Гранатовые корки полезные свойства: Корочки граната: чем они полезны и как их употреблять

Содержание

Корочки граната: чем они полезны и как их употреблять

• Кора. Отваром из сушеной гранатовой коры (2 ч. ложки молотого порошка на 1 стакан кипятка) полезно полоскать полость рта – так десны будут крепче, а дыхание свежее.

• Кожура. При сильном кашле заливаем 1 ст. ложку сушеной гранатовой кожуры 1 стаканом кипятка, настаиваем до порозовения воды и медленно выпиваем в теплом виде. А для жирной кожи лица и при угрях делаем маску: поджариваем сухую молотую кожуру на оливковом масле и наносим теплую смесь на кожу.

• Плоды. Самая большая польза – в косточках. Они богаты омолаживающими веществами, стимулируют работу гормональной системы, идут на пользу как женскому, так и мужскому здоровью. Гранат может гармонизировать давление, успокоить головную боль, хорошо укрепляет стенки сосудов и сердечную мышцу, повышает уровень гемоглобина.

• Светлая прослойка. Интересно, но внутренние пленки-перемычки граната можно жевать свежими или заваривать вместо чая.

Они очень полезны женщинам при раздражительности в особые дни, при бессоннице, при моральной истощенности и апатии.

• Сок. Поедание граната целиком может быть противопоказано при заболеваниях ЖКТ, запорах, геморрое и пр. Но это не исключает употребление полезного гранатового сока, главное – разбавить его водой. Сок граната насытит кровь полезными веществами, поможет организму побороть и оправиться после вирусных инфекций, обладает желчегонным и мочегонным эффектами. Свежевыжатым соком можно полоскать горло при ангине.

• Мужчины в Турции и Греции считают гранатовый сок самым сильным любовным эликсиром.

• Гранатов без косточек не бывает, просто в некоторых сортах они очень тонкие и почти прозрачные.

Вам понравилась статья? Желаете узнать больше?

Если да, то рекомендуем приобрести подписку на журнал «Всему свету по совету» в один клик на нашем сайте.


Гранатовая кожура: полезные свойства, применение, отвар

Польза граната для улучшения состава крови, повышения иммунитета известна всем. Но многие, не задумываясь, выбрасывают гранатовую кожуру, не подозревая о ее полезных свойствах.

Хотя о пользе кожуры граната было известно со времен Гиппократа

. Толченой коркой засыпали ожоговые и гнойные раны, настоем поили при желудочно-кишечных заболеваниях.

Химический состав

Изучением химического состава гранатовой шкурки занимаются ученые разных стран. Исследования китайских ученых утверждают, что кожура граната по содержанию антиоксидантов обогнала гранатовые зерна в два раза.

Содержащиеся в ней вещества можно разделить на основные группы:

  • дубильные вещества;
  • минералы и микроэлементы;
  • антиоксиданты;
  • кислоты.

Танины и катехины, относящиеся к дубильным веществам, составляют около 30 процентов полезных веществ шкурок. Именно они вызывают вяжущее действие и терпкий вкус.

Все минералы и микроэлементы даже трудно перечислить. Но с уверенностью можно сказать, что в корках граната присутствуют все основные элементы, необходимые человеческому организму.

Необходимо упомянуть железо, калий и кальций, марганец и цинк, медь и селен, магний и кобальт.

Полифенолы, флавоноиды, принадлежащие к антиоксидантам, защищают организм, очищая сосуды от холестерина низкой плотности. Поэтому употребление настоя из гранатовых корок благотворно влияет на работу сердца.

В наибольшем количестве в шкурках представлена

урсоловая кислота. В состав корок входят также лейцин, лизин, треонин, витамины E, группа B.

Кожура содержит витамины и минералы, дубильные вещества и антиоксиданты

Польза шкурок

Основным полезным свойством корок граната является вяжущее средство, используемое при диарее, отравлениях и болезнях ЖКТ. При этом полезная микрофлора кишечника не страдает.

Одновременно антиоксиданты, присутствующие в кожуре, выводят вредные вещества из организма. Очищающее действие оказывает лекарство из гранатовой шкурки и на печень.

Антимикробное, противовоспалительное действие используется при заболеваниях полости рта, воспалении горла.

Народная медицина применяет отвар гранатовых корок для избавления от глистов, но официальная медицина не подтверждает эффективность средства.

Многих женщин заинтересует, что кожура оказывает косметологическое действие:

  • увлажняющее действие на кожу;
  • защита кожи от ультрафиолета;
  • предотвращение старения кожи;
  • предотвращение выпадения волос и образования перхоти.

Маска из кожуры граната:

Противопоказания

Основанием отказа от лечения гранатовой кожурой служат такие заболевания:

  • аллергия на составляющие;
  • запоры;
  • гепатит;
  • геморрой.

При лечении настоями или отварами кожуры нельзя принимать антигистаминные препараты, алкоголь. Наличие в корках алкалоидов требует тщательного соблюдения дозировки, чтобы не допустить отравления.

Полезные и лечебные свойства

Свойства кожуры используются для лечения заболеваний желудочно-кишечного тракта:

  • диареи;
  • дисбактериоза;
  • колитов;
  • язвы желудка и двенадцатиперстной кишки.

Настой корок граната оказывает положительный эффект при лечении аритмии сердца, заболевании печени. Он используется для повышения гемоглобина, очистки сосудов от холестерина.

Новейшие исследования американских ученых доказали противораковые свойства антиоксидантов, присутствующих в кожуре. Важную роль они играют для профилактики рака кожи.

Порошок из сухих корок издавна используется для лечения ран, в том числе гнойных, ожогов, трофических язв.

Средства из кожуры применяют для лечения заболеваний ЖКТ, окологии, ожогов и т.д.

Применение при беременности

При беременности нежелателен прием лекарственных препаратов, поэтому отвар из кожуры граната поможет в борьбе с заболеваниями горла и ротовой полости.

При расстройстве кишечника отвар избавит от поноса и болевых ощущений.

Для приготовления отвара потребуется 20 грамм сухой кожуры и полтора стакана кипятка. Корку мелко измельчают и заливают стаканом кипятка.

На маленьком огне отвар кипятят полчаса. Процеженный отвар доливают кипятком до одного стакана. Принимают по две чайные ложки несколько раз в день, но не более пяти.

Рецепты с гранатовой кожурой: отвары, настои, порошок

Кожура граната используется в виде настоя, отвара или порошка.

При кишечных расстройствах отвар готовят из одной столовой ложки сухих шкурок, отваренных на маленьком огне в полулитре кипятка в течение десяти минут. Отвар заливают в термос и настаивают два часа. Принимают перед едой три раза в день по 50 мл.

Для детей до семи лет дозировку уменьшают до одной чайной ложки. Грудным детям лекарство дают три раза в день, а старшим детям — 4-5 раз. Подросткам можно давать по столовой ложке три раза в день.

Для полосканий горла 20 грамм корок кипятят пять минут в стакане воды, затем настаивают в термосе около часа. Количество полосканий — пять раз в сутки на протяжении недели.

Чай из заваренных гранатовых корок помогает при кашле, особенно хроническом. Заваривать можно как сухие, так и свежие корки.

Из кожуры граната готовят отвар, настой и порошок из сушеных корок

Чай получается бледного цвета, советуем подсластить его медом, ароматизировать мятой, лимоном. В течение дня выпивают стакан чая небольшими порциями.

Для борьбы с глистами народные целители рекомендуют следующий рецепт: необходимо взять 50 грамм корочек и залить пол-литра холодной воды, настоять шесть часов.

Кипятят на слабом огне до тех пор, пока количество жидкости не уменьшится вдвое. Отвар процеживают и выпивают на голодный желудок в течение часа небольшими порциями. Спустя полчаса необходимо принять слабительное.

Сухие корки измельчают в кофемолке или в ступке

: ими присыпают раны, ожоги.

Порошок из корок принимают внутрь при маточных кровотечениях, обильных месячных по чайной ложке с водой два раза в день.

Заготовленные впрок сухие корочки граната, предварительно очищенные от белой внутренней кожуры, станут полезным дополнением в домашней аптечке.

Отвар из них придет на выручку при внезапном расстройстве, ожогах и ранах, если нет возможности купить лекарственные препараты или они противопоказаны.

Чтобы не допустить отравления алкалоидами, необходимо соблюдать дозировку при приготовлении и применении отвара.

Польза гранатовой кожуры — Со Вкусом

Любители плодов граната часто не догадываются о пользе кожуры, употребляя только зернышки. Мы советуем не выбрасывать корки и расскажем почему.

Гранатовые корки содержат ряд минеральных веществ, натуральных антиоксидантов и других важных компонентов. Все они в совокупности важны для организма человека.

Лечебные свойства гранатовой кожуры

  1. Способствует заживлению ран и ожогов

    О противовоспалительном и ранозаживляющем эффекте гранатовой кожуры хорошо знал Гиппократ. На резаные и колотые раны он накладывал ткань, смоченную в водном настое корок. И поддерживал ее влажной до тех пор, пока рана не заживет.

    При ожогах рану можно протереть разбавленным гранатовым соком, а затем присыпать порошком из кожуры. Так регенерация будет проходить быстрее.

  2. Останавливает кровотечения

    При обильных месячных пьют отвар, приготовленный на основе корок. А для наружных применений одну чайную ложку порошка разводят водой до состояния пасты.

  3. Избавляет от проблем желудочно-кишечного тракта

    Для приготовления лечебного чая необходимы в равных пропорциях: сушенные корки граната, имбирь, тмин, сушеная мята и листья зеленого чая. Одну чайную ложку порошка залейте стаканом воды, доведите до кипения и держите еще пару минут на огне. Затем дайте немного настояться, процедите и добавьте мёд. Это проверенное средство при диарее, дизентерии, кишечных расстройствах и поражениях слизистой кишечника. Такой чай эффективен и для избавления от паразитов.

    Прием в течение нескольких недель приносит долгожданные результаты, избавляя организм от возбудителей сальмонеллеза, брюшного тифа, холеры, а также от хеликобактер пилори и других бактерий.

  4. Выводит из организма токсины

    Корки граната богаты антиоксидантами, которые помогают печени быстро выводить из организма вредные вещества.

  5. Эффективна при простудных заболеваниях

    Гранатовая кожура — источник витамина С. Водным раствором на основе корок промывают воспаленное горло. Смесью из кожуры и гималайской розовой соли (8 : 1), которую разбавляют водой до состояния густой пасты, лечат кашель. Эту смесь скатывают в небольшие шарики и принимают, рассасывая, по одному 3–4 раза в день.

  6. Полезна для десен и носоглотки

    Отвары для полосканий применяют при кровоточащих деснах, стоматите и гингивите. Они снимают воспаления и дезинфицируют ротовую полость. Эффективным это средство будет и при рините, а также фарингите.

  7. Улучшает состояние волос и кожи

    Ополаскиватель с корками граната устраняет перхоть и укрепляет волосы, а еще делает их темнее. Измельченная кожура, разбавленная розовой водой, предотвращает появление прыщей и угревой сыпи. А еще такие маски разглаживают морщины и омолаживают кожу.

Как сделать гранатовый порошок?

Кожуру с помытого и обсушенного гранатового плода нужно аккуратно снять ножом, а внутреннюю белую мякоть удалить. Корочки следует измельчить и высушить. Потом их можно хранить в стеклянных банках или бумажных пакетах. Для измельчения подойдет кофемолка или ступка.

Противопоказания
Несмотря на все полезные свойства гранатовой кожуры, она, как и любое лекарство, имеет противопоказания. Отвар на основе корок нельзя употреблять при хронических запорах, гепатите, остром нефрите, беременности и кормлении грудью. И в любом случае, прежде чем принимать отвар, посоветуйтесь с лечащим врачом.

Теперь вы, кушая плоды граната и готовя из него блюда, наверняка, не будете спешить выбрасывать корки. Сохраните себе эту информацию, а также поделитесь с друзьями.

Для красивой кожи и здорового сердца: все о пользе и вреде граната

https://ria.ru/20210211/granat-1597059733.html

Для красивой кожи и здорового сердца: все о пользе и вреде граната

Для красивой кожи и здорового сердца: все о пользе и вреде граната — РИА Новости, 11.02.2021

Для красивой кожи и здорового сердца: все о пользе и вреде граната

Гранат — это род кустарников и небольших деревьев, достигающих в высоту 5-6 метров. О полезных свойствах граната и противопоказаниях — в материале РИА Новости. РИА Новости, 11.02.2021

2021-02-11T16:07

2021-02-11T16:07

2021-02-11T16:07

продукты

питание

кулинария

еда

ягоды

витамины

средняя азия

здоровый образ жизни (зож)

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdn21.img.ria.ru/images/07e4/0c/07/1588031482_0:0:3067:1725_1920x0_80_0_0_d416e3917810fd44fdfb53f5e1b18512.jpg

МОСКВА, 11 фев — РИА Новости. Гранат — это род кустарников и небольших деревьев, достигающих в высоту 5-6 метров. О полезных свойствах граната и противопоказаниях — в материале РИА Новости.Родина и история гранатаРодина граната обыкновенного, который продается в любом супермаркете — Северная Африка и Средняя Азия, однако сейчас кустарник выращивают и за пределами этих территорий, в странах с субтропическим климатом. В древности его плоды считались необычайно ценными и использовались для лечения бесплодия. Также применялись в качестве красителя для тканей. В Древнем Риме у граната было два названия — «финикийское яблоко» и «зернистое яблоко». В Древней Персии плоды почитались как символ плодородия и вечной жизни и росли в садах зороастрийских храмов.Многие исследователи полагают, что культура граната зародилась по меньшей мере 4 тысячелетия назад. Упоминания о нем встречаются уже в ранних древнегреческих источниках.Чем полезен гранатГранат богат витаминами С, В6, В12, Р и микроэлементами: йодом, железом, натрием, кальцием, калием, магнием, марганцем, фосфором. Его зерна полезны для сердечно-сосудистой системы и повышают иммунитет. В 100 г граната содержится 70 ккал. Польза гранатового сока отмечается при анемии, пониженном гемоглобине, а также в восстановительный период после болезней. Из-за высокого содержания железа, гранат при беременности может предотвратить железодефицитную анемию, которая часто встречается у женщин в положении. Считается, что корки граната полезны для очищения организма, из них делают лекарственные настои или чай. Может ли гранат быть вреденВ некоторых случаях гранат может быть вреден для организма. Например, его сок противопоказан людям с гастритом с повышенной кислотностью и язвенной болезнью. Другие противопоказания к употреблению:Также гранат нельзя давать детям до трех лет. Применение в кулинарииВ основном гранат едят в свежем виде, однако часто он становится ингредиентом разных рецептов. Например, его сок часто используется в качестве маринада для мяса, заправленного специями и чесноком. Также его зерна добавляют в салаты, жареные, тушеные и вареные блюда, делают из них варенье. Гранат универсален, потому что хорошо сочетается со многими продуктами — овощами, фруктами, мясом, птицей и т.д.Как выбрать и хранитьСчитается, что большие плоды граната сочнее маленьких. При корка не должна быть влажной и эластичной — это свидетельствует о недозрелости продукта.»При покупке гранатов обратите внимание на пухлые и крупные плоды со свежим цветом и богатым ароматом, — посоветовала Вероника Хованская. — Они должны иметь тонкую жесткую корку без пятен. Корона должна быть свободна от плесени. Допускается окрас от красного до красно-коричневого цвета, это не влияет на вкус. При комнатной температуре гранаты могут лежать до двух недель, а в сухом, прохладном месте — до месяца. Не рекомендуется замораживать целые фрукты, а вот зернышки в герметичной упаковке могут быть заморожены на срок до одного года».При длительном хранении гранаты можно обернуть бумагой или пергаментом, чтобы из плодов не испарялась влага. Гранатовые корки можно высушить для приготовления отваров. Как правильно употреблятьСчитается, что если у человека нет особых проблем с желудочно-кишечным трактом, то гранат можно есть с косточками. Они не навредят, а даже могут улучшить перистальтику кишечника.

https://ria.ru/20201119/finiki-1585394635.html

https://ria.ru/20201113/inzhir-1584539834.html

средняя азия

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2021

РИА Новости

[email protected] ru

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdn25.img.ria.ru/images/07e4/0c/07/1588031482_72:0:2801:2047_1920x0_80_0_0_fbaa9be8d1980352ff16b204072b5c9b.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

продукты, питание, кулинария, еда, ягоды, витамины, средняя азия, здоровый образ жизни (зож)

МОСКВА, 11 фев — РИА Новости. Гранат — это род кустарников и небольших деревьев, достигающих в высоту 5-6 метров. О полезных свойствах граната и противопоказаниях — в материале РИА Новости.

Родина и история граната

Родина граната обыкновенного, который продается в любом супермаркете — Северная Африка и Средняя Азия, однако сейчас кустарник выращивают и за пределами этих территорий, в странах с субтропическим климатом. В древности его плоды считались необычайно ценными и использовались для лечения бесплодия. Также применялись в качестве красителя для тканей. В Древнем Риме у граната было два названия — «финикийское яблоко» и «зернистое яблоко». В Древней Персии плоды почитались как символ плодородия и вечной жизни и росли в садах зороастрийских храмов.

Многие исследователи полагают, что культура граната зародилась по меньшей мере 4 тысячелетия назад. Упоминания о нем встречаются уже в ранних древнегреческих источниках.

Чем полезен гранат

Гранат богат витаминами С, В6, В12, Р и микроэлементами: йодом, железом, натрием, кальцием, калием, магнием, марганцем, фосфором. Его зерна полезны для сердечно-сосудистой системы и повышают иммунитет. В 100 г граната содержится 70 ккал.

«Сок граната понижает количество «плохого» холестерина и улучшает кровообращение в сердце, что делает его более здоровым, — рассказала РИА Новости нутрициолог Вероника Хованская. — Витамин С помогает в производстве коллагена, который, в свою очередь, сохраняет упругость кожи и делает ее более молодой. Также гранат очищает артерии — если ежедневно съедать плод, то бляшки на стенках артерий удаляются естественным путем. Это еще не вся польза граната. Плоды этого кустарника снижают риск развития болезни Альцгеймера, помогают регенерации клеток, предотвращают диарею, улучшают здоровье костей, борются с акне, регулируют кровяное давление».

Польза гранатового сока отмечается при анемии, пониженном гемоглобине, а также в восстановительный период после болезней. Из-за высокого содержания железа, гранат при беременности может предотвратить железодефицитную анемию, которая часто встречается у женщин в положении.

Считается, что корки граната полезны для очищения организма, из них делают лекарственные настои или чай.

19 ноября 2020, 17:18

Пища долгожителей: все о пользе и вреде фиников

Может ли гранат быть вреден

В некоторых случаях гранат может быть вреден для организма. Например, его сок противопоказан людям с гастритом с повышенной кислотностью и язвенной болезнью.

Другие противопоказания к употреблению:

  • острая стадия панкреатита;
  • запоры
  • аллергия на гранат;
  • заболевания зубов и эмали.

Также гранат нельзя давать детям до трех лет.

Применение в кулинарии

В основном гранат едят в свежем виде, однако часто он становится ингредиентом разных рецептов. Например, его сок часто используется в качестве маринада для мяса, заправленного специями и чесноком. Также его зерна добавляют в салаты, жареные, тушеные и вареные блюда, делают из них варенье. Гранат универсален, потому что хорошо сочетается со многими продуктами — овощами, фруктами, мясом, птицей и т. д.

Как выбрать и хранить

Считается, что большие плоды граната сочнее маленьких. При корка не должна быть влажной и эластичной — это свидетельствует о недозрелости продукта.

«При покупке гранатов обратите внимание на пухлые и крупные плоды со свежим цветом и богатым ароматом, — посоветовала Вероника Хованская. — Они должны иметь тонкую жесткую корку без пятен. Корона должна быть свободна от плесени. Допускается окрас от красного до красно-коричневого цвета, это не влияет на вкус. При комнатной температуре гранаты могут лежать до двух недель, а в сухом, прохладном месте — до месяца. Не рекомендуется замораживать целые фрукты, а вот зернышки в герметичной упаковке могут быть заморожены на срок до одного года».

При длительном хранении гранаты можно обернуть бумагой или пергаментом, чтобы из плодов не испарялась влага. Гранатовые корки можно высушить для приготовления отваров.

13 ноября 2020, 18:35

Ни фрукт, ни ягода, ни овощ: польза и вред инжира

Как правильно употреблять

Считается, что если у человека нет особых проблем с желудочно-кишечным трактом, то гранат можно есть с косточками. Они не навредят, а даже могут улучшить перистальтику кишечника.

Чай из корки граната и его свойства

Чай из корки грана считается полезным при многих заболевания. Кожура граната, которая является вяжущей, а также горькой на вкус, может использоваться для лечения многочисленных проблем. Благодаря  горьковатому вкусу кожуры, она поможет уменьшить отеки, воспаления, диарею, дизентерию, кровотечение и многое другое. Она способствует заживлению, ускоряет пищеварение, а также является тонизирующим средством для печени. Она поставляется в комплекте с антиоксидантами и может быть использован в качестве мощного консерванта в пищевых продуктах наряду с фармацевтикой. В действительности, кожура граната содержит больше антиоксидантов по сравнению с артерилами.

Мало кто знает, что гранатовые корки – это невероятно полезный, лечебный и действительно волшебный продукт. Мы можем принести своему здоровью колоссальную пользу, просто настаивая корки граната.

Корки граната — полезные свойства

  • Оказывают мощное противопаразитарное и противовоспалительное действие, подавляют болезнетворную микрофлору.
  • Оказывают антибактериальное действие на полость рта – предотвращают возникновение пародонтоза, образование зубного камня, устраняют неприятный запах.
  • Благотворно влияют на состояние кожи и волосистой части головы. Такой напиток может быть использован, как тоник – особенно для кожи, склонной к дерматозам, жирности и образованию угревой сыпи и для полоскания волос, склонных к себорее.
  • Являются прекрасным средством для восстановления нервной системы. Нормализуют сон, снижают последствия стресса.

Сам рецепт, разумеется, не содержит ничего необыкновенного. Все довольно просто.

Если вы еще что-то знаете о свойствах корок граната и способах их употребления, пожалуйста, поделитесь ими с нами в комментариях!

  • Свежие или сухие корки граната  
  • Вода фильтрованная  
  • Цитрусовые травы  
  • Корки граната порезать небольшими кусочками и высушить при комнатной температуре. Можно использовать свежие.

  • Засыпать их в термос и залить кипятком. Оставить настаиваться на несколько часов или на ночь. Можно досыпать в термос любые травы по вашему усмотрению:

  • Добавьте немного гранатовых выжимок и корочек и смешайте со свежевыжатыми соками и пейте такой полезный напиток вместе с сыроедческими сладостями. Приятного аппетита!

