Interv Radiol1999; 10: 883–9.

    45. Lee RW , White RI, Egglin TK, и др. .Эмболотерапия крупных легочных артериовенозных мальформаций: отдаленные результаты. Ann Thorac Surg 1997; 64: 930–40.

    46. Реми-Жардин Р.М. , Ваттинн Л., Реми Дж. Транскатетерная окклюзия циркуляции легочной артерии и кровоснабжения: неудачи, инциденты и осложнения. Радиология, 1991; 180: 699–705.

    47. Haitjema T , ten Berg JM, Overtoon TTC, и др. .Необычные осложнения после эмболизации легочно-артериовенозной фистулы. Chest 1996; 109: 1601–6.

    48. Brown SE , Wright PW, Renner JW, и др. . Этапные двусторонние торакотомии по поводу множественных легочных артериовенозных мальформаций, осложняющих наследственную геморрагическую телеангиэктазию. J. Thorac Cardiovasc Surg, 1982; 83: 285–9.

    49. Minami M , Fujii Y, Mizuta T, и др. Видео-торакоскопическое иссечение легочного артериовенозного свища. J. Thorac Cardiovasc Surg, 1996; 112: 1395–7.

    50. Dutton JAE , Jackson JE, Hughes JMB, и др. . Легочные артериовенозные мальформации: результаты лечения спиральной эмболизацией у 53 пациентов. AJR Am J Roentgenol1995; 165: 1119–25.

    51. Lee DW , White RI, Egglin TK, et al. Эмболотерапия крупных легочных артериовенозных мальформаций: отдаленные результаты. Энн Торак Сург 1997; 64: 930–9.

    52. Saluja S , Sitko I, Lee DW, и др. Эмболотерапия легочных артериовенозных мальформаций с помощью съемного баллона: долговечность и эффективность. J Vasc Interv Radiol1999; 10: 883–9.

    53. Yater WM , Finnegan J, Griffin HM.Легочный артериовенозный свищ (варикозное расширение вен). JAMA1949; 141: 581–9.

    54. Мури JW . Артериовенозные аневризмы легких. Am J Surg1955; 89: 265–71.

    Кодирование различных типов анемии — взгляд на соответствующие коды МКБ-10

    Анемия — это заболевание, которое развивается, когда в крови недостаточно здоровых эритроцитов или гемоглобина. Гемоглобин — это белок, богатый железом, который помогает эритроцитам переносить кислород из легких в остальные части тела.Это заболевание считается одним из наиболее распространенных заболеваний крови и может вызывать у вас усталость и слабость. Вы также можете испытывать одышку, головокружение, головные боли или нерегулярное сердцебиение. Существуют разные типы анемии (каждый со своей причиной), которые могут быть временными или долгосрочными и могут варьироваться от легкой до тяжелой. Если не лечить, анемия может вызвать серьезные проблемы со здоровьем, такие как — осложнения при беременности, сильная усталость, проблемы с сердцем, а в некоторых тяжелых случаях даже смерть. Лечение этого состояния варьируется от приема лекарственных добавок до медицинских процедур.Документирование различных типов анемии для подачи заявки и возмещения требует лучшего понимания правил выставления счетов и кодирования медицинских услуг. Выбор услуг надежной и авторитетной компании по выставлению счетов и кодированию медицинских счетов может помочь врачам лучше справляться с задачами подачи претензий.

    По данным Национального института сердца, легких и крови, анемия поражает около 3 миллионов человек в Соединенных Штатах. Женщины, маленькие дети и люди с хроническими заболеваниями подвергаются повышенному риску развития анемии.Есть три основные причины, по которым люди становятся анемичными: снижение способности организма производить новые эритроциты / гемоглобин, увеличение кровопотери (обычно из-за кровотечения) или болезнь, которая приводит к усиленному разрушению эритроцитов. .

    Симптомы и варианты лечения

    В некоторых случаях люди с анемией не испытывают каких-либо специфических симптомов. Как правило, признаки и симптомы различаются и зависят от типа и причины анемии. Один из наиболее частых симптомов всех видов анемии — это чувство усталости, слабости и упадка сил.Другие связанные симптомы включают —

    • Кожа бледная или желтоватая
    • Нерегулярное сердцебиение
    • Одышка
    • Головокружение или дурноту
    • Боль в груди
    • Холодные руки и ноги
    • Головная боль
    • Стук или «свист» в ушах
    • Выпадение волос
    • Недомогание (общее недомогание)

    Существует несколько факторов, которые повышают риск развития анемии, и к ним относятся: диета с недостатком определенных витаминов, кишечные расстройства, хронические состояния и другие факторы, такие как инфекции, болезни крови, алкоголизм, воздействие токсичных химикатов и употребление наркотиков. определенные лекарства.

    Первоначальная диагностика анемии начинается с подробного медицинского осмотра, а также оценки медицинского и семейного анамнеза. Врачи рекомендуют выполнить общий анализ крови (CBC), который измеряет количество компонентов крови (включая уровни гемоглобина и гематокрита или отношение объема эритроцитов к общему объему крови). Общий анализ крови может дать четкое представление об общем состоянии здоровья человека и о том, есть ли у него какие-либо заболевания, такие как лейкемия или заболевание почек.В некоторых случаях также будет проведен тест для определения размера и формы ваших эритроцитов. Варианты лечения этого состояния зависят от типа и связанных с ним причин анемии. В большинстве случаев методы лечения включают витамины и пищевые добавки, добавки с фолиевой кислотой, обезболивающие, кислородную терапию и внутривенное введение жидкости. В тяжелых случаях анемии врачи могут порекомендовать переливание крови, удаление селезенки (спленэктомию) и пересадку костного мозга.

    Типы анемии и связанные с ними коды по МКБ-10

    Здесь обсуждаются различные типы анемии и связанные с ней коды по МКБ-10 —

    Железодефицитная анемия — Этот тип анемии возникает из-за нехватки минерального железа в организме.Без достаточного количества железа организм не может производить достаточно гемоглобина для красных кровяных телец. Плохое питание, частая сдача крови, определенные проблемы с пищеварением (например, болезнь Крона), тренировки на выносливость и хирургическое удаление кишечника — вот некоторые из возможных причин этого состояния. Связанные коды МКБ-10 включают —

    • D50 — Железодефицитная анемия
      • D50.0 — Железодефицитная анемия, вторичная по отношению к кровопотере (хроническая)
      • D50.1 — Сидеропеническая дисфагия
      • D50.8 — Другие железодефицитные анемии
      • D50.9 — Железодефицитная анемия неуточненная

    Витаминодефицитная анемия — Это анемическое состояние может возникать при дефиците витамина B12 и фолиевой кислоты, необходимых для выработки красных кровяных телец. Лечение дефицита фолиевой кислоты и B-12 включает потребление пищевых добавок и увеличение количества этих питательных веществ в вашем рационе. Коды МКБ-10 включают —

    • D51 — Анемия, вызванная недостаточностью витамина B12
      • D51.0 — Анемия, вызванная дефицитом витамина B12, вызванная дефицитом внутреннего фактора
      • D51.1 — Анемия, вызванная дефицитом витамина B12, вызванная селективным нарушением всасывания витамина B12 с протеинурией
      • D51.2 — Недостаток транскобаламина II
      • D51.3 — Другая диетическая витаминно-дефицитная анемия
      • D51.8 — Другие анемии, вызванные недостаточностью витамина B12
      • D51.9 — Анемия, вызванная недостаточностью витамина B12, неуточненная
    • D52 — Фолат-дефицитная анемия
      • D52.0 — Диетическая анемия, вызванная недостаточностью фолиевой кислоты
      • D52.1 — Анемия, вызванная недостаточностью фолиевой кислоты
      • D52.8 — Другие анемии, вызванные недостаточностью фолиевой кислоты
      • D52.9 — Анемия, вызванная недостаточностью фолиевой кислоты неуточненная
    • D53 — Другие пищевые анемии
      • D53.0 — Белковая анемия
      • D53.1 — Другие мегалобластные анемии, не классифицированные в других рубриках
      • D53.2 — Скорбутическая анемия
      • D53.8 — Другие уточненные пищевые анемии
      • D53.9 — Нутриционная анемия неуточненная

    Гемолитическая анемия — это заболевание крови, при котором эритроциты разрушаются быстрее, чем они могут быть произведены. Разрушение эритроцитов называется гемолизом. Гемолитическая анемия может быть наследственной или приобретенной. Общие симптомы этого состояния включают бледность кожи, головокружение, усталость, жар, спутанность сознания и слабость или невозможность выполнять физические упражнения. Существуют различные типы гемолитической анемии, такие как серповидно-клеточная анемия, талассемия, ферментативные расстройства и другие наследственные и приобретенные заболевания.Коды МКБ-10 для различных типов гемолитической анемии включают —