( 9 оценок, среднее 4 из 5 )

Полезные свойства граната, косточек и кожуры. Омоложение


Декоративное растение гранатник дарит поздней осенью свои чудо-плоды — гранаты. Целебные свойства граната воспеваются со времен древнеиндийских манускриптов и греческих писаний. И в наши дни гранат не утратил свою популярность. Плоды граната, косточки и кожура очень полезны, обладают лечебными свойствами. Гранат содержит большое количество полифенолов, витамина С и ненасыщенных жирных кислот, которые влияют на выработку оксида азота. Это вещество улучшает проходимость кровеносных сосудов, что увеличивает кровообращение в организме, и предотвращает образование тромбов.

1. Одно из целебных свойств граната — борьба с анемией, плоды граната, гранатовый сок повышают гемоглобин. При малокровии употребляют разведенный гранатовый сок по 0,5 стакана 3 раза в день за 30 минут до еды в течение 2 месяцев.

2. Кора спелого граната содержит алкалоиды пельтьерин, изопельтьерин и метилизопельтьерин, которые обладают сильным противоглистным действием. Чтобы избавиться от глистов, настаивают 40—50 г измельченной коры в 400 г холодной воды в течение 6 часов, а затем кипятят на медленном огне, пока не выпарится половина жидкости. Остывший отвар процеживают и выпивают в течение часа мелкими порциями, через час выпивают слабительное, а через 4—5 часов делают клизму.

3. Полезные свойства граната, косточек, кожуры, их применение. Кожура и плоды граната обладают вяжущим свойством, поэтому их используют против поноса, при диарее, от колита и энтероколита. Кожуру граната сушат, измельчают и принимают, взрослые — по щепотке 3 раза в день после еды, а детям дают — свежеотжатый сок, разведенный наполовину водой. В случае инфекционной диареи, полифенолы, содержащиеся в кожуре граната, эффективно уменьшают рост дизентерийной палочки и других возбудителей.

4. Водный отвар из кожуры граната или его сок применяют для полоскания горла (при ангине и фарингите), полости рта (при гингивите и стоматите), Дезинфицирует рот и горло. Дубильные вещества снимают боль, а органические кислоты уничтожают инфекцию.

5. Плоды граната — полезны диабетикам. Для этого употребляют по 100 г сока 4 раза в день до еды.

6. Выводит радиацию. Сок граната очень полезен всем, кто работает с радиоактивными изотопами или живет в зоне повышенной радиации.

7. При жирной коже, угрях делают маску из слегка поджаренной, толченой кожуры граната смешанной со сливочным или оливковым маслом. Хранят эту смесь в холодильнике, наносят на кожу не чаще 2 раз в неделю. Порошком из высушенной кожуры можно эффективно лечить угревую сыпь на коже, ожоги, трещины и царапины.

8. Зернышки граната очень мягко снижают артериальное давление у гипертоников. А перепонки из плодов граната, высушенные и добавленные в чай, помогут успокоить нервную систему, избавиться от тревоги, наладить ночной сон.

9. Повышает активность гормонов. В косточках граната содержатся масла, которые восстанавливают гормональный баланс в организме. Поэтому гранатовые зернышки съедают, особенно они полезны при болезненных месячных, головных болях и климаксе.

10. При различных воспалительных заболеваниях (почек, печени, ушей и глаз, суставов, гинекологических органов) помогает отвар кожуры граната. 2 чайные ложки измельченной гранатовой кожуры заливают 1 стаканом горячей воды, кипятят на водяной бане 30 минут, процеживают, отжимают и разводят кипяченой водой до исходного количества. Принимают по 50 г 2—3 раза в день за 30 минут до еды.

Внимание:
Кожура граната содержит небольшое количество очень ядовитых веществ — алкалоидов. Никогда не превышайте дозировку отваров, иначе повышение давления, головокружение, ухудшение зрения и судороги. Кроме этого, органические кислоты сока граната могут сильно разрушить зубную эмаль. Поэтому всегда разбавляйте сок водой.

Водный настой сухих корок плодов Граната лечит многие болезни. Это универсальное природное лекарство: водный настой сухих корок плода граната. Оно излечивает от поражения любым штаммом при заболеваниях: Дизентерия, Сальмонеллез (известно около 400 штаммов), Холера, Брюшной тиф, Язва желудка и кишечника (тонкая кишка), Колит (толстая кишка), Дисбактериоз, Острый аппендицит и необходимсть в хирургической операции отпадает, лечатся таким настоем неделю.

Рецепт приготовления водного настоя сухих корок плода граната и его применения.

В предварительно подогретую чашку, стакан или стеклянную баночку положить примерно 10-12 г сухих корок плода граната и залить их 200 мл крутого кипятка (можно в эту тару налить 200 мл сырой воды, опустить 10-12 г гранатовых корок и электрокипятильником довести до кипения, но не кипятить). Накрыть и настоять 25-30 минут, потом можно пить по 20-25 мл за 1 приём. Пить натощак, причём 1-й приём утром, после сна, а 4-й приём на ночь, перед сном. Корки не выбрасывать, настаивание продолжается.

При этом лечении спиртное противопоказано. Сущность лечения состоит в том, что во всём желудочно-кишечном тракте постоянно подавляются все болезнетворные бактерии (здоровые бактерии не подавляются) и места их расположения успешно колонизируют здоровые, необходимые для человека бактерии.

Кроме перечисленного, известно, что Гиппократ лечил этим водным настоем резаные и колотые раны. На рану накладывалась чистая (х/б) тряпочка, предварительно смоченная в водном настое сухих корок плода граната. Эта тряпочка постоянно поддерживалась влажной до заживления раны.

полезные свойства и вред. Лечение гранатовыми корками

В народной медицине считаются целебными гранатовые корки. Польза и вред для здоровья их обусловлены многими причинами, с которыми мы постараемся разобраться в данной статье. Удивительно, но в них отсутствуют химические соединения, способные оказать ощутимое действие на организм человека. При этом применяются они очень широко. Итак, сегодня мы узнаем, почему так востребованы в нетрадиционной медицине гранатовые корки, польза и вред которых вызывают насмешки скептиков.

Свойства

Какие же свойства делают их настолько популярными в народной медицине? Об этом умалчивает большинство источников. Поэтому попробуем проанализировать собственными силами химический состав данного «лекарства». Плод граната как минимум на четверть состоит из кожуры. Гранатовые корки содержат:

  • немного витаминов;
  • несколько микроэлементов;
  • биофлавоноиды;
  • полифенолы;
  • катехины;
  • эллаговую кислоту;
  • дубильные вещества.

Микроэлементы и витамины не могут оказывать сильного и быстрого воздействия на организм. А значит, если гранатовые корки, польза и вред которых вызывают большие сомнения, и обладают лечебными свойствами, то они связаны с какими-то другими веществами. Катехины, биофлавоноиды, полифенолы оказывают противопаразитарное, антиоксидантное, противомикробное действие. Противовоспалительными свойствами обладают дубильные вещества.

Лечение поноса

В средствах массовой информации и специальной литературе польза для здоровья человека гранатовых корок сильно приукрашена. К примеру, в некоторых источниках говорится о том, что за счет мощного противомикробного действия данное средство может уничтожить любую инфекцию в ЖКТ. Авторы статей рекомендуют корками лечить понос, не рассматривая причины его появления.

Но ведь диарея – это только симптом, а не заболевание. У нее множество причин для появления. А значит, и лечение проводиться должно только после установления диагноза. Для начала необходимо выяснить причину возникновения поноса, а потом устранить ее для того, чтобы снять все симптомы. Несмотря на то что кишечные инфекции — самая частая причина диареи, она — не единственная.

Причем если диарея все же вызвана микроорганизмами, то шкурками граната лечиться нельзя. Они, конечно, противомикробной активностью обладают, но не такой выраженной, чтобы ожидать быстрого и полного выздоровления. С инфекциями даже антибиотики не в состоянии справиться за один день. Что тогда говорить про гранатовые корки? Но, по мнению поклонников народной медицины, они позволяют вылечить:

При этом не только вылечить. Есть мнение, что данные заболевания, от которых вымирали в свое время целые города, под противомикробным мощным действием корок граната проходят за каких-то несколько часов. Подобным эффектом не обладает ни один современный антибактериальный препарат. Скорее всего, это выдумка. Безусловно, гранат может оказывать закрепляющее действие, но только мгновенно уничтожить патогенную флору кишечника он не в состоянии.

Дисбактериоз

Гранатовые корки (польза и вред их описаны в этой статье) используют для лечения не только диареи. Люди с их помощью пытаются справиться с различными заболеваниями. К примеру, отваром из них лечат дисбактериоз. При этом поклонники нетрадиционной медицины сами себе противоречат. В основном, причина дисбактериоза – это уничтожение антибактериальными препаратами нормальной микрофлоры кишечника, которое возникает в процессе лечения кишечной инфекции, пневмонии и пр.

При этом большинство любителей корок граната заявляют, что данное средство обладает противомикробным мощным эффектом. Другими словами, оно должно симптомы дисбактериоза только усугублять, угнетая рост микрофлоры кишечника. Так отчего этого не происходит?

Гранатовые корки: польза при борьбе с возрастными изменениями

Применение в комплексе масла гранатовых семян вместе с экстрактом кожуры способствует быстрому синтезу проколлагена, как говорится в разных тематических статьях. Такое белковое соединение может предотвратить деятельность ферментов, расщепляющих коллаген, а также способствует стремительному клеточному росту. Следовательно, благодаря гранатовым продуктам можно приостановить появление морщин и процесс старения кожи.

Здоровье волос и кожи

Для здоровья волос также используются гранатовые корки. Польза их научно не доказана. Но в народной медицине есть мнение, что они помогают бороться с потерей волос, а также используются для профилактики перхоти. Цедра этого фрукта вместе с розовой водой якобы хорошо справляется с угревой сыпью и прыщами.

Лечение корками граната

В народной медицине возможно лечение гранатовыми корками не только перечисленных выше заболеваний. Они используются также при патологии сердца, глистной инвазии, анемии, иммунодефиците, бесплодии. Только есть ли в их применении смысл при подобных болезнях? Корки имеют противоглистную активность. Вероятно, благодаря антиоксидантам, которые они содержат, на работу сердца они влияют положительно. Но при остальных патологиях лечение гранатовыми корками лучше не проводить.

Это средство вас от анемии не избавит. Собственно, как и от бесплодия. Гранатовые корки на состояние иммунитета, скорее всего, также не оказывают какого-либо влияния. Не стоит их использовать и для борьбы с глистами, поскольку для этого существует масса более эффективных препаратов. А при патологии сердца антиоксиданты прописывают в таблетках. Их больше там, стоят они дешевле. Кроме того, эффект от их использования научно подтвержден.

Вред граната

С древних времен в нетрадиционной медицине используются гранатовые корки. Польза и вред от их применения очень разнообразны. Если вы все же решили попробовать вылечить то или иное заболевание с их помощью, не забывайте о том, что с ними нужно соблюдать осторожность. Так, чтобы не возникли проблемы с зубами, нужно с осторожностью относиться к соку граната. Он может разъедать ослабленную и истонченную эмаль, при этом окрашивая обнажившийся дентин. Чтобы зубы не потемнели и не разболелись, до того как употребить сок, желательно воспользоваться специальной защитной пастой.

При язве желудка и двенадцатиперстной кишки гранат вреден. Если у вас панкреатит или гастрит с высокой кислотностью, от этого фрукта также лучше отказаться. Он очень кислый, содержит лимонную, щавелевую, яблочную, винную, борную и янтарную кислоты. Также является сильным аллергеном, поэтому давайте его детям с особой осторожностью.

Гранатовые корки: отзывы

Отзывы о лечении гранатовыми корками можно встретить различные. Часть из них оставляют молодые мамы, которые ими лечили поносы у детей. И делали это успешно. Не зная о том, что у маленьких детей понос часто носит исключительно функциональный характер и проходит самостоятельно, вне зависимости от применения корок граната. Но мамам спокойнее, если они что-то делают, а не ждут, когда диарея сама по себе пройдет. Для их психологического равновесия гранатовые корки, безусловно, полезны.

Другие девушки ими пытаются лечить анемию. Они, вероятно, полагают, что раз наша кровь красного цвета, то малокровие следует лечить с помощью красных фруктов. При этом в корках граната железа очень мало, а значит, анемию они точно не лечат. Также их пытаются использовать при климаксе, ПМС и дисбактериозе. Судя по многочисленным отзывам, отвар, приготовленный из корок, обладает отвратительным вкусом. Но девушки все же его принимают, надеясь таким образом решить свои проблемы со здоровьем.

11 полезных свойств кожуры граната, о которых вы даже не подозревали!

Вы выбрасываете кожуру граната после того, как срежете плод? Вот причины, по которым вы должны их сохранить и лучше использовать.

Автор Дебджани Арора | Обновлено: 27 января 2016 г., 15:42 IST

Гранаты известны своим вкусом и удивительной пользой для здоровья. В то время как большинство из нас жуют красные острые крошечные семечки или фрукты, чтобы пожинать плоды, от их жесткой красной кожуры часто отказываются.Впрочем, как и фрукт. кожуре тоже есть что предложить. Вот несколько преимуществ кожуры граната, о которых вы, вероятно, никогда не знали. Вот как апельсиновая корка поможет вам улучшить вашу красоту.

Гранатовая кожура полезна для здоровья кожи и волос

Вот как фруктовая кожура помогает вывести вашу красоту и уход за волосами на новый уровень:

# 1 Он борется с прыщами, прыщами и сыпью.

Благодаря своим лечебным свойствам, пилинг граната может эффективно бороться с прыщами, прыщами и сыпью.Пилинги богаты антиоксидантами и помогают сдерживать бактерии и другие инфекции. Вот несколько лечебных трав, чтобы избавиться от прыщей.

Как использовать: Возьмите горсть высушенных на солнце кожуры граната и обжарьте их на горячей tava или на сковороде с глубоким дном. Дайте им остыть и измельчите их в мясорубке или миксере. Сделайте пасту из этой пудры с лимонным соком или розовой водой и нанесите ее на все лицо, особенно на прыщи или прыщи.Дайте ему высохнуть, затем тщательно смойте теплой водой.

# 2 Предотвращает появление морщин и других признаков старения.

Пилинги предотвращают распад коллагена в вашей коже, в свою очередь способствуя росту клеток, что помогает эффективно задерживать признаки старения и морщины. Вот 10 советов, как предотвратить появление морщин и других признаков старения.

Как использовать: Возьмите две ложки высушенной на солнце и порошковой цедры и добавьте к ней немного молока.Если у вас жирная кожа, добавьте в порошок розовую воду вместо молока и сделайте из него пасту. Нанесите эту пасту на лицо и держите, пока она не высохнет. Вымойте лицо теплой водой и попробуйте использовать порошок не реже двух раз в неделю для достижения лучших результатов.

# 3 Действует как естественный увлажняющий крем.

Гранатовый пилинг отлично подходит для вашей кожи. Он увлажняет и защищает вашу кожу от загрязняющих веществ и других токсинов окружающей среды. Восстанавливает pH-баланс кожи. Эллаговая кислота, присутствующая в пилингах, удерживает влагу в коже.сохраняя его мягким и эластичным. Вот как естественным образом увлажнить кожу.

Как использовать: Вяленую кожуру граната измельчить в миксере и высыпать порошок в чистую миску. Сделайте столько порошка, чтобы хватило на неделю, и храните его в герметичном контейнере. Возьмите две ложки порошка и хорошо смешайте с йогуртом, чтобы получилась паста. Нанесите эту пасту на лицо и шею и оставьте на 10 минут. Далее смыть холодной водой.

# 4 Действует как эффективный скраб для лица.

Гранатовый пилинг может помочь в удалении омертвевшей кожи, черных и белых пятен с лица при использовании в виде скраба для лица.Вот 10 натуральных домашних скрабов для лица, которые помогут избавиться от омертвевшей кожи.

Как использовать: Возьмите две ложки сушеного на солнце гранатового порошка и добавьте к нему одну ложку коричневого сахара. Чтобы приготовить пасту, добавьте одну ложку меда, одну ложку масла авокадо или любое эфирное масло по вашему выбору и хорошо перемешайте. Затем потрите лицо домашним скрабом и тщательно помассируйте. Смойте водой, чтобы кожа стала гладкой и эластичной. Однако не забудьте использовать тоник и увлажняющий крем после очистки.

# 5 Действует как естественный солнцезащитный крем.

Гранатовые кожуры также содержат солнцезащитные вещества, которые могут защитить вашу кожу от вредных лучей UVA и UVB, которые могут иметь большое значение в предотвращении рака кожи. Вот несколько домашних средств, которые помогут избавиться от загара естественным путем.

Как использовать: Сделайте порошок из высушенной на солнце кожуры граната и храните в герметичном контейнере. Смешайте этот порошок с лосьоном или кремом, желательно за 20 минут до выхода из дома.Кроме того, вы также можете смешать порошок с некоторыми эфирными маслами и нанести на лицо, если хотите использовать натуральный солнцезащитный крем.

# 6 Он останавливает выпадение волос и предотвращает появление перхоти.

Гранатовая корка также помогает бороться с выпадением волос и предотвращает угрозу перхоти. Вот семь домашних средств от перхоти.

Как использовать: Смешайте порошок сушеной корки граната с маслом для волос. Затем нанесите его на корни волос и тщательно помассируйте.Вы можете мыть волосы мягким шампунем через два часа после нанесения или оставить его на ночь, если вам будет удобно.

Кожура граната помогает восстановить ваше общее состояние здоровья

Вот как кожура может помочь справиться с различными проблемами со здоровьем и улучшить общее состояние здоровья:

# 7 Это отличное домашнее средство от боли в горле.

Если у вас болит горло или вы страдаете от боли в миндалинах и вам требуется немедленное облегчение, порошок из кожуры граната может помочь вам успокоить больное горло.

Как использовать: Возьмите горсть высушенных на солнце кожуры граната и отварите их в воде. Теперь процедите смесь и дайте ей немного остыть. Затем часто полощите горло этой водой, чтобы избавиться от боли в горле и миндалин.

# 8 Защищает от сердечных заболеваний

Пилинги содержат мощные антиоксиданты, которые помогают бороться с опасными и опасными для жизни сердечными заболеваниями. Он также снижает уровень холестерина, снижает стресс и восстанавливает здоровье сердца.Они уменьшают окислительный стресс и понижают кровяное давление. Вот восемь способов предотвратить закупорку сердца.

Как использовать: Смешайте одну чайную ложку порошка корки граната со стаканом теплой воды и пейте смесь ежедневно, чтобы улучшить здоровье сердца. Однако употребление напитка через день также поможет вам восстановить здоровье сердца, наряду с правильным питанием и регулярными физическими упражнениями.

# 9 Улучшает гигиену полости рта.

Гранатовый пилинг помогает справиться с целым рядом стоматологических проблем, таких как предотвращение неприятного запаха изо рта, гингивита, язв во рту.Вот как плохая гигиена полости рта может привести к раку полости рта.

Как использовать: В стакан воды добавьте одну чайную ложку высушенной на солнце порошка кожуры граната и хорошо перемешайте. Затем полощите горло этой смесью два раза в день, чтобы избавиться от неприятного запаха изо рта. Массаж десен порошком из кожуры граната может предотвратить заболевания десен, успокаивая опухшие, воспаленные и кровоточащие десны. Смешайте щепотку порошка черного перца с порошком граната, нанесите смесь пальцами на зубы и держите некоторое время, чтобы предотвратить кариес.Примерно через 10 минут прополощите рот водой.

# 10 Улучшает здоровье костей

Благодаря своим антибактериальным и противовоспалительным свойствам кожура граната эффективна в снижении потери плотности костей, особенно у женщин в менопаузе. Исследования показывают, что употребление смесей из кожуры граната может помочь улучшить здоровье костей и предотвратить возникновение остеопороза после менопаузы. Вот пять вещей, которые могут помочь улучшить плотность костей.

Как использовать: Добавьте две ложки высушенной на солнце порошка кожуры граната в стакан с теплой водой и хорошо перемешайте.Вы также можете добавить ложку лимонного сока и немного соли, чтобы вкус стал лучше. Пейте эту смесь на ночь, чтобы укрепить кости.

# 11 Помогает улучшить здоровье кишечника

Пилинги содержат дубильные вещества, которые помогают уменьшить воспаление кишечника, отек геморроя, сужают слизистую оболочку кишечника, останавливают кровотечение во время диареи и улучшают пищеварение. Вот девять домашних средств для улучшения пищеварения.

Как использовать: Замочите полстакана высушенной на солнце кожуры граната в воде на 30 минут.Когда он станет мягким, поместите его в блендер, добавьте одну чайную ложку семян тмина, три четверти стакана пахты, немного каменной соли и смешайте все ингредиенты. Пейте эту смесь не менее трех раз в неделю, чтобы избавиться от геморроя, воспаления кишечника или проблем с пищеварением. Если вы страдаете диареей или у вас кровавый стул, вы можете пить его три раза в день, чтобы облегчить симптомы.

Как приготовить гранатовый порошок

Следуйте инструкциям, чтобы правильно приготовить гранатовый порошок и использовать его по мере необходимости:

  1. Возьмите четыре-пять плодов граната и разрежьте каждый плод на четыре пополам в продольном направлении.
  2. Затем удалите все семена и отделите кожуру.
  3. Далее каждую кожуру разрежьте на две половинки.
  4. Очистите ножом желтую часть под красной кожей на случай, если вы хотите использовать пилинг в терапевтических целях. Поскольку желтая часть при сушке и измельчении может придать вашим смесям горький привкус. Однако при использовании для внешнего применения желтую часть можно оставить нетронутой.
  5. Положите кожуру на тарелку или высушенную ткань и следите за тем, чтобы они не перекрывали друг друга.Поместите их под прямые солнечные лучи и дайте им высохнуть.
  6. Держите пилинги на солнце каждый день, пока они не станут твердыми и не потеряют всю влагу.
  7. Затем в чистую сухую смесь добавить все высушенные на солнце корки и измельчить в течение двух минут.
  8. Храните порошок в чистой стеклянной герметичной банке. Удалите необходимое количество по мере необходимости.

Источник изображения: Getty Images


Total Wellness теперь на расстоянии одного клика.

Следуйте за нами на

18 Основные преимущества кожуры граната для здоровья | HB раз

Гранат — ярко-красный цвет, вместе с рубиновым драгоценным камнем, встроенными в него, почитается как божественный плод. Мысль о гранатовой кожуре процветала в Эдемском саду, гранат стал частью древней символики, ритуалов, верований, а также народных обычаев.

Веды — самые исторические тексты индуистской философии, в которых гранат считается символом плодородия и процветания. В китайском символизме гранат с его ярко-красной кожицей и вкусными семенами на самом деле является показателем изобилия, страсти, счастья, а также плодородия. Его красота и омолаживающий вкус также обладают невероятными преимуществами для здоровья. Цветы, листья, кора, кожура, а также, конечно, семена или семена граната съедобны, а также обладают мощными лечебными свойствами.

Гранатовые кожуры, оставленные сушиться на старой латунной тарелке, рядом с тлеющей «чулхой» (печь для приготовления пищи, которая использует дрова в качестве топлива) или, возможно, на солнце, было обычным явлением в моем доме для матери в Гоа. Кожура граната была, вероятно, самым ценным компонентом аптечки моей бабушки. Выбрасывать кожуру граната по ее мнению было преступлением! Из-за множества полезных для здоровья свойств, находящихся под его «кожурой», тратить кожуру фруктов так же, как гранат, на самом деле является преступлением.

Аюрведа высоко ценит плод граната из-за его способности усмирять все три доши.Он считается полезным и полезным при многих заболеваниях, включая анемию, дизентерию, диарею, сердечные заболевания, кишечные глисты и многое другое. Кожура или даже кожура граната, обладающая как вяжущим, так и горьким вкусом, может использоваться для лечения множества проблем. Благодаря кашаятикте, то есть горьковато-терпкому вкусу кожуры, он помогает уменьшить отеки, воспаления, диарею, дизентерию, кровотечение и т. Д. Он способствует заживлению, улучшает пищеварение, а также является тонизирующим средством для печени.Он поставляется вместе с антиоксидантами и может использоваться как мощный консервант в пищевых продуктах, а также в фармацевтике. На самом деле в кожуре граната больше антиоксидантов, чем в кожуре граната. Кожура граната также обладает антибактериальной активностью.

Польза кожуры граната для здоровья

Гранаты известны своим вкусом, а также невероятной пользой для здоровья. В то время как многие из нас жуют красные острые крошечные семена или даже фрукты, чтобы насладиться их преимуществами, жесткую красную кожицу обычно выбрасывают.Впрочем, как и фрукт. кожура тоже наполнена множеством вещей, которые можно предложить. Вот несколько преимуществ кожуры граната, о которых вы, скорее всего, не знали. Вот как фруктовая кожура помогает вывести вашу красоту и уход за волосами на новый уровень:

1. Борется с прыщами, прыщами и высыпаниями

Благодаря своим целебным свойствам кожура граната может эффективно бороться с угрями, прыщами и сыпью. Пилинги богаты антиоксидантами, которые помогают уберечь от бактерий и других инфекций.Вот несколько лечебных трав для устранения прыщей.

2. Помогает в детоксикации организма

В нашем теле может быть много токсичных веществ. Чтобы бороться со всеми этими токсичными веществами, вам понадобится помощь антиоксидантов. Антиоксиданты невероятно эффективны в детоксикации организма. В кожуре граната больше антиоксидантов. Таким образом, они очень полезны для защиты всего организма от токсинов.

3. Борется с морщинами и старением

Гранатовая кожура действительно помогает сохранить молодость кожи.Вы можете использовать экстракты граната вместе с маслом семян. Это может привести к синтезу проколлагена. Кроме того, он помогает предотвратить расщепление коллагена ферментами. В значительной степени ускоряется рост клеток. В конечном итоге это может естественным образом замедлить старение. Также можно избежать морщин, и ваша кожа будет выглядеть моложе и свежее.

4. Лечит боль в горле и кашель

Кожура граната действительно эффективна при лечении тех, кто борется с кашлем или, возможно, с болью в горле.Он издавна использовался в традиционной медицине как действительно хорошее и естественное средство от этих проблем. Все, что вам нужно сделать, это припудрить его и смешать с небольшим количеством воды. Не забывайте часто полоскать горло этой водой, чтобы получить мгновенное облегчение и, наконец, вылечить ваши проблемы. Тебе действительно хорошо.

5. Действует как естественный увлажнитель

Гранатовые пилинги идеально подходят для кожи. Он увлажняет, а также защищает кожу от загрязняющих веществ и других токсинов из окружающей среды.Восстанавливает pH-баланс кожи. Эллаговая кислота, содержащаяся в пилингах, удерживает влагу в коже. сохраняя его эластичным и мягким.

6. Эффективное солнцезащитное средство

Гранатовый пилинг — эффективное солнцезащитное средство, помогающее предотвращать и восстанавливать повреждения кожи, вызванные солнечными лучами UVA и UVB.

7. Борьба с раком

Было обнаружено, что кожура граната успешно борется с раком. В рамках этой темы было проведено исследование, результаты которого были опубликованы на конференции Американской ассоциации исследований рака.Они сказали, что в экстрактах граната было обнаружено профилактическое средство. Было обнаружено, что именно этот агент предотвращает рак кожи.

8. Борьба со старением и морщинами

Исследования также показывают, что экстракты кожуры граната в сочетании с маслом семян позволяют синтез проколлагена, помогают предотвратить ферменты, расщепляющие коллаген, а также успешно стимулируют рост клеток кожи, тем самым естественным образом и эффективно замедляя старение кожи и появление морщин.

9. Действует как эффективный скраб для лица

Гранатовый пилинг может помочь в удалении омертвевшей кожи, черных и белых пятен с лица при использовании в виде скраба для лица.

10. Действует как естественный солнцезащитный крем

Гранатовая кожура также содержит солнцезащитные агенты, которые могут спасти вашу кожу от вредных лучей UVA и UVB, которые могут иметь большое значение в предотвращении рака кожи.

11. Блокирует выпадение волос и предотвращает появление перхоти

Гранатовая кожура также помогает бороться с выпадением волос, предотвращая появление перхоти.

12. Фантастическое домашнее лекарство от боли в горле

Если у вас болит горло или вы склонны к боли в миндалинах и вам требуется мгновенное облегчение, порошок из кожуры граната поможет вам успокоить больное горло.

13. Содержит большое количество витамина C

Витамин С необходим для хорошего здоровья. Многие люди используют витаминные добавки, чтобы предотвратить их дефицит. Дефицит витамина С может вызвать множество серьезных проблем.Вместо того, чтобы тратить деньги на синтетические добавки, гораздо лучше использовать кожуру граната. Они богаты витамином С и защищают организм от дефицита. Витамин С способствует правильному росту, ускоряет процесс заживления ран, а также формирует рубцовую ткань. Это поможет нарастить массу тела за счет образования необходимых белков. Кроме того, витамин С очень помогает в восстановлении костей, зубов, а также хрящей и, кроме того, сохраняет их крепкими и здоровыми.

14.Борется с пороками сердца

Кожура граната содержит множество антиоксидантов, которые защищают холестерин ЛПНП. Антиоксиданты предотвращают их окисление. Окисление холестерина ЛПНП приводит к окислительному стрессу. Этот конкретный стресс приводит к заболеваниям сердца наряду с другими подобными проблемами. Чтобы уберечь вас от этой проблемы, необходимы антиоксиданты. Итак, чем больше вы получите антиоксидантов, тем лучше для сердца. Кожура граната — лучший источник получения как можно большего количества антиоксидантов.

15. Улучшает гигиену полости рта

Гранатовая кожура может помочь справиться с рядом стоматологических проблем, таких как предотвращение неприятного запаха изо рта, гингивита, язв во рту.

16. Полезно для зубов

Во многих зубных порошках и пастах гранатовая кожура используется как один из важнейших компонентов. Это связано со свойствами пилинга, которые помогают поддерживать правильную гигиену полости рта и зубов. Вы также можете припудрить кожуру граната и смешать ее с водой, чтобы избежать неприятного запаха изо рта и неприятного запаха.Он сохраняет зубы и десны здоровыми и чистыми.

17. Повышает здоровье костей

Благодаря своим антибактериальным, а также противовоспалительным свойствам кожура граната впечатляет снижением прочности костей и потерей плотности, особенно у женщин в период менопаузы. Исследования показывают, что употребление смесей из кожуры граната может помочь улучшить здоровье костей и избежать начала остеопороза сразу после менопаузы.

18. Помогает улучшить здоровье кишечника

Пилинги содержат дубильные вещества, которые помогают уменьшить воспаление кишечника, отек геморроя, уплотнить слизистую оболочку кишечника, предотвратить кровотечение во время диареи и улучшить пищеварение.

Лечебная польза от кожуры граната для здоровья

  • Возьмите горсть высушенных на солнце кожуры граната и обжарьте их над горячей тавой или, возможно, на сковороде с глубоким дном. Дайте им остыть и измельчите их в мясорубке или миксере. Сделайте пасту из порошка вместе с лимонным соком или даже розовой водой и используйте ее на лице, особенно при прыщах или прыщах. Дайте ему высохнуть в течение некоторого времени, затем полностью смойте теплой водой.
  • Возьмите две ложки сушеной на солнце и порошковой цедры и добавьте в нее немного молока. Если у вас жирная кожа, добавьте в порошок розовую воду, а не молоко, чтобы сделать из него пасту. Нанесите эту пасту на лицо, пока она не высохнет. Вымойте лицо теплой водой и попробуйте использовать пудру не реже двух раз в неделю для достижения лучших результатов.
  • Вяленую на солнце кожуру граната измельчить в миксере и высыпать порошок в чистую миску. Приготовьте порошок, которого хватит на неделю, и храните его в герметичном контейнере.Возьмите две ложки порошка и хорошо смешайте с небольшим количеством йогурта, чтобы получилась паста. Нанесите эту пасту на лицо и шею и оставьте на 10 минут. Далее хорошо промойте его холодной водой.
  • Возьмите две ложки сушеного на солнце порошка граната и добавьте к нему одну ложку коричневого сахара. Чтобы приготовить пасту, добавьте одну ложку меда, одну ложку масла авокадо или любое эфирное масло по своему вкусу и хорошо перемешайте. Затем протрите лицо домашним скрабом и тщательно помассируйте.Смойте водой, чтобы кожа стала гладкой и эластичной. Однако не забывайте использовать тоник вместе с увлажняющим кремом сразу после чистки.
  • Сделайте порошок вместе с высушенной на солнце кожурой граната и храните в герметичном контейнере. Смешайте этот порошок с лосьоном, если возможно, за 20 минут до выхода из дома. Кроме того, вы также можете смешать порошок с несколькими эфирными маслами и нанести на лицо, если хотите использовать естественный солнцезащитный крем.
  • Смешайте порошок цедры граната с маслом для волос. Затем нанесите на корни волос и тщательно помассируйте. Вы можете вымыть волосы мягким шампунем через два часа после нанесения или оставить его на ночь по вашему усмотрению.
  • Возьмите несколько сушеных на солнце кожуры граната и также отварите их в воде. Теперь процедите смесь и дайте ей немного остыть. Затем часто полощите горло этой водой, чтобы избавиться от боли в горле и миндалин.
  • Смешайте одну чайную ложку порошка корки граната со стаканом теплой воды, а также употребляйте смесь ежедневно, чтобы укрепить здоровье сердца. Однако употребление напитка через день может помочь вам восстановить здоровье сердца наряду с правильным питанием и физическими упражнениями.
  • В стакан воды положите одну чайную ложку высушенной на солнце порошка кожуры граната и хорошо перемешайте. Затем полощите горло этой смесью два раза в день, чтобы устранить неприятный запах изо рта. Помассируйте десны вместе с порошком из кожуры граната, чтобы избежать заболеваний десен, просто успокаивая опухшие, воспаленные и кровоточащие десны.Смешайте щепотку порошка черного перца с порошком граната и нанесите смесь пальцами на зубы и держите ее в течение короткого времени, чтобы избежать кариеса. Примерно через 10 минут промойте область рта водой.
  • Добавьте две ложки высушенной на солнце порошка цедры граната в стакан с теплой водой и хорошо перемешайте. Вы также можете добавить ложку лимонного сока и немного соли, чтобы вкус действительно стал лучше. Принимайте эту смесь на ночь, чтобы укрепить кости.
  • Замочите полстакана высушенной на солнце цедры граната в воде на 30 минут. Когда он станет мягким, поместите его в блендер, добавьте одну чайную ложку семян тмина, три четверти стакана пахты, немного каменной соли и смешайте все ингредиенты. Пейте эту комбинацию минимум 3 раза в неделю, чтобы бороться с геморрой, воспалением кишечника или проблемами пищеварения. Если вы страдаете диареей и у вас кровавый стул, вы можете пить его 3 раза в день, чтобы облегчить симптомы.
  • 1 столовую ложку порошка кожуры граната необходимо принимать два раза в день, запивая водой, чтобы предотвратить неприятный запах изо рта.Полоскание горла вместе с отваром из кожуры граната также может помочь в решении этой проблемы. Массаж десен вместе с порошком корки граната помогает успокоить опухшие, воспаленные, а также кровоточащие десны. Гранатовый порошок в сочетании с небольшим количеством свежемолотого черного перца можно использовать в качестве зубного порошка для предотвращения кариеса.
  • Жареную и измельченную кожуру граната можно смешать с розовой водой или даже соком лайма и использовать как маску для лица для успокоения прыщей, фурункулов, прыщей, а также для удаления белых и черных точек.
  • Сухие корки граната используются вместе с имбирем и листьями туласи для приготовления домашнего лекарства от кашля
  • От неприятного запаха изо рта — принимать 4 грамма пилингового порошка, запивая водой, два раза в день
  • При сильном мочеиспускании — 5 граммов порошка для очищения кожи вместе с водой два раза в день
  • При чрезмерном менструальном кровотечении — 1 чайная ложка порошка сухой корки вместе с водой комнатной температуры два раза в день
  • Чтобы остановить кровотечение практически в любых частях тела — 1 чайная ложка порошка сушеной корки вместе с водой два раза в день
  • От кровоточащих геморроя — 8 г пилингового порошка вместе с водой один раз утром и вечером для облегчения состояния

Как приготовить гранатовый порошок

Следуйте инструкциям, чтобы правильно приготовить гранатовый порошок, а затем используйте его по мере необходимости:

  1. Возьмите четыре или пять плодов граната и разрежьте каждый плод на четыре пополам в продольном направлении.
  2. Затем удалите все семена и отделите кожуру.
  3. Далее разрежьте каждую кожуру на две половинки.
  4. Очистите ножом желтую часть под красной кожей на случай, если вам потребуется использовать пилинг в терапевтических целях. Поскольку желтая часть, когда она сушится и измельчается, может придать вашим смесям горький привкус. Однако, если использовать для внешнего применения, вы можете сохранить желтую часть нетронутой.
  5. Положите кожуру на тарелку или высушенную ткань и следите за тем, чтобы они не перекрывали друг друга.Поместите их под прямые солнечные лучи и дайте им высохнуть.
  6. Держите пилинги на солнце каждый день, пока они не станут твердыми и не потеряют всю влагу.
  7. Затем в чистую сухую смесь добавьте все высушенные на солнце корки и измельчите в течение двух минут.
  8. Храните порошок в прозрачной стеклянной герметичной банке. Удалите необходимое количество по мере необходимости.

Рецепт кожуры граната

1. Травяной чай с гранатом

  • 1 чайная ложка моей травяной смеси или
  • гранатовый порошок
  • мята
  • имбирь
  • тмин
  • органические листья зеленого чая
  • 1 чайная ложка меда

Направление:

  1. Положите все травы в кофемолку и измельчите в мелкий порошок.Добавьте 1 чайную ложку смеси в 1 и 1/4 стакана воды и доведите до кипения в течение 1 минуты. Снимите с огня и дайте настояться 5 минут. Процедите чай и добавьте мед.
  2. Вы можете использовать гранатовый порошок практически в любых травяных смесях, которые у вас есть. Порошок граната используется в моей смеси из 10 трав. Вы можете принимать только капсулы при паразитах.

2. Цедра граната Тамбли

Состав

  • Цедра граната — кусок 3 дюйма
  • Семена тмина — 1/2 чайной ложки
  • Перец — 1/2 чайной ложки
  • Разбавленный йогурт — 1/2 стакана
  • Свежий тертый кокос — 1/2 стакана
  • Соль-3/4 ч. Л.
  • кампанияИконные купоны

Приправы

Проезд

  1. В сковороду добавить немного масла, гранатовые цедры, перец, а также семена тмина.Жарьте их до тех пор, пока кожура граната не станет слегка хрустящей или изменит цвет.
  2. В миксере-мясорубке добавьте тертый кокос и обжаренные ингредиенты из шага 1. Добавьте соль и измельчите их вместе до мелкой пасты. Смешайте с разжиженным йогуртом. Цедра граната тамбли готова.
  3. Нагрейте форму для приправ, добавив немного масла, семян горчицы и листьев карри. Когда семена горчицы появятся, перенесите их в тамбли.
  4. Воспользуйтесь преимуществами тамбли из кожуры граната при лечении диареи в домашних условиях.

Комментарии

комментария

Преимущества гранатовой кожуры

Гранаты известны своим вкусом и удивительной пользой для здоровья.

Однако очень немногие знают о преимуществах его кожи, которую мы выбрасываем.

Кожура, как и фрукт, имеет много преимуществ.

Благодаря своим целебным свойствам кожура граната может эффективно бороться с прыщами, прыщами и сыпью.

Кожура богата антиоксидантами и помогает избавиться от бактерий и других инфекций.

Можно взять две ложки сушеной на солнце и порошковой цедры и добавить к ней немного молока.

Если у кого-то жирная кожа, можно вместо молока добавить в порошок розовую воду и сделать из него пасту.

Нанесите эту пасту на лицо и держите, пока она не высохнет.

Вымойте лицо теплой водой и попробуйте использовать порошок не реже двух раз в неделю для достижения лучших результатов.

Гранатовый пилинг также увлажняет и защищает кожу от загрязняющих веществ и других токсинов окружающей среды.

Восстанавливает pH-баланс кожи.

Эллаговая кислота, присутствующая в пилингах, удерживает влагу в коже, делая ее мягкой и эластичной.

Вяленую на солнце кожуру граната измельчить в миксере и высыпать порошок в чистую миску.

Приготовьте порошка, которого хватит на неделю, и храните в герметичном контейнере.

Возьмите две ложки порошка и хорошо смешайте с йогуртом, чтобы получилась паста.

Нанесите эту пасту на лицо и шею и оставьте на 10 минут.

Далее смойте холодной водой.

Возьмите две ложки сушеного на солнце порошка граната и добавьте к нему одну ложку коричневого сахара.

Чтобы приготовить пасту, добавьте одну ложку меда, одну ложку масла авокадо или любое эфирное масло по выбору и хорошо перемешайте.

Затем потрите лицо домашним скрабом и тщательно помассируйте.

Смыть водой, чтобы кожа стала гладкой и эластичной.

Однако после очистки важно использовать тоник и увлажняющий крем.

Сделайте порошок из высушенной на солнце кожуры граната и храните в герметичном контейнере.

Смешайте этот порошок с любым лосьоном или кремом, желательно за 20 минут до выхода из дома.

В качестве альтернативы можно также смешать пудру с некоторыми эфирными маслами и нанести на лицо, если вы хотите использовать натуральный солнцезащитный крем.

Положительное влияние экстракта кожуры граната и пробиотиков на преадипоцитную дифференцировку

Front Microbiol.2019; 10: 660.

Валерия Сорренти

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия

Cinzia Lucia Randazzo

2 Dipaziena Di мы Università di Catania, Катания, Италия

Cinzia Caggia

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

Габриэле

, Совет по экономическим исследованиям, Габриэле, ) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Флора Валерия Ромео

3 Совет сельскохозяйственных исследований и экономики (CREA) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Симона Фаброни

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок и цитрусовых and Tree Fruit, Ачиреале, Италия

Николина Тимпанаро

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр олив, цитрусовых и древесных фруктов, Ачиреале, Италия

Марко Рафаэле

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Luca Vanella

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия

85

Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

3 (CREA) Совет по сельскохозяйственным исследованиям и экономическим исследованиям Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Редактор: Розальба Ланчотти, Болонский университет, Италия 90 005

Рецензент: Анна Реале, Институт науки и технологий (ISA), Италия; Коши Филип, Малайский университет, Малайзия

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы микробиологии»

Поступила в редакцию 22 октября 2018 г .; Принята в печать 15 марта 2019 г.

Авторские права © 2019 Сорренти, Рандаццо, Каджия, Баллистрери, Ромео, Фаброни, Тимпанаро, Раффаэле и Ванелла.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Благоприятные эффекты граната обусловлены содержанием эллагитаннинов и антоцианов, которые защищают от множества заболеваний, включая воспалительные. Многие исследователи сообщают, что экстракты отходов граната (кожуры и семян), полученные из отходов промышленной переработки, обладают акцептором свободных радикалов и обладают мощной антиоксидантной способностью. Также сообщалось, что экстракты граната (ПЭ) обладают антибактериальной, противовирусной, гиполипидемической и противовоспалительной биоактивностью благодаря содержанию полифенольных соединений, включая пуникалагины, галловую кислоту и производные эллаговой кислоты.В центре внимания данной рукописи было изучение пребиотического потенциала PE, растворимого в воде и охарактеризованного с помощью HPLC – PDA – ESI / MS n на предмет его фенольного содержания. Более того, поскольку сообщалось, что экстракты граната снижали уровень липидов в крови и что было показано, что ряд пробиотических штаммов влияет на адипогенез в культуре клеток, это исследование также было выполнено для проверки in vitro эффектов PE и пробиотик L.rhamnosus GG ATCC 53103 (LGG) на линии клеток 3T3-L1. PE и пробиотики существенно снижали содержание триглицеридов и увеличение внутриклеточных липидов по сравнению с контрольной группой. Однако комбинированная обработка отработанного бульона (SB), отфильтрованного через PE и LGG, была наиболее эффективной для снижения содержания триглицеридов и накопления внутриклеточных липидов. Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были существенно ниже в клетках 3T3-L1, обработанных PE и SB, отфильтрованных через LGG.Эти результаты свидетельствуют о том, что синергетический эффект пробиотиков и полифенолов, содержащихся в PE, может влиять на адипогенез in vitro и , а также может способствовать разработке новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Ключевые слова: лактобациллы, антимикробная активность, экстракт граната, дифференциация адипоцитов, комбинирование продуктов

Введение

Гранат — плод, положительное влияние которого на здоровье было тщательно изучено.Этот фрукт богат биологически активными соединениями, такими как эллагитаннины и антоцианы, которые защищают от дегенеративных заболеваний. Плод граната из-за его высокой питательной ценности, пользы для здоровья и биоактивных антиоксидантных соединений считается пищевым лекарством. Фактически, гранат широко используется в фитотерапии при нескольких патологиях, включая грипп и инфекции верхних дыхательных путей. Все части плодов граната, то есть кожура и семена, рассматриваемые как отходы, могут быть переработаны для получения продуктов с добавленной стоимостью, имеющих промышленную, медицинскую и косметическую ценность (Dhumal et al., 2014).

Отходы граната образуются на всех этапах жизненного цикла плодов, то есть во время сельскохозяйственного производства, промышленного производства и переработки. Можно использовать побочные продукты граната, поскольку они являются богатым источником биологически активных соединений, таких как флавоноиды, фенольные кислоты и дубильные вещества. Более того, многие исследователи описали, что экстракты граната, полученные из побочных продуктов перерабатывающих заводов, обладают эффективным улавливанием свободных радикалов и антиоксидантной способностью (Lee et al., 2010; Panichayupakaranant et al., 2010; Fischer et al., 2011).

Кроме того, экстракты граната действуют как естественные ингибиторы патогенов, бактерий и грибов (Al-Zoreky, 2009; Tehranifar et al., 2011; Romeo et al., 2015).

Эллагитаннины граната гидролизуются микробиотой кишечника до более мелких фенольных соединений, таких как эллаговая кислота. Затем эллаговая кислота всасывается в кровоток, в то время как эллагитанины не всасываются и метаболизируются в уролитины.

Сообщалось, что побочные продукты граната и пуникалагины в значительной степени способны подавлять рост патогенных бактерий Escherichia coli , Pseudomonas aeruginosa , Clostridia и Staphylococcus aureus (Reddy et al., 2007; Bialonska et al., 2009) и для увеличения роста полезных бактерий, включая Bifidobacterium spp. и Lactobacillus spp. (Reddy et al., 2007; Bialonska et al., 2010).

Экстракты граната также снижают уровень липидов в крови и обладают значительной противоопухолевой, противовирусной и противовоспалительной активностью (Li et al., 2006; Hossin, 2009; Lin et al., 2013; Bassiri- Джахроми, 2018).

Эти потенциальные полезные эффекты приписываются полифенольным соединениям, которые содержатся в экстрактах граната, включая пуникалагины, галловую кислоту и производные эллаговой кислоты (Vanella et al., 2013а, б, в; Romeo et al., 2015).

Поскольку ожирение является одной из основных проблем общественного здравоохранения, необходимы новые превентивные стратегии (Smith and Smith, 2016).

Адипоциты играют важную роль в начале или развитии метаболических осложнений, связанных с ожирением, таких как метаболический синдром и диабетические осложнения (Kim and Plutzky, 2016).

Интерес исследователей к выявлению натуральных продуктов, полученных из диетических растений, обладающих активностью против ожирения, возрос.Сообщалось, что ксантиген и фукоксантин, природные соединения масла косточек граната, значительно подавляли дифференцировку адипоцитов и накопление липидов (Lai et al., 2012).

Настоящая рукопись посвящена прежде всего изучению антиоксидантной и антимикробной активности, а также пребиотического потенциала ПЭ, богатого фенольными соединениями. Более того, обогащенный стандартизованный полиэтилен, содержащий высокий процент природных антиоксидантов граната, был химически охарактеризован с помощью ВЭЖХ – PDA – ESI / MSn.Во-вторых, поскольку гранатовый сок (Les et al., 2018) и различные типы экстрактов граната (PE), включая экстракт, полученный из цельного фрукта (Li et al., 2015), и экстракт, полученный из кожуры граната (Neyrinck et al., 2013), и было показано, что ряд пробиотических штаммов (Moon et al., 2012; Park et al., 2014) влияют на адипогенез, это исследование было проведено для проверки in vitro эффектов PE, пробиотика L rhamnosus GG ATCC 53103 (LGG), предварительно инкубированные с PE, отдельно или в комбинации, при дифференцировке клеток 3T3-L1.

Материалы и методы

Химические вещества

Порошкообразный экстракт граната (Dermogranate ® ), использованный в этом исследовании, был предоставлен Medinutrex (Катания, Италия). Вкратце, экстракт готовили из сушеных и измельченных плодов граната, смешанных с водно-спиртовыми растворами (пищевой), а затем фильтровали. Фильтрат концентрировали и затем сушили распылением для получения стандартизованного экстракта. Экстракт Dermogranate ® имел следующий химический состав: общие полифенолы (16%), пуникалагины (8%), эллаговая кислота и производные (8%).

Реагент Фолина – Чокальтеу (FCR), карбонат натрия (Na 2 CO 3 ), галловая кислота, пуникалин (смесь аномеров), пуникалагин и эллаговая кислота были приобретены у Sigma-Aldrich (Милан, Италия). Гранатин Б был приобретен у LGC Standards (Лондон, Великобритания). Для хроматографии использовали растворители чистоты для ВЭЖХ – МС (Merck KgaA, Дармштадт, Германия), а все остальные реагенты были аналитической чистоты.

Определение общего содержания полифенолов

Анализ Folin – Ciocalteu (Singleton et al., 1999) был использован для определения общего содержания полифенолов с небольшими изменениями. 0,1 мг / мл экстракта растворяли в дистиллированной воде. Затем к 500 мкл образца добавляли 5 мл 10% FCR и 4,5 мл раствора Na 2 CO 3 (7,5% мас. / Об.). Конечный раствор перемешивали в течение 2 часов в темноте, а затем измеряли Abs при λ = 765 нм. Анализы проводили в трех экземплярах, и общую концентрацию полифенолов выражали в граммах эквивалентов галловой кислоты (GAE) / 100 г экстракта.

HPLC – PDA – ESI / MS

n Анализ фенольных соединений

Разделение и количественное определение фенольных соединений выполняли, как описано ранее (Romeo et al., 2015). Для идентификации фенольных соединений времена удерживания (RT), спектры и данные МС в режиме отрицательного ESI сравнивали с данными аутентичных стандартов. Количественное определение каждого фенольного соединения проводили с использованием соответствующего стандарта в качестве внешнего стандарта. Количественное определение галловой кислоты проводили при 280 нм.Пуникалины, гранатин В, пуникалагины и эллаговая кислота определялись количественно при 378 нм; та же длина волны использовалась для количественного определения производных эллаговой кислоты с использованием эллаговой кислоты в качестве стандарта сравнения. Анализы проводили в трех экземплярах, и результаты выражали в г соединения / 100 г экстракта.

Тушение DPPH

Способность улавливать свободные радикалы различных концентраций экстракта PE (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) измеряли по 2, Безрадикальный метод 2-дифенил-1-пикрилгидразилгидрата (DPPH), как сообщалось ранее (Salerno et al., 2012). Результаты выражены в процентах от степени ингибирования ± SD .

Влияние поглотителя на супероксид-анион

Способность экстракт ПЭ различных концентраций улавливать супероксид-анион (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) определялась как сообщалось ранее (Салерно и др., 2012). Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Мышиные преадипоциты 3T3-L1 Жизнеспособность клеток

Мышиные преадипоциты 3T3-L1 были приобретены в Американской коллекции типовых культур (Роквилл, Мэриленд, США).Клетки высевали в концентрации 2 × 10 5 клеток на лунку 96-луночного микропланшета и культивировали при 37 ° C в инкубаторе с 5% CO 2 в течение 48 часов в отсутствие и в присутствии различных концентраций ЧП сообщалось выше. Жизнеспособность клеток измеряли с помощью анализа МТТ, как сообщалось ранее (Di Giacomo et al., 2015). МТТ, желтый тетразол, в живых клетках восстанавливается до пурпурного формазана. Результаты выражены в процентах формазана, продуцированного в обработанных мышиных преадипоцитах 3T3-L1, по сравнению с необработанными клетками.

Микробиология

Культивирование бактерий

Использовали коммерческие штаммы патогенов E. coli ATCC 25922, S. aureus ATCC 29213, Listeria innocua ATCC 33090 и Salmonella enterica ATCC 14028. Штамм E. coli выращивали в бульоне Лурия-Бертани (LB) при 37 ° C в течение ночи; S. aureus , S. enterica и L. innocua обычно выращивали в течение ночи в триптон-соевом бульоне (TSB) при 37 и 30 ° C соответственно.Все материалы и приложения предоставлены Oxoid (Милан, Италия).

Коммерческие пробиотические штаммы LGG, Bifidobacterium animalis BB12, B. longum BB536 и дикий штамм Lactobacillus paracasei N 24, выделенные из кротонского сыра пекорино, культивировали в бульоне Демана – Рогоза – Шарпа (MRS). при 37 ° C в течение ночи.

Ночные бактериальные культуры инкубировали при 37 ° C в течение 24 часов в анаэробных условиях, пока они не достигли плотности клеток приблизительно 1.0 × 10 9 КОЕ / мл.

Определение скорости роста

На основании результатов, полученных по активности PE в качестве акцептора свободных радикалов, и экспериментов по жизнеспособности преадипоцитов мышей 3T3-L1, для обработки штаммов пробиотиков или патогенов, как описано ниже, использовали различные концентрации.

Антимикробная активность PE оценивалась в отношении коммерческих штаммов патогенов, упомянутых выше. Ночные культуры патогенов совместно культивировали при 37 ° C в течение 24 ч с PE в различных концентрациях (1.7–0,34–0,17 мг / мл), а антимикробную активность оценивали подсчетом живых бактерий на чашках и выражали в КОЕ / мл.

Влияние PE на рост пробиотических штаммов, упомянутых выше, оценивали при совместном культивировании пробиотических штаммов с плотностью клеток приблизительно 1,0 × 10 9 КОЕ / мл с PE в различных концентрациях (0,085–0,042– 0,028 мг / мл). Влияние экстракта на рост пробиотических штаммов оценивали после инкубации при 37 ° C в течение 24 часов в анаэробных условиях путем посева на чашки живых бактерий и выражали в КОЕ / мл.

Все эксперименты проводились в двух экземплярах, а результаты выражались в виде средних значений и стандартного отклонения. Основываясь на предварительных результатах, для последующих анализов была выбрана LGG.

Свежие бульонные культуры центрифугировали при 5000 об / мин в течение 10 минут при 4 ° C, супернатант декантировали для сбора отработанного бульона (SB), который фильтровали (FSB) с использованием фильтра 0,22 мкм и затем использовали для дальнейшего использования. анализы.

Бактериальный осадок ресуспендировали в 1 мл PBS и пять раз обрабатывали ультразвуком с амплитудой 44% в течение 2 мин с 6 мин отдыха.Затем обработанный ультразвуком центрифугировали при 1100 × g в течение 15 мин при 4 ° C. Супернатант собирали, фильтровали через фильтр 0,22 мкм и меченный экстракт бактериальных клеток (CE). CE использовался для дальнейшего анализа.

Культура клеток и дифференцировка клеток адипоцитов

Преадипоциты мышей 3T3-L1 ресуспендировали в среде Игла, модифицированной по Дульбекко (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS, Invitrogen, Карлсбад, Калифорния, США) и 1% антибиотика. / антимикотический раствор (Invitrogen, Карлсбад, Калифорния, США) и высевали в колбу размером 75 см 2 при плотности от 1 до 2 × 10 4 клеток.Дифференцировку клеток адипоцитов получали, как сообщалось ранее (Waldman et al., 2016).

Дифференцирующиеся преадипоциты 3T3-L1 обрабатывали в течение 7 дней PE (0,028 мг / мл), LGG CE (25 мкг / мл) и SB, профильтрованным через LGG (10 мкг / мл) из ночной бактериальной культуры, инкубированной с или без ПЭ (0,028 мг / мл).

Количественное определение содержания липидов

Для количественной оценки накопления липидов проводили масляное красное окрашивание, как сообщалось ранее (Barbagallo et al., 2017). Образование липидных капель измеряли с помощью инвертированного многоканального светодиодного флуоресцентного микроскопа (Evos, Life Technologies, Гранд-Айленд, Нью-Йорк, США).

Экстракция РНК и qRT-PCR

Экспрессии адипонектина, PPAR-γ, SREBP, FAS, IL-6 и IL-10 оценивали с помощью ПЦР в реальном времени. РНК экстрагировали и количественно оценивали, как сообщалось ранее (Raffaele et al., 2018). Использовали соответствующие последовательности праймеров (). Относительный уровень экспрессии мРНК измеряли по значению порогового цикла (Ct) каждого продукта ПЦР и нормализовали с таковым для GAPDH с использованием сравнительного метода 2 -ΔΔCt .

Таблица 1

ПЦР-праймеров, использованных в этом исследовании.

Gene Прямой праймер Обратный праймер
Адипонектин GAAGCCGCTTATGTGTATCGC GAATGGGTACATTGGGAACAGT
IL-6 TTCCTCTCTGCAAGAGACTTCC AGGAGAGCATTGGAAATTGGGG
FAS GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
GAPDH AGCTTCGGCACATATTTCATCTG CGTTCACTCCCATGACAAACA
IL-10 GCTGGACAACATACTGCTAACC ATTTCCGATAAGGCTTGGCAA
SREBP-1 GATGTGCGAACTGGACACAG CATAGGGGGCGTCAAACAG
PPAR-γ TCGCTGATGCACTGCCTATG ACCTGATGGCATTGTGAGACAT

Статистический анализ

Статистический анализ множественных сравнений был выполнен e Метод Фишера. P — значения ниже 0,05 были приняты как значимые. Данные были проанализированы с использованием либо однофакторного дисперсионного анализа (ANOVA) для нескольких групп, либо непарного t -теста для двух групп, и результаты представлены в виде среднего значения ± стандартное отклонение.

Результаты

HPLC – PDA – ESI / MS

n Анализ PE

Фенольный профиль PE () включал определение 1 гидроксибензойной кислоты и 19 эллагитаннинов. Основные пики соответствовали пуникалину (пик 4), гранатину B (пик 6), пуникалагину A и B (пики 10 и 14) и эллаговой кислоте (пик 19) ().Выявлено также присутствие галловой кислоты (пик 1) и производных эллаговой кислоты (пики 2, 3, 5, 7–9, 11–13, 15–18, 20). Как показано на хроматограмме, эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожуры), поскольку они составляют более 99% от общего содержания фенольных соединений граната. Пуникалагины, основные эллагитаннины побочных продуктов граната, составляют 47,6% от общего содержания фенольных соединений в ПЭ (). Производные эллаговой кислоты, эллаговая кислота и другие второстепенные фенольные соединения (пуникалин, гранатин B и галловая кислота) составили 38.4, 10,2 и 3,8% от общего содержания фенолов в ПЭ соответственно ().

ВЭЖХ-хроматограмма фенольных соединений ПЭ, обнаруженных при 378 нм. Об идентификации пиков см.

Таблица 2

Список пиков и количественное определение фенольных соединений в ПЭ.

907 0,07 907 907 907 0,07 907 907 909 ± 0,04 98 6 7

9 9,5

9 905 909 0,09 909 909 7 7 8 7

9

7

9 35,498 Ead d

9099 7.82

907 907 907 9024 9099 907 907 907 907 907 907 907 907
Номер пика a RT (мин) λ ​​(нм) [M – H] ( м / z ) MS n ( м / z ) Фенольные соединения г / 100 г b
1 3.9 269,310 169 125 Кислота галловая 0,07 ± 0,02
2 4,1 255,364 301 3 7,0 255,363 301 Ead d 0,41 ± 0,04
4 7,3 263,364
5 8,4 264,366 301 Ead d 0,19 ± 0,09
Гранатин B 0,28 ± 0,03
7 10,4 259,361 301 Ead d 0,02 ± 0,01 257,360 301 Ead d 0,05 ± 0,01
9 ​​ 13,5 256,362 0,07 0,07 909 0,07 EAD
10 14,0 258,378 1083 781/601 Пуникалагин А 3,05 ± 0,05
11 15,1 0.13 ± 0,09
12 15,9 257,361 301 Ead d 0,95 ± 0,03
13 9
13 4 Ead d 2,69 ± 0,11
14 17,7 257,378 1083 781/601 Пуникалагин 18 98 7 ± 0,21 257,362 301 Ead d 0,12 ± 0,01
16 25,2 256,363 0,163 0,12 9 0,07 909 0,07 909 0,07
17 29,3 254,361 301 Ead d 0,17 ± 0,01
18 32,2 99 9028 0.08 ± 0,03
19 33,6 256,367 301 229/185 Эллаговая кислота 1,68 ± 0,01
20
20 0,08 ± 0,02
Всего полифенолов c 16,48 ± 2,49
Производные эллаговой кислоты 6,31
Эллаговая кислота 0,62
Итого 16.43

Масс-спектрометрические свойства 20 идентифицированных фенольных соединений (пики 1–20) показаны на рис. Как сообщалось ранее (Romeo et al., 2015), наблюдались две изомерные формы (A и B) пуникалагинов (пики 10 и 14), а также было подчеркнуто присутствие гранатина B (пик 6). Кроме того, эти соединения также были охарактеризованы прямым анализом отрицательных ионов вливания ESI / MS n стандартных соединений.Пик 4 был идентифицирован как пуникалин ( m / z 781), тогда как пики 2, 3, 5, 7–9, 11–13, 15–18 и 20 были идентифицированы как производные эллаговой кислоты в соответствии с их УФ – видимой областью и массой. характеристики (λ max около 370 нм и фрагмент MS 1 на m / z 301, соответствующий эллаговой кислоте).

Активность PE по улавливанию свободных радикалов

Антиоксидантная активность PE проверялась по их способности восстанавливать стабильный радикал DPPH.

В частности, процент ингибирования DPPH достигал 75% при концентрациях ниже 0.21 мг / мл (76,78, 79 и 80% соответственно при концентрации ПЭ 0,17-0,11-0,085 и 0,028 мг / мл). При концентрациях выше 0,21 мг / мл процент ингибирования DPPH был ниже ().

Активность ПЭ по улавливанию радикалов DPPH в различных концентрациях. Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Экстракт граната ингибировал образование супероксид-аниона дозозависимым образом (). Как правило, в этом тесте PE оказался более эффективным, чем в предыдущем.Это может быть связано с меньшим размером супероксид-аниона по сравнению с радикалом DPPH.

Таблица 3

Активность по улавливанию супероксидных ионов при различных концентрациях ПЭ.

78 ± 2
концентрации PE % ингибирования концентрации PE % ингибирования
PE (3,4 мг / мл) 65 ± 2 PE (0,21 мг / мл)
PE (1,7 мг / мл) 73 ± 3 PE (0.17 мг / мл) 80 ± 1
PE (0,85 мг / мл) 75 ± 1 PE (0,11 мг / мл) 85 ± 3
PE (0,56 мг / мл ) 70 ± 2 PE (0,085 мг / мл 88 ± 4
PE (0,42 мг / мл) 68 ± 1 PE (0,028 мг / мл) 95 ± 1
PE (0,34 мг / мл) 75 ± 4

Влияние PE на жизнеспособность клеток 3T3-L1

3- (4,5-диметилтиазол ил) -2,5-дифенилтетразолийбромид (МТТ) проводили для оценки жизнеспособности клеток 3T3-L1.Результаты показывают значительное снижение жизнеспособности клеток при высоких концентрациях PE (3,4, 1,7, 0,85, 0,56 и 0,42 мг / мл), тогда как при более низких (0,34, 0,21, 0,17, 0,11 и 0,085 мг / мл) концентрациях наблюдается умеренная ингибирующий эффект и концентрация 0,028 мг / мл не оказали значительного влияния на жизнеспособность клеток преадипоцитов мышей 3T3-L1 ().

Процент выживаемости преадипоцитов мышей 3T3-L1 в присутствии PE в различных концентрациях. Результаты выражены как среднее значение ± стандартное отклонение четырех экспериментов, проведенных в трех повторностях.Значимые по сравнению с необработанными контролями: * p <0,005; ∗∗ p <0,05.

Microbiology

Антимикробная активность PE в отношении штаммов патогенов

Данные анализа совместного культивирования показали, что патогены были по-разному чувствительны к PE. В деталях, как показано в, экстракт в концентрации 1,7 мг / мл показал наивысшую антимикробную активность против всех патогенов со значительным снижением на L. innocua (проксимально 4 log единицы).При концентрации 0,34 мг / мл экстракт был эффективен против E. coli , L. innocua и S. aureus , демонстрируя снижение плотности клеток на 1 и 2 log единицы соответственно. Когда PE тестировали при концентрации 0,17 мг / мл, штаммы S. aureus , S. enterica и L. innocua все еще подавлялись, в то время как рост E. coli не подвергался значительному влиянию.

Противомикробная активность PE различной концентрации в отношении патогенов, обнаруженных на T24 (24 ч инокулята).Плотность клеток выражается как Δlog КОЕ / мл.

Эффект PE на рост пробиотических штаммов

Результаты, показанные в, подчеркнули, что PE, при всех испытанных концентрациях, не обладал какой-либо ингибирующей активностью в отношении роста испытанных пробиотических штаммов. Небольшое увеличение роста наблюдалось для LGG, совместно культивируемых с PE в концентрации 0,028 мг / мл ().

Таблица 4

Количество бактерий, выраженное как log 10 КОЕ / мл в трех повторностях ± стандартное отклонение L. rhamnosus GG ATCC 53103, Bifidobacterium animalis BB12, B.longum BB536 и дикий штамм Lactobacillus paracasei N 24 после инкубации с PE в различных концентрациях.

мл ) b Б.longum 909 мг 9,57 ± 0,12 a
Журнал 10
L. rhamnosus GG Исходный уровень 8,83 ± 0,09 / PE 9,20 ± 0,10 b
PE (0.042 мг / мл) 9,24 ± 0,07 b
PE (0,028 мг / мл) 9,26 ± 0,04 b
Lactobacillus paracasei 23 907 a
N24 PE (0,085 мг / мл) 8,70 ± 0,08 a
PE (0,042 мг / мл) 8,79 ± 0,10 907 907 907 PE (0.028 мг / мл) 8,74 ± 0,09 a
Bifidobacterium animalis Исходный уровень 9,15 ± 0,05 a
BB12 мг / 0,07 мг / 0,07 0,12 a
PE (0,042 мг / мл) 9,44 ± 0,10 b
PE (0,028 мг / мл) 9,55 ± 0,07 907 Исходный уровень 9,77 ± 0,03 a
BB536 PE (0,085 мг / мл) 9,54 ± 0,10 a
PE (0,028 мг / мл) 9,44 ± 0,16 a

Влияние PE на содержание липидов Pomenate

9 фильтрованный SB значительно снизил содержание триглицеридов по сравнению с контрольной группой ().Однако эффект отфильтрованного SB, полученного из клеток, инкубированных с PE (LGG-T1) или без него (LGG-T0), был аналогичным. Одновременная обработка преадипоцитов мышей 3T3-L1 SB, отфильтрованным через PE и LGG, значительно снизила содержание триглицеридов по сравнению с обработкой только SB, отфильтрованного через LGG. Более того, эти данные свидетельствуют о том, что комбинированное лечение PE и LGG-T1 было наиболее эффективным для снижения содержания триглицеридов и накопления внутриклеточных липидов.

(A) Типичное окрашивание O масляным красным О клеток 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE. (B) Содержание липидов определяли количественно с помощью окрашивания Oil Red O (среднее ± SD , * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с LGG T0 + PE).

Обработка преадипоцитов мышей 3T3-L1 клеточным экстрактом LGG (CE), полученным из клеток, инкубированных с PE (CE + PE) или без него (CE), не оказала влияния на накопление внутриклеточных липидов по сравнению с контрольной группой ( Контроль: ABS 490 нм = 0.200 ± 0,07; CE: ABS 490 нм = 0,187 ± 0,09; CE + PE = ABS 490 нм = 0,190 ± 0,05).

Влияние PE на адипогенные маркеры

Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно менее выражены в клетках 3T3-L1, обработанных SB, отфильтрованным через PE и LGG. В частности, PE, LGG-T0 и LGG-T1 были способны снижать уровни гена адипонектина, PPAR-γ, SREBP, FAS и IL-6 и повышать уровни гена IL-10 ().

(A – F) Анализ экспрессии генов с помощью qRT-PCR липогенного пути в клетках 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE.Результаты выражены как средние значения ± стандартное отклонение четырех экспериментов, выполненных в трех повторностях ( * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с контролем. LGG T0 + PE).

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно снизила уровни экспрессии мРНК основных транскрипционных факторов, участвующих в адипогенезе, по сравнению с обработкой SB, отфильтрованных через LGG ( LGGT0 и LGGT1) отдельно ().

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно увеличила уровни экспрессии мРНК IL10 по сравнению с обработкой только SB (LGGT0 и LGGT1), профильтрованных через LGG ( ). Более того, эти данные свидетельствуют о том, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10 (2).

Обсуждение

Благоприятные эффекты употребления плодов граната и / или сока вызвали значительный научный интерес (Basu and Penugonda, 2009).Многие исследователи сообщают, что полиэтилены, полученные из отходов перерабатывающих предприятий, обладают способностью улавливать свободные радикалы и обладают мощной антиоксидантной способностью (Panichayupakaranant et al., 2010; Fischer et al., 2011). ПЭ, использованный в настоящем исследовании, был растворим в воде и охарактеризован с помощью ВЭЖХ – PDA – ESI / MS n на содержание фенолов и антоцианов. В соответствии с предыдущими сообщениями (Fischer et al., 2011; Qu et al., 2012; Romeo et al., 2015), эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожура), поскольку они составляют более 99% от общего содержания фенольных соединений граната.Основными эллагитаннинами побочных продуктов граната, а также продуктов из граната (фруктов и соков) являются пуникалагины (Gil et al., 2000; Fischer et al., 2011; Qu et al., 2012).

Экстракт граната содержит высокий процент фенольных соединений и проявляет антиоксидантную активность в зависимости от концентрации, как показано для анализа как DPPH, так и анализа поглощения супероксид-анионов.

Сообщалось, что диетические полифенолы растений способны избирательно модулировать рост чувствительных микроорганизмов (Tabasco et al., 2011). Экстракты растений обычно подавляют рост бактерий, но степень эффекта зависит от состава экстракта и типа бактериального штамма.

Результаты, полученные в наших экспериментальных условиях, показали, что высокие концентрации полифенолов граната оказывают противомикробное действие на некоторые штаммы патогенов, такие как L. innocua и S. aureus. Эти результаты согласуются с исследованиями Panichayupakaranant et al. (2010), Fawole et al.(2012) и Su et al. (2012).

Однако при концентрациях PE ниже 0,34 мг / мл, хотя не было обнаружено концентраций ингибирующей активности против пробиотических штаммов, оценивалось только небольшое увеличение роста LGG. Эти результаты не согласуются с исследованиями Li et al. (2015) и Neyrinck et al. (2013), которые продемонстрировали, что полифенолы граната потенциально могут работать как пребиотики.

Ожирение — это состояние, при котором накопление липидов приводит к расширению жировой ткани, которая действует как метаболический и эндокринный орган.Молекулярные механизмы, которые модулируют рост, дифференцировку и липогенез преадипоцитов жировых клеток, были предметом обширных исследований (Vanella et al., 2012; Stechschulte et al., 2014; Moseti et al., 2016; Palmeri et al., 2016; Waldman et al., 2016; Carpene et al., 2018).

Во время дифференцировки адипоцитов преадипоциты дифференцируются в зрелые адипоциты (Lefterova and Lazar, 2009). Повышенное накопление жира сильно коррелирует с количеством клеток и / или размером адипоцитов (Jiang et al., 2008).

Сообщалось, что степень ожирения связана с дифференцировкой преадипоцитов в адипоцитах и ​​с увеличением адипоцитов в жировой ткани (Wang and Jones, 2004).

Другие авторы сообщили, что PEs способны подавлять дифференцировку преадипоцитов и адипогенез и уменьшать жировую дистрофию печени у крыс с ожирением и диабетом 2 типа (Xu et al., 2009).

В соответствии с данными Moon et al. (2012) и Park et al. (2014) в наших экспериментальных условиях PE, LGG-T0 и LGG-T1 приводили к значительному снижению накопления липидов в клетках 3T3-L1 во время дифференцировки в адипоциты, предполагая, что PE, LGG-T0 и LGG-T1 способны подавлять дифференцировка адипоцитов.Однако обработка LGG-фильтрованным SB, полученным из клеток, инкубированных с PE (LGG-T1) или без (LGG-T1), была аналогичной. В наших экспериментальных условиях фактически не наблюдалось пребиотического эффекта, продемонстрированного другими авторами. Более того, комбинированное лечение PE и LGG-T1 было наиболее эффективным в снижении внутриклеточного накопления липидов. Эти данные демонстрируют, что, даже если в наших экспериментальных условиях не наблюдалось пребиотического эффекта, фильтрованный SB, полученный из LGG, инкубированного с PE (LGG-T1), мог бы содержать, помимо полезных бактериальных секретируемых биоактивных соединений, также небольшие количества PE- производные биоактивные соединения.Последний, присутствующий в небольших количествах в LGG-T1, не будет иметь более сильных положительных эффектов, чем LGG-T0, но в сочетании с PE может иметь потенциальные синергетические преимущества для здоровья.

Адипоцит-специфический рецептор-активируемый пролифератором пероксисом-γ (PPARγ) участвует в ранней стадии дифференцировки адипоцитов (Rosen et al., 2000), регулируя экспрессию адипогенных генов, таких как синтаза жирных кислот (FAS) и регуляторный элемент стерола. -связывающие белки (SREBP), а затем запускают накопление жира в клетках (Kawada et al., 2001; Бергер и Моллер, 2002).

Жировая ткань — это не только первичный резервуар жира, но и эндокринный орган, контролирующий гомеостаз липидов. Измененные уровни адипокинов жировой ткани могут способствовать развитию воспаления, что приводит к нарушению липидного обмена (Armani et al., 2010). При хроническом воспалении провоспалительные цитокины, такие как IL-6, активируются, тогда как противовоспалительные цитокины, такие как IL-10, подавляются (Kershaw and Flier, 2004; Bradley et al., 2008; Лира и др., 2012; Лю и др., 2018).

Наши результаты демонстрируют, что комбинированное лечение PE + LGG-T1 значительно снижает уровень мРНК адипонектина, FAS и IL-6 и повышает уровень IL-10.

Можно сделать вывод, что комбинированное лечение PE + LGG-T1 обладает противовоспалительными свойствами и способно ингибировать дифференцировку адипоцитов, модулируя уровни экспрессии ключевых факторов адипогенной транскрипции, участвующих в адипогенезе.

Заключение

SB, отфильтрованный экстрактом граната и LGG, значительно снижал накопление внутриклеточных липидов.Наблюдали синергетический эффект пробиотиков и полифенолов, содержащихся в ПЭ. Более того, наши результаты показали, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10.

Эти результаты свидетельствуют о том, что пробиотики и полифенолы, содержащиеся в ПЭ, могут влиять на адипогенез in vitro. Более того, наши результаты демонстрируют, что синергетические свойства сочетания таких продуктов, как гранат и пробиотики, могут оказывать комбинированное воздействие на здоровье.

Тогда гранат и пробиотики, такие как штамм LGG, могут внести свой вклад в разработку новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Вклад авторов

VS, LV, CR, CC, FR и GB собрали исследовательские статьи, разработали эксперименты, проанализировали результаты и написали рукопись. CR, MR, SF и NT проводили эксперименты.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Источники

  • Аль-Зореки Н.С. (2009). Антимикробная активность кожуры плодов граната ( Punica granatum L.). Внутр. J. Food Microbiol. 134 244–248. 10.1016 / j.ijfoodmicro.2009.07.002 [PubMed] [CrossRef] [Google Scholar]
  • Армани А., Мамми К., Марцолла В., Каланчини М., Антелми А., Розано Г. М. и др. (2010). Клеточные модели для понимания адипогенеза, дисфункции жировой ткани и ожирения. J. Cell Biochem. 110 564–572.10.1002 / jcb.22598 [PubMed] [CrossRef] [Google Scholar]
  • Барбагалло И., Ли Вольти Г., Сорренти В., Ди Джакомо К., Аквавива Р., Раффаэле М. и др. (2017). Фенетиловый эфир кофейной кислоты восстанавливает экспрессию гена адипоцитов после обработки липополисахаридом. Lett. Drug Des. Discov. 14 481–487. 10.2174 / 1570180813666160

    4707 [CrossRef] [Google Scholar]

  • Бассири-Джахроми С. (2018). Активность Punica granatum (граната) в укреплении здоровья и профилактике рака. Онкол. Сборка 12: 345. 10.4081 / онкол.2018.345 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Басу А., Пенугонда К. (2009). Гранатовый сок: фруктовый сок, полезный для сердца. Nutr. Сборка 67 49–56. 10.1111 / j.1753-4887.2008.00133.x [PubMed] [CrossRef] [Google Scholar]
  • Бергер Дж., Моллер Д. Э. (2002). Механизмы действия PPAR. Annu. Rev. Med. 53 409–435. 10.1146 / annurev.med.53.082901.104018 [PubMed] [CrossRef] [Google Scholar]
  • Bialonska D., Касимсетти С. Г., Шредер К. К., Феррейра Д. (2009). Влияние побочных продуктов граната ( Punica granatum L.) и эллагитаннинов на рост кишечных бактерий человека. J. Agric. Food Chem. 57 год 8344–8349. 10.1021 / jf

    1b [PubMed] [CrossRef] [Google Scholar]

  • Бялонска Д., Рамнани П., Касимсетти С. Г., Мунта К. Р., Гибсон Г. Р., Феррейра Д. (2010). Влияние побочного продукта граната и пуникалагинов на отдельные группы кишечной микробиоты человека. Внутр.J. Food Microbiol. 140 175–182. 10.1016 / j.ijfoodmicro.2010.03.038 [PubMed] [CrossRef] [Google Scholar]
  • Брэдли Р. Л., Фишер Ф. Ф., Маратос-Флиер Э. (2008). Пищевые жирные кислоты по-разному регулируют продукцию TNF-альфа и IL-10 адипоцитами 3T3-L1 мышей. Ожирение 16 938–944. 10.1038 / обы.2008.39 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Карпен К., Пеженауте Х., Дель Мораль Р., Буле Н., Хихона Э., Андраде Ф. и др. (2018). Диетический антиоксидант пицеатаннол подавляет адипогенез мезенхимальных стволовых клеток жировой ткани человека и ограничивает транспорт глюкозы и липогенную активность в адипоцитах. Внутр. J. Mol. Sci. 19: E2081. 10.3390 / ijms181 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Дхумал С., Карале А. Р., Джадхав С. Б., Кад В. П. (2014). Последние достижения и разработки в области обработки и использования граната: обзор. J. Agric. Crop Sci. 1 1–17. [Google Scholar]
  • Ди Джакомо К., Ванелла Л., Сорренти В., Сантанджело Р., Барбагалло И., Калабрезе Г. и др. (2015). Эффекты tithonia diversifolia (Hemsl.) A.Серый экстракт о дифференцировке адипоцитов мезенхимальных стволовых клеток человека. PLoS One 10: e0122320. 10.1371 / journal.pone.0122320 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Фаволе О. А., Макунга Н. П., Опара Ю. Л. (2012). Метанольный экстракт кожуры плодов граната обладает антибактериальной, антиоксидантной и ингибирующей тирозиназой активностью. BMC Дополнение. Альтерн. Med. 12: 200. 10.1186 / 1472-6882-12-200 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Fischer U.А., Карл Р., Каммерер Д. Р. (2011). Идентификация и количественное определение фенольных соединений из кожуры граната ( Punica granatum L.), мезокарпа, арил и других соков с помощью HPLC-DAD-ESI / MS (n). Food Chem. 127 807–821. 10.1016 / j.foodchem.2010.12.156 [PubMed] [CrossRef] [Google Scholar]
  • Гил М. И., Томас-Барберан Ф. А., Хесс-Пирс Б., Холкрофт Д. М., Кадер А. А. (2000). Антиоксидантная активность гранатового сока и ее связь с фенольным составом и обработкой. J. Agric. Food Chem. 48 4581–4589. [PubMed] [Google Scholar]
  • Хоссин Ф. Л. А. (2009). Воздействие кожуры граната (Punica granatum) и его экстракта на крыс с ожирением и гиперхолестеринемией. Пак. J. Nutr. 8 1251–1257. 10.3923 / pjn.2009.1251.1257 [CrossRef] [Google Scholar]
  • Jiang L., Zhang N. X., Mo W., Wan R., Ma C. G., Li X., et al. (2008). Ремания подавляет дифференцировку адипоцитов и адипогенез. Biochem. Биофиз. Res. Commun. 371 185–190.10.1016 / j.bbrc.2008.03.129 [PubMed] [CrossRef] [Google Scholar]
  • Кавада Т., Такахаши Н., Фушики Т. (2001). Биохимические и физиологические характеристики жировой клетки. J. Nutr. Sci. Витаминол. 47 1–12. [PubMed] [Google Scholar]
  • Кершоу Э. Э., Флиер Дж. С. (2004). Жировая ткань как эндокринный орган. J. Clin. Эндокринол. Метаб. 89 2548–2556. 10.1210 / jc.2004-0395 [PubMed] [CrossRef] [Google Scholar]
  • Ким С. Х., Плутцки Дж. (2016). Бурый жир и потемнение для лечения ожирения и связанных с ним нарушений обмена веществ. Diabetes Metab. J. 40 12–21. 10.4093 / dmj.2016.40.1.12 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лай С., Цай М. Л., Бадмаев В., Хименес М., Хо К. Т., Пан М. Х. (2012). Ксантиген подавляет дифференцировку преадипоцитов и адипогенез за счет подавления PPARgamma и C / EBP и модуляции путей SIRT-1, AMPK и FoxO. J. Agric. Food Chem. 60 1094–1101. 10.1021 / jf204862d [PubMed] [CrossRef] [Google Scholar]
  • Ли К.Дж., Чен Л. Г., Лян В. Л., Ван К. С. (2010). Противовоспалительное действие punica granatum Linne in vitro и in vivo. Food Chem. 118 315–322. [Google Scholar]
  • Лефтерова М. И., Лазарь М. А. (2009). Новые разработки в адипогенезе. Trends Endocrinol. Метаб. 20 107–114. 10.1016 / j.tem.2008.11.005 [PubMed] [CrossRef] [Google Scholar]
  • Лес Ф., Арбонес-Майнар Дж. М., Валеро М. С., Лопес В. (2018). Полифенолы граната и уролитин А ингибируют альфа-глюкозидазу, дипептидилпептидазу-4, липазу, накопление триглицеридов и гены, связанные с адипогенезом, в адипоцитоподобных клетках 3T3-L1. J. Ethnopharmacol. 220 67–74. 10.1016 / j.jep.2018.03.029 [PubMed] [CrossRef] [Google Scholar]
  • Ли Ю. Ф., Го К. Дж., Ян Дж. Дж., Вэй Дж. Ю., Сюй Дж., Ченг С. (2006). Оценка антиоксидантных свойств экстракта кожуры граната по сравнению с экстрактом мякоти граната. Food Chem. 96 254–260. [Google Scholar]
  • Ли З., Сумманен П. Х., Комория Т., Хеннинг С. М., Ли Р. П., Карлсон Э. и др. (2015). Эллагитаннины граната стимулируют рост кишечных бактерий in vitro: влияние на пребиотические и метаболические эффекты. Анаэроб 34 164–168. 10.1016 / j.anaerobe.2015.05.012 [PubMed] [CrossRef] [Google Scholar]
  • Лин Л. Т., Чен Т. Ю., Лин С. С., Чунг С. Ю., Лин Т. К., Ван Г. Х. и др. (2013). Широкий спектр противовирусной активности хебулаговой кислоты и пуникалагина против вирусов, которые используют гликозаминогликаны для проникновения. BMC Microbiol. 13: 187. 10.1186 / 1471-2180-13-187 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Lira F. S., Rosa J. C., Pimentel G. D., Seelaender M., Дамасо А. Р., Ояма Л. М. и др. (2012). И адипонектин, и интерлейкин-10 ингибируют LPS-индуцированную активацию пути NF-kappaB в адипоцитах 3T3-L1. Цитокин 57 год 98–106. 10.1016 / j.cyto.2011.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Лю Ю., Сюй Д., Инь С., Ван С., Ван М., Сяо Ю. (2018). Уровень IL-10 / STAT3 снижается при детском ожирении с гипертриглицеридемией и связан с уровнем триглицеридов у крыс с ожирением, вызванным диетой. BMC Endocr. Disord. 18:39.10.1186 / s12902-018-0265-z [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Moon Y. J., Soh J. R., Yu J. J., Sohn H. S., Cha Y. S., Oh S. H. (2012). Эффект ингибирования внутриклеточного накопления липидов Weissella koreensis OK1-6, выделенного из Kimchi, на дифференцировку адипоцитов. J. Appl. Microbiol. 113 652–658. 10.1111 / j.1365-2672.2012.05348.x [PubMed] [CrossRef] [Google Scholar]
  • Мосети Д., Регасса А., Ким В. К. (2016). Молекулярная регуляция адипогенеза и потенциальные антиадипогенные биоактивные молекулы. Внутр. J. Mol. Sci. 17: E124. 10.3390 / ijms17010124 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Нейринк А. М., Ван Хи В. Ф., Биндельс Л. Б., Де Бакер Ф., Кани П. Д., Делзен Н. М. (2013). Богатый полифенолами экстракт кожуры граната облегчает воспаление тканей и гиперхолестеринемию у мышей с ожирением, вызванных диетой с высоким содержанием жиров: потенциальное влияние на микробиоту кишечника. руб. J. Nutr. 109 802–809. 10.1017 / S0007114512002206 [PubMed] [CrossRef] [Google Scholar]
  • Палмери Р., Монтелеоне Дж. И., Спанья Г., Рестучча К., Раффаэле М., Ванелла Л. и др. (2016). Экстракт оливковых листьев сицилийского сорта уменьшал накопление липидов, вызывая термогенный путь во время адипогенеза. Фронт. Pharmacol. 7: 143. 10.3389 / fphar.2016.00143 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Panichayupakaranant P., Tewtrakul S., Yuenyongsawad S. (2010). Антибактериальное, противовоспалительное и противоаллергическое действие стандартизированного экстракта кожуры граната. Food Chem. 123 400–403. 10.1055 / s-0030-1264706 [CrossRef] [Google Scholar]
  • Парк Дж. Э., О С. Х., Ча Ю. С. (2014). Lactobacillus brevis OPK-3, выделенный из кимчи, подавляет адипогенез и оказывает противовоспалительное действие в адипоцитах 3T3-L1. J. Sci. Продовольственное сельское хозяйство. 94 2514–2520. 10.1002 / jsfa.6588 [PubMed] [CrossRef] [Google Scholar]
  • Ку В., Брекса III А. П., Пан З., Ма Х. (2012). Количественное определение основных составляющих полифенолов в продуктах из граната. Food Chem. 132 1585–1591. 10.1016 / j.foodchem.2011.11.106 [PubMed] [CrossRef] [Google Scholar]
  • Раффаэле М., Барбагалло И., Ликари М., Карота Г., Сферраццо Г., Спампинато М. и др. (2018). N-ацетилцистеин (NAC) улучшает липидную метаболическую дисфункцию в адипоцитах, происходящих из стромальных клеток костного мозга. Evid. На основе дополнения. Альтерн. Med. 2018: 9. 10.1155 / 2018/5310961 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Редди М. К., Гупта С.К., Джейкоб М. Р., Хан С. И., Феррейра Д. (2007). Антиоксидантное, противомалярийное и противомикробное действие богатых танинами фракций, эллагитаннинов и фенольных кислот из Punica granatum L. Planta Med. 73 461–467. 10.1055 / с-2007-967167 [PubMed] [CrossRef] [Google Scholar]
  • Ромео Ф. В., Баллистрери Г., Фаброни С., Пангалло С., Никосия М. Г., Шена Л. и др. (2015). Химическая характеристика различных экстрактов сумаха и граната, эффективных против гнили Botrytis cinerea. Молекулы 20 11941–11958. 10,3390 / молекул 200711941 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Розен Э. Д., Уолки К. Дж., Пучсервер П., Шпигельман Б. М. (2000). Транскрипционная регуляция адипогенеза. Genes Dev. 14 1293–1307. [PubMed] [Google Scholar]
  • Салерно Л., Модика М. Н., Ромео Г., Питтала В., Сиракуза М. А., Амато М. Э. и др. (2012). Новые ингибиторы синтазы оксида азота с антиоксидантными свойствами. Eur.J. Med. Chem. 49 118–126. 10.1016 / j.ejmech.2012.01.002 [PubMed] [CrossRef] [Google Scholar]
  • Синглтон В. Л., Ортофер Р., Ламуэла-Равентос Р. М. (1999). Анализ общих фенолов и других субстратов окисления и антиоксидантов с помощью реактива Фолина – Чокальто. Methods Enzymol. 299 152–178. 10.1016 / S0076-6879 (99) 99017-1 [CrossRef] [Google Scholar]
  • Смит К. Б., Смит М. С. (2016). Статистика ожирения. Prim Care 43 год 121–135. 10.1016 / j.поп.2015.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Stechschulte L.A., Хайндс Т.Д., мл., Худер С.С., Шоу В., Наджар С.М., Санчес Э.Р. (2014). FKBP51 контролирует клеточный адипогенез посредством опосредованного p38 киназой фосфорилирования GRalpha и PPARgamma. Мол. Эндокринол. 28 год 1265–1275. 10.1210 / мне.2014-1022 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Su X., Howell A. B., D’Souza D. H. (2012). Антибактериальные эффекты растительных экстрактов на устойчивый к метициллину Staphylococcus aureus. Пищевой патоген. Дис. 9 573–578. 10.1089 / fpd.2011.1046 [PubMed] [CrossRef] [Google Scholar]
  • Табаско Р., Санчес-Патан Ф., Монагас М., Бартоломе Б., Виктория Морено-Аррибас М., Пелаез К. и др. (2011). Влияние полифенолов винограда на рост молочнокислых бактерий и бифидобактерий: устойчивость и метаболизм. Food Microbiol. 28 год 1345–1352. 10.1016 / j.fm.2011.06.005 [PubMed] [CrossRef] [Google Scholar]
  • Тегеранифар А., Селахварзи Ю., Харрази М., Бахш В.J. (2011). Высокий потенциал побочных продуктов агропромышленного производства граната ( Punica granatum L.) как мощных противогрибковых и антиоксидантных веществ. Инд. Сельскохозяйственные культуры 34 1523–1527. 10.1016 / j.indcrop.2011.05.007 [CrossRef] [Google Scholar]
  • Ванелла Л., Барбагалло И., Аквавива Р., Ди Джакомо К., Кардил В., Абрахам Н. Г. и др. (2013a). Эллаговая кислота: цитодифференцирующие и антипролиферативные эффекты в клеточных линиях рака предстательной железы человека. Curr. Pharm.Des. 19 2728–2736. [PubMed] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Кардил В., Ким Д. Х. и др. (2013b). Маркеры апоптоза в клеточной линии рака простаты: эффект эллаговой кислоты. Онкол. Реп. 30 2804–2810. 10.3892 / или 2013.2757 [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Ли Вольти Г., Кардил В. и др. (2013c). Влияние эллаговой кислоты на ангиогенные факторы в клетках рака простаты. Раки 5 726–738. 10.3390 / раки5020726 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Сэнфорд К., мл., Ким Д. Х., Абрахам Н. Г., Эбрахейм Н. (2012). Окислительный стресс и гемоксигеназа-1 регулируют дифференцировку мезенхимальных стволовых клеток человека. Внутр. J. Hypertens. 2012: 8. 10.1155 / 2012/8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Waldman M., Bellner L., Vanella L., Schragenheim J., Sodhi K., Singh S.P., et al. (2016). Эпоксиэйкозатриеновые кислоты регулируют дифференцировку адипоцитов клеток 3T3 мыши посредством активации PGC-1alpha, которая необходима для экспрессии HO-1 и увеличения функции митохондрий. Stem Cells Dev. 25 1084–1094. 10.1089 / scd.2016.0072 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Wang Y. W., Jones P. J. (2004). Конъюгированная линолевая кислота и контроль ожирения: эффективность и механизмы. Внутр. J. Obes. Relat. Метаб. Disord. 28 год 941–955.10.1038 / sj.ijo.0802641 [PubMed] [CrossRef] [Google Scholar]
  • Сюй К. З., Чжу К., Ким М. С., Ямахара Дж., Ли Ю. (2009). Цветок граната уменьшает ожирение печени у животных с диабетом 2 типа и ожирением. J. Ethnopharmacol. 123 280–287. 10.1016 / j.jep.2009.03.035 [PubMed] [CrossRef] [Google Scholar]

Положительное влияние экстракта кожуры граната и пробиотиков на преадипоцитную дифференцировку

Front Microbiol. 2019; 10: 660.

Валерия Сорренти

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия

Cinzia Lucia Randazzo

2 Dipaziena Di мы Università di Catania, Катания, Италия

Cinzia Caggia

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

Габриэле

, Совет по экономическим исследованиям, Габриэле, ) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Флора Валерия Ромео

3 Совет сельскохозяйственных исследований и экономики (CREA) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Симона Фаброни

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок и цитрусовых and Tree Fruit, Ачиреале, Италия

Николина Тимпанаро

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр олив, цитрусовых и древесных фруктов, Ачиреале, Италия

Марко Рафаэле

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Luca Vanella

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия

85

Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

3 (CREA) Совет по сельскохозяйственным исследованиям и экономическим исследованиям Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Редактор: Розальба Ланчотти, Болонский университет, Италия 90 005

Рецензент: Анна Реале, Институт науки и технологий (ISA), Италия; Коши Филип, Малайский университет, Малайзия

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы микробиологии»

Поступила в редакцию 22 октября 2018 г .; Принята в печать 15 марта 2019 г.

Авторские права © 2019 Сорренти, Рандаццо, Каджия, Баллистрери, Ромео, Фаброни, Тимпанаро, Раффаэле и Ванелла.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Благоприятные эффекты граната обусловлены содержанием эллагитаннинов и антоцианов, которые защищают от множества заболеваний, включая воспалительные. Многие исследователи сообщают, что экстракты отходов граната (кожуры и семян), полученные из отходов промышленной переработки, обладают акцептором свободных радикалов и обладают мощной антиоксидантной способностью. Также сообщалось, что экстракты граната (ПЭ) обладают антибактериальной, противовирусной, гиполипидемической и противовоспалительной биоактивностью благодаря содержанию полифенольных соединений, включая пуникалагины, галловую кислоту и производные эллаговой кислоты.В центре внимания данной рукописи было изучение пребиотического потенциала PE, растворимого в воде и охарактеризованного с помощью HPLC – PDA – ESI / MS n на предмет его фенольного содержания. Более того, поскольку сообщалось, что экстракты граната снижали уровень липидов в крови и что было показано, что ряд пробиотических штаммов влияет на адипогенез в культуре клеток, это исследование также было выполнено для проверки in vitro эффектов PE и пробиотик L.rhamnosus GG ATCC 53103 (LGG) на линии клеток 3T3-L1. PE и пробиотики существенно снижали содержание триглицеридов и увеличение внутриклеточных липидов по сравнению с контрольной группой. Однако комбинированная обработка отработанного бульона (SB), отфильтрованного через PE и LGG, была наиболее эффективной для снижения содержания триглицеридов и накопления внутриклеточных липидов. Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были существенно ниже в клетках 3T3-L1, обработанных PE и SB, отфильтрованных через LGG.Эти результаты свидетельствуют о том, что синергетический эффект пробиотиков и полифенолов, содержащихся в PE, может влиять на адипогенез in vitro и , а также может способствовать разработке новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Ключевые слова: лактобациллы, антимикробная активность, экстракт граната, дифференциация адипоцитов, комбинирование продуктов

Введение

Гранат — плод, положительное влияние которого на здоровье было тщательно изучено.Этот фрукт богат биологически активными соединениями, такими как эллагитаннины и антоцианы, которые защищают от дегенеративных заболеваний. Плод граната из-за его высокой питательной ценности, пользы для здоровья и биоактивных антиоксидантных соединений считается пищевым лекарством. Фактически, гранат широко используется в фитотерапии при нескольких патологиях, включая грипп и инфекции верхних дыхательных путей. Все части плодов граната, то есть кожура и семена, рассматриваемые как отходы, могут быть переработаны для получения продуктов с добавленной стоимостью, имеющих промышленную, медицинскую и косметическую ценность (Dhumal et al., 2014).

Отходы граната образуются на всех этапах жизненного цикла плодов, то есть во время сельскохозяйственного производства, промышленного производства и переработки. Можно использовать побочные продукты граната, поскольку они являются богатым источником биологически активных соединений, таких как флавоноиды, фенольные кислоты и дубильные вещества. Более того, многие исследователи описали, что экстракты граната, полученные из побочных продуктов перерабатывающих заводов, обладают эффективным улавливанием свободных радикалов и антиоксидантной способностью (Lee et al., 2010; Panichayupakaranant et al., 2010; Fischer et al., 2011).

Кроме того, экстракты граната действуют как естественные ингибиторы патогенов, бактерий и грибов (Al-Zoreky, 2009; Tehranifar et al., 2011; Romeo et al., 2015).

Эллагитаннины граната гидролизуются микробиотой кишечника до более мелких фенольных соединений, таких как эллаговая кислота. Затем эллаговая кислота всасывается в кровоток, в то время как эллагитанины не всасываются и метаболизируются в уролитины.

Сообщалось, что побочные продукты граната и пуникалагины в значительной степени способны подавлять рост патогенных бактерий Escherichia coli , Pseudomonas aeruginosa , Clostridia и Staphylococcus aureus (Reddy et al., 2007; Bialonska et al., 2009) и для увеличения роста полезных бактерий, включая Bifidobacterium spp. и Lactobacillus spp. (Reddy et al., 2007; Bialonska et al., 2010).

Экстракты граната также снижают уровень липидов в крови и обладают значительной противоопухолевой, противовирусной и противовоспалительной активностью (Li et al., 2006; Hossin, 2009; Lin et al., 2013; Bassiri- Джахроми, 2018).

Эти потенциальные полезные эффекты приписываются полифенольным соединениям, которые содержатся в экстрактах граната, включая пуникалагины, галловую кислоту и производные эллаговой кислоты (Vanella et al., 2013а, б, в; Romeo et al., 2015).

Поскольку ожирение является одной из основных проблем общественного здравоохранения, необходимы новые превентивные стратегии (Smith and Smith, 2016).

Адипоциты играют важную роль в начале или развитии метаболических осложнений, связанных с ожирением, таких как метаболический синдром и диабетические осложнения (Kim and Plutzky, 2016).

Интерес исследователей к выявлению натуральных продуктов, полученных из диетических растений, обладающих активностью против ожирения, возрос.Сообщалось, что ксантиген и фукоксантин, природные соединения масла косточек граната, значительно подавляли дифференцировку адипоцитов и накопление липидов (Lai et al., 2012).

Настоящая рукопись посвящена прежде всего изучению антиоксидантной и антимикробной активности, а также пребиотического потенциала ПЭ, богатого фенольными соединениями. Более того, обогащенный стандартизованный полиэтилен, содержащий высокий процент природных антиоксидантов граната, был химически охарактеризован с помощью ВЭЖХ – PDA – ESI / MSn.Во-вторых, поскольку гранатовый сок (Les et al., 2018) и различные типы экстрактов граната (PE), включая экстракт, полученный из цельного фрукта (Li et al., 2015), и экстракт, полученный из кожуры граната (Neyrinck et al., 2013), и было показано, что ряд пробиотических штаммов (Moon et al., 2012; Park et al., 2014) влияют на адипогенез, это исследование было проведено для проверки in vitro эффектов PE, пробиотика L rhamnosus GG ATCC 53103 (LGG), предварительно инкубированные с PE, отдельно или в комбинации, при дифференцировке клеток 3T3-L1.

Материалы и методы

Химические вещества

Порошкообразный экстракт граната (Dermogranate ® ), использованный в этом исследовании, был предоставлен Medinutrex (Катания, Италия). Вкратце, экстракт готовили из сушеных и измельченных плодов граната, смешанных с водно-спиртовыми растворами (пищевой), а затем фильтровали. Фильтрат концентрировали и затем сушили распылением для получения стандартизованного экстракта. Экстракт Dermogranate ® имел следующий химический состав: общие полифенолы (16%), пуникалагины (8%), эллаговая кислота и производные (8%).

Реагент Фолина – Чокальтеу (FCR), карбонат натрия (Na 2 CO 3 ), галловая кислота, пуникалин (смесь аномеров), пуникалагин и эллаговая кислота были приобретены у Sigma-Aldrich (Милан, Италия). Гранатин Б был приобретен у LGC Standards (Лондон, Великобритания). Для хроматографии использовали растворители чистоты для ВЭЖХ – МС (Merck KgaA, Дармштадт, Германия), а все остальные реагенты были аналитической чистоты.

Определение общего содержания полифенолов

Анализ Folin – Ciocalteu (Singleton et al., 1999) был использован для определения общего содержания полифенолов с небольшими изменениями. 0,1 мг / мл экстракта растворяли в дистиллированной воде. Затем к 500 мкл образца добавляли 5 мл 10% FCR и 4,5 мл раствора Na 2 CO 3 (7,5% мас. / Об.). Конечный раствор перемешивали в течение 2 часов в темноте, а затем измеряли Abs при λ = 765 нм. Анализы проводили в трех экземплярах, и общую концентрацию полифенолов выражали в граммах эквивалентов галловой кислоты (GAE) / 100 г экстракта.

HPLC – PDA – ESI / MS

n Анализ фенольных соединений

Разделение и количественное определение фенольных соединений выполняли, как описано ранее (Romeo et al., 2015). Для идентификации фенольных соединений времена удерживания (RT), спектры и данные МС в режиме отрицательного ESI сравнивали с данными аутентичных стандартов. Количественное определение каждого фенольного соединения проводили с использованием соответствующего стандарта в качестве внешнего стандарта. Количественное определение галловой кислоты проводили при 280 нм.Пуникалины, гранатин В, пуникалагины и эллаговая кислота определялись количественно при 378 нм; та же длина волны использовалась для количественного определения производных эллаговой кислоты с использованием эллаговой кислоты в качестве стандарта сравнения. Анализы проводили в трех экземплярах, и результаты выражали в г соединения / 100 г экстракта.

Тушение DPPH

Способность улавливать свободные радикалы различных концентраций экстракта PE (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) измеряли по 2, Безрадикальный метод 2-дифенил-1-пикрилгидразилгидрата (DPPH), как сообщалось ранее (Salerno et al., 2012). Результаты выражены в процентах от степени ингибирования ± SD .

Влияние поглотителя на супероксид-анион

Способность экстракт ПЭ различных концентраций улавливать супероксид-анион (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) определялась как сообщалось ранее (Салерно и др., 2012). Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Мышиные преадипоциты 3T3-L1 Жизнеспособность клеток

Мышиные преадипоциты 3T3-L1 были приобретены в Американской коллекции типовых культур (Роквилл, Мэриленд, США).Клетки высевали в концентрации 2 × 10 5 клеток на лунку 96-луночного микропланшета и культивировали при 37 ° C в инкубаторе с 5% CO 2 в течение 48 часов в отсутствие и в присутствии различных концентраций ЧП сообщалось выше. Жизнеспособность клеток измеряли с помощью анализа МТТ, как сообщалось ранее (Di Giacomo et al., 2015). МТТ, желтый тетразол, в живых клетках восстанавливается до пурпурного формазана. Результаты выражены в процентах формазана, продуцированного в обработанных мышиных преадипоцитах 3T3-L1, по сравнению с необработанными клетками.

Микробиология

Культивирование бактерий

Использовали коммерческие штаммы патогенов E. coli ATCC 25922, S. aureus ATCC 29213, Listeria innocua ATCC 33090 и Salmonella enterica ATCC 14028. Штамм E. coli выращивали в бульоне Лурия-Бертани (LB) при 37 ° C в течение ночи; S. aureus , S. enterica и L. innocua обычно выращивали в течение ночи в триптон-соевом бульоне (TSB) при 37 и 30 ° C соответственно.Все материалы и приложения предоставлены Oxoid (Милан, Италия).

Коммерческие пробиотические штаммы LGG, Bifidobacterium animalis BB12, B. longum BB536 и дикий штамм Lactobacillus paracasei N 24, выделенные из кротонского сыра пекорино, культивировали в бульоне Демана – Рогоза – Шарпа (MRS). при 37 ° C в течение ночи.

Ночные бактериальные культуры инкубировали при 37 ° C в течение 24 часов в анаэробных условиях, пока они не достигли плотности клеток приблизительно 1.0 × 10 9 КОЕ / мл.

Определение скорости роста

На основании результатов, полученных по активности PE в качестве акцептора свободных радикалов, и экспериментов по жизнеспособности преадипоцитов мышей 3T3-L1, для обработки штаммов пробиотиков или патогенов, как описано ниже, использовали различные концентрации.

Антимикробная активность PE оценивалась в отношении коммерческих штаммов патогенов, упомянутых выше. Ночные культуры патогенов совместно культивировали при 37 ° C в течение 24 ч с PE в различных концентрациях (1.7–0,34–0,17 мг / мл), а антимикробную активность оценивали подсчетом живых бактерий на чашках и выражали в КОЕ / мл.

Влияние PE на рост пробиотических штаммов, упомянутых выше, оценивали при совместном культивировании пробиотических штаммов с плотностью клеток приблизительно 1,0 × 10 9 КОЕ / мл с PE в различных концентрациях (0,085–0,042– 0,028 мг / мл). Влияние экстракта на рост пробиотических штаммов оценивали после инкубации при 37 ° C в течение 24 часов в анаэробных условиях путем посева на чашки живых бактерий и выражали в КОЕ / мл.

Все эксперименты проводились в двух экземплярах, а результаты выражались в виде средних значений и стандартного отклонения. Основываясь на предварительных результатах, для последующих анализов была выбрана LGG.

Свежие бульонные культуры центрифугировали при 5000 об / мин в течение 10 минут при 4 ° C, супернатант декантировали для сбора отработанного бульона (SB), который фильтровали (FSB) с использованием фильтра 0,22 мкм и затем использовали для дальнейшего использования. анализы.

Бактериальный осадок ресуспендировали в 1 мл PBS и пять раз обрабатывали ультразвуком с амплитудой 44% в течение 2 мин с 6 мин отдыха.Затем обработанный ультразвуком центрифугировали при 1100 × g в течение 15 мин при 4 ° C. Супернатант собирали, фильтровали через фильтр 0,22 мкм и меченный экстракт бактериальных клеток (CE). CE использовался для дальнейшего анализа.

Культура клеток и дифференцировка клеток адипоцитов

Преадипоциты мышей 3T3-L1 ресуспендировали в среде Игла, модифицированной по Дульбекко (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS, Invitrogen, Карлсбад, Калифорния, США) и 1% антибиотика. / антимикотический раствор (Invitrogen, Карлсбад, Калифорния, США) и высевали в колбу размером 75 см 2 при плотности от 1 до 2 × 10 4 клеток.Дифференцировку клеток адипоцитов получали, как сообщалось ранее (Waldman et al., 2016).

Дифференцирующиеся преадипоциты 3T3-L1 обрабатывали в течение 7 дней PE (0,028 мг / мл), LGG CE (25 мкг / мл) и SB, профильтрованным через LGG (10 мкг / мл) из ночной бактериальной культуры, инкубированной с или без ПЭ (0,028 мг / мл).

Количественное определение содержания липидов

Для количественной оценки накопления липидов проводили масляное красное окрашивание, как сообщалось ранее (Barbagallo et al., 2017). Образование липидных капель измеряли с помощью инвертированного многоканального светодиодного флуоресцентного микроскопа (Evos, Life Technologies, Гранд-Айленд, Нью-Йорк, США).

Экстракция РНК и qRT-PCR

Экспрессии адипонектина, PPAR-γ, SREBP, FAS, IL-6 и IL-10 оценивали с помощью ПЦР в реальном времени. РНК экстрагировали и количественно оценивали, как сообщалось ранее (Raffaele et al., 2018). Использовали соответствующие последовательности праймеров (). Относительный уровень экспрессии мРНК измеряли по значению порогового цикла (Ct) каждого продукта ПЦР и нормализовали с таковым для GAPDH с использованием сравнительного метода 2 -ΔΔCt .

Таблица 1

ПЦР-праймеров, использованных в этом исследовании.

Gene Прямой праймер Обратный праймер
Адипонектин GAAGCCGCTTATGTGTATCGC GAATGGGTACATTGGGAACAGT
IL-6 TTCCTCTCTGCAAGAGACTTCC AGGAGAGCATTGGAAATTGGGG
FAS GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
GAPDH AGCTTCGGCACATATTTCATCTG CGTTCACTCCCATGACAAACA
IL-10 GCTGGACAACATACTGCTAACC ATTTCCGATAAGGCTTGGCAA
SREBP-1 GATGTGCGAACTGGACACAG CATAGGGGGCGTCAAACAG
PPAR-γ TCGCTGATGCACTGCCTATG ACCTGATGGCATTGTGAGACAT

Статистический анализ

Статистический анализ множественных сравнений был выполнен e Метод Фишера. P — значения ниже 0,05 были приняты как значимые. Данные были проанализированы с использованием либо однофакторного дисперсионного анализа (ANOVA) для нескольких групп, либо непарного t -теста для двух групп, и результаты представлены в виде среднего значения ± стандартное отклонение.

Результаты

HPLC – PDA – ESI / MS

n Анализ PE

Фенольный профиль PE () включал определение 1 гидроксибензойной кислоты и 19 эллагитаннинов. Основные пики соответствовали пуникалину (пик 4), гранатину B (пик 6), пуникалагину A и B (пики 10 и 14) и эллаговой кислоте (пик 19) ().Выявлено также присутствие галловой кислоты (пик 1) и производных эллаговой кислоты (пики 2, 3, 5, 7–9, 11–13, 15–18, 20). Как показано на хроматограмме, эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожуры), поскольку они составляют более 99% от общего содержания фенольных соединений граната. Пуникалагины, основные эллагитаннины побочных продуктов граната, составляют 47,6% от общего содержания фенольных соединений в ПЭ (). Производные эллаговой кислоты, эллаговая кислота и другие второстепенные фенольные соединения (пуникалин, гранатин B и галловая кислота) составили 38.4, 10,2 и 3,8% от общего содержания фенолов в ПЭ соответственно ().

ВЭЖХ-хроматограмма фенольных соединений ПЭ, обнаруженных при 378 нм. Об идентификации пиков см.

Таблица 2

Список пиков и количественное определение фенольных соединений в ПЭ.

907 0,07 907 907 907 0,07 907 907 909 ± 0,04 98 6 7

9 9,5

9 905 909 0,09 909 909 7 7 8 7

9

7

9 35,498 Ead d

9099 7.82

907 907 907 9024 9099 907 907 907 907 907 907 907 907
Номер пика a RT (мин) λ ​​(нм) [M – H] ( м / z ) MS n ( м / z ) Фенольные соединения г / 100 г b
1 3.9 269,310 169 125 Кислота галловая 0,07 ± 0,02
2 4,1 255,364 301 3 7,0 255,363 301 Ead d 0,41 ± 0,04
4 7,3 263,364
5 8,4 264,366 301 Ead d 0,19 ± 0,09
Гранатин B 0,28 ± 0,03
7 10,4 259,361 301 Ead d 0,02 ± 0,01 257,360 301 Ead d 0,05 ± 0,01
9 ​​ 13,5 256,362 0,07 0,07 909 0,07 EAD
10 14,0 258,378 1083 781/601 Пуникалагин А 3,05 ± 0,05
11 15,1 0.13 ± 0,09
12 15,9 257,361 301 Ead d 0,95 ± 0,03
13 9
13 4 Ead d 2,69 ± 0,11
14 17,7 257,378 1083 781/601 Пуникалагин 18 98 7 ± 0,21 257,362 301 Ead d 0,12 ± 0,01
16 25,2 256,363 0,163 0,12 9 0,07 909 0,07 909 0,07
17 29,3 254,361 301 Ead d 0,17 ± 0,01
18 32,2 99 9028 0.08 ± 0,03
19 33,6 256,367 301 229/185 Эллаговая кислота 1,68 ± 0,01
20
20 0,08 ± 0,02
Всего полифенолов c 16,48 ± 2,49
Производные эллаговой кислоты 6,31
Эллаговая кислота 0,62
Итого 16.43

Масс-спектрометрические свойства 20 идентифицированных фенольных соединений (пики 1–20) показаны на рис. Как сообщалось ранее (Romeo et al., 2015), наблюдались две изомерные формы (A и B) пуникалагинов (пики 10 и 14), а также было подчеркнуто присутствие гранатина B (пик 6). Кроме того, эти соединения также были охарактеризованы прямым анализом отрицательных ионов вливания ESI / MS n стандартных соединений.Пик 4 был идентифицирован как пуникалин ( m / z 781), тогда как пики 2, 3, 5, 7–9, 11–13, 15–18 и 20 были идентифицированы как производные эллаговой кислоты в соответствии с их УФ – видимой областью и массой. характеристики (λ max около 370 нм и фрагмент MS 1 на m / z 301, соответствующий эллаговой кислоте).

Активность PE по улавливанию свободных радикалов

Антиоксидантная активность PE проверялась по их способности восстанавливать стабильный радикал DPPH.

В частности, процент ингибирования DPPH достигал 75% при концентрациях ниже 0.21 мг / мл (76,78, 79 и 80% соответственно при концентрации ПЭ 0,17-0,11-0,085 и 0,028 мг / мл). При концентрациях выше 0,21 мг / мл процент ингибирования DPPH был ниже ().

Активность ПЭ по улавливанию радикалов DPPH в различных концентрациях. Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Экстракт граната ингибировал образование супероксид-аниона дозозависимым образом (). Как правило, в этом тесте PE оказался более эффективным, чем в предыдущем.Это может быть связано с меньшим размером супероксид-аниона по сравнению с радикалом DPPH.

Таблица 3

Активность по улавливанию супероксидных ионов при различных концентрациях ПЭ.

78 ± 2
концентрации PE % ингибирования концентрации PE % ингибирования
PE (3,4 мг / мл) 65 ± 2 PE (0,21 мг / мл)
PE (1,7 мг / мл) 73 ± 3 PE (0.17 мг / мл) 80 ± 1
PE (0,85 мг / мл) 75 ± 1 PE (0,11 мг / мл) 85 ± 3
PE (0,56 мг / мл ) 70 ± 2 PE (0,085 мг / мл 88 ± 4
PE (0,42 мг / мл) 68 ± 1 PE (0,028 мг / мл) 95 ± 1
PE (0,34 мг / мл) 75 ± 4

Влияние PE на жизнеспособность клеток 3T3-L1

3- (4,5-диметилтиазол ил) -2,5-дифенилтетразолийбромид (МТТ) проводили для оценки жизнеспособности клеток 3T3-L1.Результаты показывают значительное снижение жизнеспособности клеток при высоких концентрациях PE (3,4, 1,7, 0,85, 0,56 и 0,42 мг / мл), тогда как при более низких (0,34, 0,21, 0,17, 0,11 и 0,085 мг / мл) концентрациях наблюдается умеренная ингибирующий эффект и концентрация 0,028 мг / мл не оказали значительного влияния на жизнеспособность клеток преадипоцитов мышей 3T3-L1 ().

Процент выживаемости преадипоцитов мышей 3T3-L1 в присутствии PE в различных концентрациях. Результаты выражены как среднее значение ± стандартное отклонение четырех экспериментов, проведенных в трех повторностях.Значимые по сравнению с необработанными контролями: * p <0,005; ∗∗ p <0,05.

Microbiology

Антимикробная активность PE в отношении штаммов патогенов

Данные анализа совместного культивирования показали, что патогены были по-разному чувствительны к PE. В деталях, как показано в, экстракт в концентрации 1,7 мг / мл показал наивысшую антимикробную активность против всех патогенов со значительным снижением на L. innocua (проксимально 4 log единицы).При концентрации 0,34 мг / мл экстракт был эффективен против E. coli , L. innocua и S. aureus , демонстрируя снижение плотности клеток на 1 и 2 log единицы соответственно. Когда PE тестировали при концентрации 0,17 мг / мл, штаммы S. aureus , S. enterica и L. innocua все еще подавлялись, в то время как рост E. coli не подвергался значительному влиянию.

Противомикробная активность PE различной концентрации в отношении патогенов, обнаруженных на T24 (24 ч инокулята).Плотность клеток выражается как Δlog КОЕ / мл.

Эффект PE на рост пробиотических штаммов

Результаты, показанные в, подчеркнули, что PE, при всех испытанных концентрациях, не обладал какой-либо ингибирующей активностью в отношении роста испытанных пробиотических штаммов. Небольшое увеличение роста наблюдалось для LGG, совместно культивируемых с PE в концентрации 0,028 мг / мл ().

Таблица 4

Количество бактерий, выраженное как log 10 КОЕ / мл в трех повторностях ± стандартное отклонение L. rhamnosus GG ATCC 53103, Bifidobacterium animalis BB12, B.longum BB536 и дикий штамм Lactobacillus paracasei N 24 после инкубации с PE в различных концентрациях.

мл ) b Б.longum 909 мг 9,57 ± 0,12 a
Журнал 10
L. rhamnosus GG Исходный уровень 8,83 ± 0,09 / PE 9,20 ± 0,10 b
PE (0.042 мг / мл) 9,24 ± 0,07 b
PE (0,028 мг / мл) 9,26 ± 0,04 b
Lactobacillus paracasei 23 907 a
N24 PE (0,085 мг / мл) 8,70 ± 0,08 a
PE (0,042 мг / мл) 8,79 ± 0,10 907 907 907 PE (0.028 мг / мл) 8,74 ± 0,09 a
Bifidobacterium animalis Исходный уровень 9,15 ± 0,05 a
BB12 мг / 0,07 мг / 0,07 0,12 a
PE (0,042 мг / мл) 9,44 ± 0,10 b
PE (0,028 мг / мл) 9,55 ± 0,07 907 Исходный уровень 9,77 ± 0,03 a
BB536 PE (0,085 мг / мл) 9,54 ± 0,10 a
PE (0,028 мг / мл) 9,44 ± 0,16 a

Влияние PE на содержание липидов Pomenate

9 фильтрованный SB значительно снизил содержание триглицеридов по сравнению с контрольной группой ().Однако эффект отфильтрованного SB, полученного из клеток, инкубированных с PE (LGG-T1) или без него (LGG-T0), был аналогичным. Одновременная обработка преадипоцитов мышей 3T3-L1 SB, отфильтрованным через PE и LGG, значительно снизила содержание триглицеридов по сравнению с обработкой только SB, отфильтрованного через LGG. Более того, эти данные свидетельствуют о том, что комбинированное лечение PE и LGG-T1 было наиболее эффективным для снижения содержания триглицеридов и накопления внутриклеточных липидов.

(A) Типичное окрашивание O масляным красным О клеток 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE. (B) Содержание липидов определяли количественно с помощью окрашивания Oil Red O (среднее ± SD , * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с LGG T0 + PE).

Обработка преадипоцитов мышей 3T3-L1 клеточным экстрактом LGG (CE), полученным из клеток, инкубированных с PE (CE + PE) или без него (CE), не оказала влияния на накопление внутриклеточных липидов по сравнению с контрольной группой ( Контроль: ABS 490 нм = 0.200 ± 0,07; CE: ABS 490 нм = 0,187 ± 0,09; CE + PE = ABS 490 нм = 0,190 ± 0,05).

Влияние PE на адипогенные маркеры

Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно менее выражены в клетках 3T3-L1, обработанных SB, отфильтрованным через PE и LGG. В частности, PE, LGG-T0 и LGG-T1 были способны снижать уровни гена адипонектина, PPAR-γ, SREBP, FAS и IL-6 и повышать уровни гена IL-10 ().

(A – F) Анализ экспрессии генов с помощью qRT-PCR липогенного пути в клетках 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE.Результаты выражены как средние значения ± стандартное отклонение четырех экспериментов, выполненных в трех повторностях ( * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с контролем. LGG T0 + PE).

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно снизила уровни экспрессии мРНК основных транскрипционных факторов, участвующих в адипогенезе, по сравнению с обработкой SB, отфильтрованных через LGG ( LGGT0 и LGGT1) отдельно ().

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно увеличила уровни экспрессии мРНК IL10 по сравнению с обработкой только SB (LGGT0 и LGGT1), профильтрованных через LGG ( ). Более того, эти данные свидетельствуют о том, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10 (2).

Обсуждение

Благоприятные эффекты употребления плодов граната и / или сока вызвали значительный научный интерес (Basu and Penugonda, 2009).Многие исследователи сообщают, что полиэтилены, полученные из отходов перерабатывающих предприятий, обладают способностью улавливать свободные радикалы и обладают мощной антиоксидантной способностью (Panichayupakaranant et al., 2010; Fischer et al., 2011). ПЭ, использованный в настоящем исследовании, был растворим в воде и охарактеризован с помощью ВЭЖХ – PDA – ESI / MS n на содержание фенолов и антоцианов. В соответствии с предыдущими сообщениями (Fischer et al., 2011; Qu et al., 2012; Romeo et al., 2015), эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожура), поскольку они составляют более 99% от общего содержания фенольных соединений граната.Основными эллагитаннинами побочных продуктов граната, а также продуктов из граната (фруктов и соков) являются пуникалагины (Gil et al., 2000; Fischer et al., 2011; Qu et al., 2012).

Экстракт граната содержит высокий процент фенольных соединений и проявляет антиоксидантную активность в зависимости от концентрации, как показано для анализа как DPPH, так и анализа поглощения супероксид-анионов.

Сообщалось, что диетические полифенолы растений способны избирательно модулировать рост чувствительных микроорганизмов (Tabasco et al., 2011). Экстракты растений обычно подавляют рост бактерий, но степень эффекта зависит от состава экстракта и типа бактериального штамма.

Результаты, полученные в наших экспериментальных условиях, показали, что высокие концентрации полифенолов граната оказывают противомикробное действие на некоторые штаммы патогенов, такие как L. innocua и S. aureus. Эти результаты согласуются с исследованиями Panichayupakaranant et al. (2010), Fawole et al.(2012) и Su et al. (2012).

Однако при концентрациях PE ниже 0,34 мг / мл, хотя не было обнаружено концентраций ингибирующей активности против пробиотических штаммов, оценивалось только небольшое увеличение роста LGG. Эти результаты не согласуются с исследованиями Li et al. (2015) и Neyrinck et al. (2013), которые продемонстрировали, что полифенолы граната потенциально могут работать как пребиотики.

Ожирение — это состояние, при котором накопление липидов приводит к расширению жировой ткани, которая действует как метаболический и эндокринный орган.Молекулярные механизмы, которые модулируют рост, дифференцировку и липогенез преадипоцитов жировых клеток, были предметом обширных исследований (Vanella et al., 2012; Stechschulte et al., 2014; Moseti et al., 2016; Palmeri et al., 2016; Waldman et al., 2016; Carpene et al., 2018).

Во время дифференцировки адипоцитов преадипоциты дифференцируются в зрелые адипоциты (Lefterova and Lazar, 2009). Повышенное накопление жира сильно коррелирует с количеством клеток и / или размером адипоцитов (Jiang et al., 2008).

Сообщалось, что степень ожирения связана с дифференцировкой преадипоцитов в адипоцитах и ​​с увеличением адипоцитов в жировой ткани (Wang and Jones, 2004).

Другие авторы сообщили, что PEs способны подавлять дифференцировку преадипоцитов и адипогенез и уменьшать жировую дистрофию печени у крыс с ожирением и диабетом 2 типа (Xu et al., 2009).

В соответствии с данными Moon et al. (2012) и Park et al. (2014) в наших экспериментальных условиях PE, LGG-T0 и LGG-T1 приводили к значительному снижению накопления липидов в клетках 3T3-L1 во время дифференцировки в адипоциты, предполагая, что PE, LGG-T0 и LGG-T1 способны подавлять дифференцировка адипоцитов.Однако обработка LGG-фильтрованным SB, полученным из клеток, инкубированных с PE (LGG-T1) или без (LGG-T1), была аналогичной. В наших экспериментальных условиях фактически не наблюдалось пребиотического эффекта, продемонстрированного другими авторами. Более того, комбинированное лечение PE и LGG-T1 было наиболее эффективным в снижении внутриклеточного накопления липидов. Эти данные демонстрируют, что, даже если в наших экспериментальных условиях не наблюдалось пребиотического эффекта, фильтрованный SB, полученный из LGG, инкубированного с PE (LGG-T1), мог бы содержать, помимо полезных бактериальных секретируемых биоактивных соединений, также небольшие количества PE- производные биоактивные соединения.Последний, присутствующий в небольших количествах в LGG-T1, не будет иметь более сильных положительных эффектов, чем LGG-T0, но в сочетании с PE может иметь потенциальные синергетические преимущества для здоровья.

Адипоцит-специфический рецептор-активируемый пролифератором пероксисом-γ (PPARγ) участвует в ранней стадии дифференцировки адипоцитов (Rosen et al., 2000), регулируя экспрессию адипогенных генов, таких как синтаза жирных кислот (FAS) и регуляторный элемент стерола. -связывающие белки (SREBP), а затем запускают накопление жира в клетках (Kawada et al., 2001; Бергер и Моллер, 2002).

Жировая ткань — это не только первичный резервуар жира, но и эндокринный орган, контролирующий гомеостаз липидов. Измененные уровни адипокинов жировой ткани могут способствовать развитию воспаления, что приводит к нарушению липидного обмена (Armani et al., 2010). При хроническом воспалении провоспалительные цитокины, такие как IL-6, активируются, тогда как противовоспалительные цитокины, такие как IL-10, подавляются (Kershaw and Flier, 2004; Bradley et al., 2008; Лира и др., 2012; Лю и др., 2018).

Наши результаты демонстрируют, что комбинированное лечение PE + LGG-T1 значительно снижает уровень мРНК адипонектина, FAS и IL-6 и повышает уровень IL-10.

Можно сделать вывод, что комбинированное лечение PE + LGG-T1 обладает противовоспалительными свойствами и способно ингибировать дифференцировку адипоцитов, модулируя уровни экспрессии ключевых факторов адипогенной транскрипции, участвующих в адипогенезе.

Заключение

SB, отфильтрованный экстрактом граната и LGG, значительно снижал накопление внутриклеточных липидов.Наблюдали синергетический эффект пробиотиков и полифенолов, содержащихся в ПЭ. Более того, наши результаты показали, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10.

Эти результаты свидетельствуют о том, что пробиотики и полифенолы, содержащиеся в ПЭ, могут влиять на адипогенез in vitro. Более того, наши результаты демонстрируют, что синергетические свойства сочетания таких продуктов, как гранат и пробиотики, могут оказывать комбинированное воздействие на здоровье.

Тогда гранат и пробиотики, такие как штамм LGG, могут внести свой вклад в разработку новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Вклад авторов

VS, LV, CR, CC, FR и GB собрали исследовательские статьи, разработали эксперименты, проанализировали результаты и написали рукопись. CR, MR, SF и NT проводили эксперименты.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Источники

  • Аль-Зореки Н.С. (2009). Антимикробная активность кожуры плодов граната ( Punica granatum L.). Внутр. J. Food Microbiol. 134 244–248. 10.1016 / j.ijfoodmicro.2009.07.002 [PubMed] [CrossRef] [Google Scholar]
  • Армани А., Мамми К., Марцолла В., Каланчини М., Антелми А., Розано Г. М. и др. (2010). Клеточные модели для понимания адипогенеза, дисфункции жировой ткани и ожирения. J. Cell Biochem. 110 564–572.10.1002 / jcb.22598 [PubMed] [CrossRef] [Google Scholar]
  • Барбагалло И., Ли Вольти Г., Сорренти В., Ди Джакомо К., Аквавива Р., Раффаэле М. и др. (2017). Фенетиловый эфир кофейной кислоты восстанавливает экспрессию гена адипоцитов после обработки липополисахаридом. Lett. Drug Des. Discov. 14 481–487. 10.2174 / 1570180813666160

    4707 [CrossRef] [Google Scholar]

  • Бассири-Джахроми С. (2018). Активность Punica granatum (граната) в укреплении здоровья и профилактике рака. Онкол. Сборка 12: 345. 10.4081 / онкол.2018.345 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Басу А., Пенугонда К. (2009). Гранатовый сок: фруктовый сок, полезный для сердца. Nutr. Сборка 67 49–56. 10.1111 / j.1753-4887.2008.00133.x [PubMed] [CrossRef] [Google Scholar]
  • Бергер Дж., Моллер Д. Э. (2002). Механизмы действия PPAR. Annu. Rev. Med. 53 409–435. 10.1146 / annurev.med.53.082901.104018 [PubMed] [CrossRef] [Google Scholar]
  • Bialonska D., Касимсетти С. Г., Шредер К. К., Феррейра Д. (2009). Влияние побочных продуктов граната ( Punica granatum L.) и эллагитаннинов на рост кишечных бактерий человека. J. Agric. Food Chem. 57 год 8344–8349. 10.1021 / jf

    1b [PubMed] [CrossRef] [Google Scholar]

  • Бялонска Д., Рамнани П., Касимсетти С. Г., Мунта К. Р., Гибсон Г. Р., Феррейра Д. (2010). Влияние побочного продукта граната и пуникалагинов на отдельные группы кишечной микробиоты человека. Внутр.J. Food Microbiol. 140 175–182. 10.1016 / j.ijfoodmicro.2010.03.038 [PubMed] [CrossRef] [Google Scholar]
  • Брэдли Р. Л., Фишер Ф. Ф., Маратос-Флиер Э. (2008). Пищевые жирные кислоты по-разному регулируют продукцию TNF-альфа и IL-10 адипоцитами 3T3-L1 мышей. Ожирение 16 938–944. 10.1038 / обы.2008.39 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Карпен К., Пеженауте Х., Дель Мораль Р., Буле Н., Хихона Э., Андраде Ф. и др. (2018). Диетический антиоксидант пицеатаннол подавляет адипогенез мезенхимальных стволовых клеток жировой ткани человека и ограничивает транспорт глюкозы и липогенную активность в адипоцитах. Внутр. J. Mol. Sci. 19: E2081. 10.3390 / ijms181 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Дхумал С., Карале А. Р., Джадхав С. Б., Кад В. П. (2014). Последние достижения и разработки в области обработки и использования граната: обзор. J. Agric. Crop Sci. 1 1–17. [Google Scholar]
  • Ди Джакомо К., Ванелла Л., Сорренти В., Сантанджело Р., Барбагалло И., Калабрезе Г. и др. (2015). Эффекты tithonia diversifolia (Hemsl.) A.Серый экстракт о дифференцировке адипоцитов мезенхимальных стволовых клеток человека. PLoS One 10: e0122320. 10.1371 / journal.pone.0122320 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Фаволе О. А., Макунга Н. П., Опара Ю. Л. (2012). Метанольный экстракт кожуры плодов граната обладает антибактериальной, антиоксидантной и ингибирующей тирозиназой активностью. BMC Дополнение. Альтерн. Med. 12: 200. 10.1186 / 1472-6882-12-200 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Fischer U.А., Карл Р., Каммерер Д. Р. (2011). Идентификация и количественное определение фенольных соединений из кожуры граната ( Punica granatum L.), мезокарпа, арил и других соков с помощью HPLC-DAD-ESI / MS (n). Food Chem. 127 807–821. 10.1016 / j.foodchem.2010.12.156 [PubMed] [CrossRef] [Google Scholar]
  • Гил М. И., Томас-Барберан Ф. А., Хесс-Пирс Б., Холкрофт Д. М., Кадер А. А. (2000). Антиоксидантная активность гранатового сока и ее связь с фенольным составом и обработкой. J. Agric. Food Chem. 48 4581–4589. [PubMed] [Google Scholar]
  • Хоссин Ф. Л. А. (2009). Воздействие кожуры граната (Punica granatum) и его экстракта на крыс с ожирением и гиперхолестеринемией. Пак. J. Nutr. 8 1251–1257. 10.3923 / pjn.2009.1251.1257 [CrossRef] [Google Scholar]
  • Jiang L., Zhang N. X., Mo W., Wan R., Ma C. G., Li X., et al. (2008). Ремания подавляет дифференцировку адипоцитов и адипогенез. Biochem. Биофиз. Res. Commun. 371 185–190.10.1016 / j.bbrc.2008.03.129 [PubMed] [CrossRef] [Google Scholar]
  • Кавада Т., Такахаши Н., Фушики Т. (2001). Биохимические и физиологические характеристики жировой клетки. J. Nutr. Sci. Витаминол. 47 1–12. [PubMed] [Google Scholar]
  • Кершоу Э. Э., Флиер Дж. С. (2004). Жировая ткань как эндокринный орган. J. Clin. Эндокринол. Метаб. 89 2548–2556. 10.1210 / jc.2004-0395 [PubMed] [CrossRef] [Google Scholar]
  • Ким С. Х., Плутцки Дж. (2016). Бурый жир и потемнение для лечения ожирения и связанных с ним нарушений обмена веществ. Diabetes Metab. J. 40 12–21. 10.4093 / dmj.2016.40.1.12 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лай С., Цай М. Л., Бадмаев В., Хименес М., Хо К. Т., Пан М. Х. (2012). Ксантиген подавляет дифференцировку преадипоцитов и адипогенез за счет подавления PPARgamma и C / EBP и модуляции путей SIRT-1, AMPK и FoxO. J. Agric. Food Chem. 60 1094–1101. 10.1021 / jf204862d [PubMed] [CrossRef] [Google Scholar]
  • Ли К.Дж., Чен Л. Г., Лян В. Л., Ван К. С. (2010). Противовоспалительное действие punica granatum Linne in vitro и in vivo. Food Chem. 118 315–322. [Google Scholar]
  • Лефтерова М. И., Лазарь М. А. (2009). Новые разработки в адипогенезе. Trends Endocrinol. Метаб. 20 107–114. 10.1016 / j.tem.2008.11.005 [PubMed] [CrossRef] [Google Scholar]
  • Лес Ф., Арбонес-Майнар Дж. М., Валеро М. С., Лопес В. (2018). Полифенолы граната и уролитин А ингибируют альфа-глюкозидазу, дипептидилпептидазу-4, липазу, накопление триглицеридов и гены, связанные с адипогенезом, в адипоцитоподобных клетках 3T3-L1. J. Ethnopharmacol. 220 67–74. 10.1016 / j.jep.2018.03.029 [PubMed] [CrossRef] [Google Scholar]
  • Ли Ю. Ф., Го К. Дж., Ян Дж. Дж., Вэй Дж. Ю., Сюй Дж., Ченг С. (2006). Оценка антиоксидантных свойств экстракта кожуры граната по сравнению с экстрактом мякоти граната. Food Chem. 96 254–260. [Google Scholar]
  • Ли З., Сумманен П. Х., Комория Т., Хеннинг С. М., Ли Р. П., Карлсон Э. и др. (2015). Эллагитаннины граната стимулируют рост кишечных бактерий in vitro: влияние на пребиотические и метаболические эффекты. Анаэроб 34 164–168. 10.1016 / j.anaerobe.2015.05.012 [PubMed] [CrossRef] [Google Scholar]
  • Лин Л. Т., Чен Т. Ю., Лин С. С., Чунг С. Ю., Лин Т. К., Ван Г. Х. и др. (2013). Широкий спектр противовирусной активности хебулаговой кислоты и пуникалагина против вирусов, которые используют гликозаминогликаны для проникновения. BMC Microbiol. 13: 187. 10.1186 / 1471-2180-13-187 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Lira F. S., Rosa J. C., Pimentel G. D., Seelaender M., Дамасо А. Р., Ояма Л. М. и др. (2012). И адипонектин, и интерлейкин-10 ингибируют LPS-индуцированную активацию пути NF-kappaB в адипоцитах 3T3-L1. Цитокин 57 год 98–106. 10.1016 / j.cyto.2011.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Лю Ю., Сюй Д., Инь С., Ван С., Ван М., Сяо Ю. (2018). Уровень IL-10 / STAT3 снижается при детском ожирении с гипертриглицеридемией и связан с уровнем триглицеридов у крыс с ожирением, вызванным диетой. BMC Endocr. Disord. 18:39.10.1186 / s12902-018-0265-z [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Moon Y. J., Soh J. R., Yu J. J., Sohn H. S., Cha Y. S., Oh S. H. (2012). Эффект ингибирования внутриклеточного накопления липидов Weissella koreensis OK1-6, выделенного из Kimchi, на дифференцировку адипоцитов. J. Appl. Microbiol. 113 652–658. 10.1111 / j.1365-2672.2012.05348.x [PubMed] [CrossRef] [Google Scholar]
  • Мосети Д., Регасса А., Ким В. К. (2016). Молекулярная регуляция адипогенеза и потенциальные антиадипогенные биоактивные молекулы. Внутр. J. Mol. Sci. 17: E124. 10.3390 / ijms17010124 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Нейринк А. М., Ван Хи В. Ф., Биндельс Л. Б., Де Бакер Ф., Кани П. Д., Делзен Н. М. (2013). Богатый полифенолами экстракт кожуры граната облегчает воспаление тканей и гиперхолестеринемию у мышей с ожирением, вызванных диетой с высоким содержанием жиров: потенциальное влияние на микробиоту кишечника. руб. J. Nutr. 109 802–809. 10.1017 / S0007114512002206 [PubMed] [CrossRef] [Google Scholar]
  • Палмери Р., Монтелеоне Дж. И., Спанья Г., Рестучча К., Раффаэле М., Ванелла Л. и др. (2016). Экстракт оливковых листьев сицилийского сорта уменьшал накопление липидов, вызывая термогенный путь во время адипогенеза. Фронт. Pharmacol. 7: 143. 10.3389 / fphar.2016.00143 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Panichayupakaranant P., Tewtrakul S., Yuenyongsawad S. (2010). Антибактериальное, противовоспалительное и противоаллергическое действие стандартизированного экстракта кожуры граната. Food Chem. 123 400–403. 10.1055 / s-0030-1264706 [CrossRef] [Google Scholar]
  • Парк Дж. Э., О С. Х., Ча Ю. С. (2014). Lactobacillus brevis OPK-3, выделенный из кимчи, подавляет адипогенез и оказывает противовоспалительное действие в адипоцитах 3T3-L1. J. Sci. Продовольственное сельское хозяйство. 94 2514–2520. 10.1002 / jsfa.6588 [PubMed] [CrossRef] [Google Scholar]
  • Ку В., Брекса III А. П., Пан З., Ма Х. (2012). Количественное определение основных составляющих полифенолов в продуктах из граната. Food Chem. 132 1585–1591. 10.1016 / j.foodchem.2011.11.106 [PubMed] [CrossRef] [Google Scholar]
  • Раффаэле М., Барбагалло И., Ликари М., Карота Г., Сферраццо Г., Спампинато М. и др. (2018). N-ацетилцистеин (NAC) улучшает липидную метаболическую дисфункцию в адипоцитах, происходящих из стромальных клеток костного мозга. Evid. На основе дополнения. Альтерн. Med. 2018: 9. 10.1155 / 2018/5310961 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Редди М. К., Гупта С.К., Джейкоб М. Р., Хан С. И., Феррейра Д. (2007). Антиоксидантное, противомалярийное и противомикробное действие богатых танинами фракций, эллагитаннинов и фенольных кислот из Punica granatum L. Planta Med. 73 461–467. 10.1055 / с-2007-967167 [PubMed] [CrossRef] [Google Scholar]
  • Ромео Ф. В., Баллистрери Г., Фаброни С., Пангалло С., Никосия М. Г., Шена Л. и др. (2015). Химическая характеристика различных экстрактов сумаха и граната, эффективных против гнили Botrytis cinerea. Молекулы 20 11941–11958. 10,3390 / молекул 200711941 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Розен Э. Д., Уолки К. Дж., Пучсервер П., Шпигельман Б. М. (2000). Транскрипционная регуляция адипогенеза. Genes Dev. 14 1293–1307. [PubMed] [Google Scholar]
  • Салерно Л., Модика М. Н., Ромео Г., Питтала В., Сиракуза М. А., Амато М. Э. и др. (2012). Новые ингибиторы синтазы оксида азота с антиоксидантными свойствами. Eur.J. Med. Chem. 49 118–126. 10.1016 / j.ejmech.2012.01.002 [PubMed] [CrossRef] [Google Scholar]
  • Синглтон В. Л., Ортофер Р., Ламуэла-Равентос Р. М. (1999). Анализ общих фенолов и других субстратов окисления и антиоксидантов с помощью реактива Фолина – Чокальто. Methods Enzymol. 299 152–178. 10.1016 / S0076-6879 (99) 99017-1 [CrossRef] [Google Scholar]
  • Смит К. Б., Смит М. С. (2016). Статистика ожирения. Prim Care 43 год 121–135. 10.1016 / j.поп.2015.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Stechschulte L.A., Хайндс Т.Д., мл., Худер С.С., Шоу В., Наджар С.М., Санчес Э.Р. (2014). FKBP51 контролирует клеточный адипогенез посредством опосредованного p38 киназой фосфорилирования GRalpha и PPARgamma. Мол. Эндокринол. 28 год 1265–1275. 10.1210 / мне.2014-1022 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Su X., Howell A. B., D’Souza D. H. (2012). Антибактериальные эффекты растительных экстрактов на устойчивый к метициллину Staphylococcus aureus. Пищевой патоген. Дис. 9 573–578. 10.1089 / fpd.2011.1046 [PubMed] [CrossRef] [Google Scholar]
  • Табаско Р., Санчес-Патан Ф., Монагас М., Бартоломе Б., Виктория Морено-Аррибас М., Пелаез К. и др. (2011). Влияние полифенолов винограда на рост молочнокислых бактерий и бифидобактерий: устойчивость и метаболизм. Food Microbiol. 28 год 1345–1352. 10.1016 / j.fm.2011.06.005 [PubMed] [CrossRef] [Google Scholar]
  • Тегеранифар А., Селахварзи Ю., Харрази М., Бахш В.J. (2011). Высокий потенциал побочных продуктов агропромышленного производства граната ( Punica granatum L.) как мощных противогрибковых и антиоксидантных веществ. Инд. Сельскохозяйственные культуры 34 1523–1527. 10.1016 / j.indcrop.2011.05.007 [CrossRef] [Google Scholar]
  • Ванелла Л., Барбагалло И., Аквавива Р., Ди Джакомо К., Кардил В., Абрахам Н. Г. и др. (2013a). Эллаговая кислота: цитодифференцирующие и антипролиферативные эффекты в клеточных линиях рака предстательной железы человека. Curr. Pharm.Des. 19 2728–2736. [PubMed] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Кардил В., Ким Д. Х. и др. (2013b). Маркеры апоптоза в клеточной линии рака простаты: эффект эллаговой кислоты. Онкол. Реп. 30 2804–2810. 10.3892 / или 2013.2757 [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Ли Вольти Г., Кардил В. и др. (2013c). Влияние эллаговой кислоты на ангиогенные факторы в клетках рака простаты. Раки 5 726–738. 10.3390 / раки5020726 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Сэнфорд К., мл., Ким Д. Х., Абрахам Н. Г., Эбрахейм Н. (2012). Окислительный стресс и гемоксигеназа-1 регулируют дифференцировку мезенхимальных стволовых клеток человека. Внутр. J. Hypertens. 2012: 8. 10.1155 / 2012/8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Waldman M., Bellner L., Vanella L., Schragenheim J., Sodhi K., Singh S.P., et al. (2016). Эпоксиэйкозатриеновые кислоты регулируют дифференцировку адипоцитов клеток 3T3 мыши посредством активации PGC-1alpha, которая необходима для экспрессии HO-1 и увеличения функции митохондрий. Stem Cells Dev. 25 1084–1094. 10.1089 / scd.2016.0072 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Wang Y. W., Jones P. J. (2004). Конъюгированная линолевая кислота и контроль ожирения: эффективность и механизмы. Внутр. J. Obes. Relat. Метаб. Disord. 28 год 941–955.10.1038 / sj.ijo.0802641 [PubMed] [CrossRef] [Google Scholar]
  • Сюй К. З., Чжу К., Ким М. С., Ямахара Дж., Ли Ю. (2009). Цветок граната уменьшает ожирение печени у животных с диабетом 2 типа и ожирением. J. Ethnopharmacol. 123 280–287. 10.1016 / j.jep.2009.03.035 [PubMed] [CrossRef] [Google Scholar]

Положительное влияние экстракта кожуры граната и пробиотиков на преадипоцитную дифференцировку

Front Microbiol. 2019; 10: 660.

Валерия Сорренти

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия

Cinzia Lucia Randazzo

2 Dipaziena Di мы Università di Catania, Катания, Италия

Cinzia Caggia

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

Габриэле

, Совет по экономическим исследованиям, Габриэле, ) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Флора Валерия Ромео

3 Совет сельскохозяйственных исследований и экономики (CREA) — Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Симона Фаброни

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр оливок и цитрусовых and Tree Fruit, Ачиреале, Италия

Николина Тимпанаро

3 Совет по сельскохозяйственным исследованиям и экономике (CREA) — Исследовательский центр олив, цитрусовых и древесных фруктов, Ачиреале, Италия

Марко Рафаэле

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

Luca Vanella

1 Dipartimento di Scienze del Farmaco, Sezione di Biochimica, Università di Catania, Catania, Италия

85

Farmaco, Sezione di Biochimica, Università di Catania, Катания, Италия

2 Dipartimento di Agricoltura, Alimentazione e Ambiente — Di3A, Università di Catania, Катания, Италия

3 (CREA) Совет по сельскохозяйственным исследованиям и экономическим исследованиям Исследовательский центр оливок, цитрусовых и древесных фруктов, Ачиреале, Италия

Редактор: Розальба Ланчотти, Болонский университет, Италия 90 005

Рецензент: Анна Реале, Институт науки и технологий (ISA), Италия; Коши Филип, Малайский университет, Малайзия

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы микробиологии»

Поступила в редакцию 22 октября 2018 г .; Принята в печать 15 марта 2019 г.

Авторские права © 2019 Сорренти, Рандаццо, Каджия, Баллистрери, Ромео, Фаброни, Тимпанаро, Раффаэле и Ванелла.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя (ов) и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Благоприятные эффекты граната обусловлены содержанием эллагитаннинов и антоцианов, которые защищают от множества заболеваний, включая воспалительные. Многие исследователи сообщают, что экстракты отходов граната (кожуры и семян), полученные из отходов промышленной переработки, обладают акцептором свободных радикалов и обладают мощной антиоксидантной способностью. Также сообщалось, что экстракты граната (ПЭ) обладают антибактериальной, противовирусной, гиполипидемической и противовоспалительной биоактивностью благодаря содержанию полифенольных соединений, включая пуникалагины, галловую кислоту и производные эллаговой кислоты.В центре внимания данной рукописи было изучение пребиотического потенциала PE, растворимого в воде и охарактеризованного с помощью HPLC – PDA – ESI / MS n на предмет его фенольного содержания. Более того, поскольку сообщалось, что экстракты граната снижали уровень липидов в крови и что было показано, что ряд пробиотических штаммов влияет на адипогенез в культуре клеток, это исследование также было выполнено для проверки in vitro эффектов PE и пробиотик L.rhamnosus GG ATCC 53103 (LGG) на линии клеток 3T3-L1. PE и пробиотики существенно снижали содержание триглицеридов и увеличение внутриклеточных липидов по сравнению с контрольной группой. Однако комбинированная обработка отработанного бульона (SB), отфильтрованного через PE и LGG, была наиболее эффективной для снижения содержания триглицеридов и накопления внутриклеточных липидов. Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были существенно ниже в клетках 3T3-L1, обработанных PE и SB, отфильтрованных через LGG.Эти результаты свидетельствуют о том, что синергетический эффект пробиотиков и полифенолов, содержащихся в PE, может влиять на адипогенез in vitro и , а также может способствовать разработке новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Ключевые слова: лактобациллы, антимикробная активность, экстракт граната, дифференциация адипоцитов, комбинирование продуктов

Введение

Гранат — плод, положительное влияние которого на здоровье было тщательно изучено.Этот фрукт богат биологически активными соединениями, такими как эллагитаннины и антоцианы, которые защищают от дегенеративных заболеваний. Плод граната из-за его высокой питательной ценности, пользы для здоровья и биоактивных антиоксидантных соединений считается пищевым лекарством. Фактически, гранат широко используется в фитотерапии при нескольких патологиях, включая грипп и инфекции верхних дыхательных путей. Все части плодов граната, то есть кожура и семена, рассматриваемые как отходы, могут быть переработаны для получения продуктов с добавленной стоимостью, имеющих промышленную, медицинскую и косметическую ценность (Dhumal et al., 2014).

Отходы граната образуются на всех этапах жизненного цикла плодов, то есть во время сельскохозяйственного производства, промышленного производства и переработки. Можно использовать побочные продукты граната, поскольку они являются богатым источником биологически активных соединений, таких как флавоноиды, фенольные кислоты и дубильные вещества. Более того, многие исследователи описали, что экстракты граната, полученные из побочных продуктов перерабатывающих заводов, обладают эффективным улавливанием свободных радикалов и антиоксидантной способностью (Lee et al., 2010; Panichayupakaranant et al., 2010; Fischer et al., 2011).

Кроме того, экстракты граната действуют как естественные ингибиторы патогенов, бактерий и грибов (Al-Zoreky, 2009; Tehranifar et al., 2011; Romeo et al., 2015).

Эллагитаннины граната гидролизуются микробиотой кишечника до более мелких фенольных соединений, таких как эллаговая кислота. Затем эллаговая кислота всасывается в кровоток, в то время как эллагитанины не всасываются и метаболизируются в уролитины.

Сообщалось, что побочные продукты граната и пуникалагины в значительной степени способны подавлять рост патогенных бактерий Escherichia coli , Pseudomonas aeruginosa , Clostridia и Staphylococcus aureus (Reddy et al., 2007; Bialonska et al., 2009) и для увеличения роста полезных бактерий, включая Bifidobacterium spp. и Lactobacillus spp. (Reddy et al., 2007; Bialonska et al., 2010).

Экстракты граната также снижают уровень липидов в крови и обладают значительной противоопухолевой, противовирусной и противовоспалительной активностью (Li et al., 2006; Hossin, 2009; Lin et al., 2013; Bassiri- Джахроми, 2018).

Эти потенциальные полезные эффекты приписываются полифенольным соединениям, которые содержатся в экстрактах граната, включая пуникалагины, галловую кислоту и производные эллаговой кислоты (Vanella et al., 2013а, б, в; Romeo et al., 2015).

Поскольку ожирение является одной из основных проблем общественного здравоохранения, необходимы новые превентивные стратегии (Smith and Smith, 2016).

Адипоциты играют важную роль в начале или развитии метаболических осложнений, связанных с ожирением, таких как метаболический синдром и диабетические осложнения (Kim and Plutzky, 2016).

Интерес исследователей к выявлению натуральных продуктов, полученных из диетических растений, обладающих активностью против ожирения, возрос.Сообщалось, что ксантиген и фукоксантин, природные соединения масла косточек граната, значительно подавляли дифференцировку адипоцитов и накопление липидов (Lai et al., 2012).

Настоящая рукопись посвящена прежде всего изучению антиоксидантной и антимикробной активности, а также пребиотического потенциала ПЭ, богатого фенольными соединениями. Более того, обогащенный стандартизованный полиэтилен, содержащий высокий процент природных антиоксидантов граната, был химически охарактеризован с помощью ВЭЖХ – PDA – ESI / MSn.Во-вторых, поскольку гранатовый сок (Les et al., 2018) и различные типы экстрактов граната (PE), включая экстракт, полученный из цельного фрукта (Li et al., 2015), и экстракт, полученный из кожуры граната (Neyrinck et al., 2013), и было показано, что ряд пробиотических штаммов (Moon et al., 2012; Park et al., 2014) влияют на адипогенез, это исследование было проведено для проверки in vitro эффектов PE, пробиотика L rhamnosus GG ATCC 53103 (LGG), предварительно инкубированные с PE, отдельно или в комбинации, при дифференцировке клеток 3T3-L1.

Материалы и методы

Химические вещества

Порошкообразный экстракт граната (Dermogranate ® ), использованный в этом исследовании, был предоставлен Medinutrex (Катания, Италия). Вкратце, экстракт готовили из сушеных и измельченных плодов граната, смешанных с водно-спиртовыми растворами (пищевой), а затем фильтровали. Фильтрат концентрировали и затем сушили распылением для получения стандартизованного экстракта. Экстракт Dermogranate ® имел следующий химический состав: общие полифенолы (16%), пуникалагины (8%), эллаговая кислота и производные (8%).

Реагент Фолина – Чокальтеу (FCR), карбонат натрия (Na 2 CO 3 ), галловая кислота, пуникалин (смесь аномеров), пуникалагин и эллаговая кислота были приобретены у Sigma-Aldrich (Милан, Италия). Гранатин Б был приобретен у LGC Standards (Лондон, Великобритания). Для хроматографии использовали растворители чистоты для ВЭЖХ – МС (Merck KgaA, Дармштадт, Германия), а все остальные реагенты были аналитической чистоты.

Определение общего содержания полифенолов

Анализ Folin – Ciocalteu (Singleton et al., 1999) был использован для определения общего содержания полифенолов с небольшими изменениями. 0,1 мг / мл экстракта растворяли в дистиллированной воде. Затем к 500 мкл образца добавляли 5 мл 10% FCR и 4,5 мл раствора Na 2 CO 3 (7,5% мас. / Об.). Конечный раствор перемешивали в течение 2 часов в темноте, а затем измеряли Abs при λ = 765 нм. Анализы проводили в трех экземплярах, и общую концентрацию полифенолов выражали в граммах эквивалентов галловой кислоты (GAE) / 100 г экстракта.

HPLC – PDA – ESI / MS

n Анализ фенольных соединений

Разделение и количественное определение фенольных соединений выполняли, как описано ранее (Romeo et al., 2015). Для идентификации фенольных соединений времена удерживания (RT), спектры и данные МС в режиме отрицательного ESI сравнивали с данными аутентичных стандартов. Количественное определение каждого фенольного соединения проводили с использованием соответствующего стандарта в качестве внешнего стандарта. Количественное определение галловой кислоты проводили при 280 нм.Пуникалины, гранатин В, пуникалагины и эллаговая кислота определялись количественно при 378 нм; та же длина волны использовалась для количественного определения производных эллаговой кислоты с использованием эллаговой кислоты в качестве стандарта сравнения. Анализы проводили в трех экземплярах, и результаты выражали в г соединения / 100 г экстракта.

Тушение DPPH

Способность улавливать свободные радикалы различных концентраций экстракта PE (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) измеряли по 2, Безрадикальный метод 2-дифенил-1-пикрилгидразилгидрата (DPPH), как сообщалось ранее (Salerno et al., 2012). Результаты выражены в процентах от степени ингибирования ± SD .

Влияние поглотителя на супероксид-анион

Способность экстракт ПЭ различных концентраций улавливать супероксид-анион (3,4–1,7–0,85–0,56–0,42–0,34–0,21–0,17–0,11–0,085–0,028 мг / мл) определялась как сообщалось ранее (Салерно и др., 2012). Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Мышиные преадипоциты 3T3-L1 Жизнеспособность клеток

Мышиные преадипоциты 3T3-L1 были приобретены в Американской коллекции типовых культур (Роквилл, Мэриленд, США).Клетки высевали в концентрации 2 × 10 5 клеток на лунку 96-луночного микропланшета и культивировали при 37 ° C в инкубаторе с 5% CO 2 в течение 48 часов в отсутствие и в присутствии различных концентраций ЧП сообщалось выше. Жизнеспособность клеток измеряли с помощью анализа МТТ, как сообщалось ранее (Di Giacomo et al., 2015). МТТ, желтый тетразол, в живых клетках восстанавливается до пурпурного формазана. Результаты выражены в процентах формазана, продуцированного в обработанных мышиных преадипоцитах 3T3-L1, по сравнению с необработанными клетками.

Микробиология

Культивирование бактерий

Использовали коммерческие штаммы патогенов E. coli ATCC 25922, S. aureus ATCC 29213, Listeria innocua ATCC 33090 и Salmonella enterica ATCC 14028. Штамм E. coli выращивали в бульоне Лурия-Бертани (LB) при 37 ° C в течение ночи; S. aureus , S. enterica и L. innocua обычно выращивали в течение ночи в триптон-соевом бульоне (TSB) при