    .
    • D55 — Анемия вследствие ферментативных нарушений
      • D55.0 — Анемия, вызванная дефицитом глюкозо-6-фосфатдегидрогеназы [G6PD]
      • D55.1 — Анемия, вызванная другими нарушениями обмена глутатиона
      • D55.2 — Анемия вследствие нарушения гликолитических ферментов
      • D55.3 — Анемия вследствие нарушения обмена нуклеотидов
      • D55.8 — Другие анемии, вызванные ферментными нарушениями
      • D55.9 — Анемия, вызванная нарушением ферментов, неуточненная
    • D56 — Талассемия
      • D56.0 — Альфа-талассемия
      • D56.1 — Бета-талассемия
      • D56.2 — Дельта-бета талассемия
      • D56.3 — Малая талассемия
      • D56.4 — Наследственная персистенция гемоглобина плода (HPFH)
      • D56.5 — Гемоглобин E-бета талассемия
      • D56.8 — Другие талассемии
      • D56.9 — Талассемия неуточненная
    • D57 — Серповидно-клеточные заболевания
      • D57.0 — Болезнь Hb-SS с кризом
      • D57.1 — Серповидно-клеточная анемия без криза
      • D57.2 — Серповидноклеточная болезнь / Hb-C
      • D57.3 — Серповидно-клеточный признак
      • D57.4 — Серповидно-клеточная талассемия
      • D57.8 — Другие серповидно-клеточные заболевания
    • D58 — Другие наследственные гемолитические анемии
      • D58.0 — Наследственный сфероцитоз
      • D58.1 — Наследственный эллиптоцитоз
      • D58.2 — Другие гемоглобинопатии
      • D58.8 — Другие уточненные наследственные гемолитические анемии
      • D58.9 — Наследственная гемолитическая анемия неуточненная
    • D59 — Приобретенная гемолитическая анемия
      • D59.0 — Аутоиммунная гемолитическая анемия, вызванная лекарственными средствами
      • D59.1 — Другие аутоиммунные гемолитические анемии
      • D59.2 — Лекарственная неаутоиммунная гемолитическая анемия
      • D59.3 — Гемолитико-уремический синдром
      • D59.4 — Другие неаутоиммунные гемолитические анемии
      • D59.5 — Пароксизмальная ночная гемоглобинурия [Маркиафава-Микели]
      • D59.6 — Гемоглобинурия вследствие гемолиза от других внешних причин
      • D59.8 — Другие приобретенные гемолитические анемии
      • D59.9 — Приобретенная гемолитическая анемия неуточненная

    Апластическая анемия — Рассматриваемое как редкое заболевание недостаточности костного мозга, это состояние возникает, когда костный мозг перестает производить достаточное количество кровяных телец (красных кровяных телец, белых кровяных телец и тромбоцитов). Состояние может возникнуть из-за нескольких причин, таких как — хроническое воздействие токсичных химикатов, вирусные инфекции, генетические аномалии, миелодиспластические синдромы, лечение рака и использование определенных лекарств.Лечение этого состояния может включать переливание крови для повышения уровня эритроцитов в организме. В некоторых случаях врачи могут порекомендовать пересадку костного мозга, если ваш костный мозг болен и не может производить здоровые клетки крови. Для возмещения расходов используйте следующие коды ICD-10 —

    .
    • D60 — Приобретенная аплазия чистых эритроцитов [эритробластопения]
    • D61 — Другие апластические анемии и другие синдромы недостаточности костного мозга
      • D61.0 — Конституциональная апластическая анемия
      • D61.1 — Апластическая анемия, вызванная лекарственными средствами
      • D61.2 — Апластическая анемия, вызванная другими внешними агентами
      • D61.3 — Идиопатическая апластическая анемия
      • D61.8 — Другие уточненные апластические анемии и другие синдромы недостаточности костного мозга
      • D61.9 — Апластическая анемия неуточненная

    Анемия хронического заболевания — Этот тип связан с серьезными хроническими заболеваниями, такими как запущенное заболевание почек, гипотиреоз и другие хронические заболевания, такие как рак, инфекции, волчанка, диабет и артрит.Поскольку не существует специального лечения этого типа анемии, врачи обычно сосредотачиваются на лечении основного заболевания. Если симптомы становятся серьезными, переливание крови или инъекции синтетического эритропоэтина (гормона, обычно вырабатываемого почками) могут помочь стимулировать выработку эритроцитов и снять усталость. Коды МКБ-10 включают —

    • D63 — Анемия при хронических болезнях, классифицированных в других рубриках
      • D63.0 — Анемия при опухолевых заболеваниях
      • D63.1 — Анемия при хронической болезни почек
      • D63.8 — Анемия при других хронических болезнях, классифицированных в других рубриках
    • D64 — Другие анемии
      • D64.0 — Сидеробластная анемия наследственная
      • D64.1 — Вторичная сидеробластная анемия, вызванная болезнью
      • D64.2 — Вторичная сидеробластная анемия, вызванная лекарствами и токсинами
      • D64.3 — Другие сидеробластные анемии
      • D64.4 — Врожденная дизэритропоэтическая анемия
      • D64.8 — Другие уточненные анемии
      • D64.9 Анемия неуточненная

    Любой человек, который постоянно чувствует себя слабым и усталым, должен немедленно обратиться к врачу и проверить его на анемию.

    Leave a Reply

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *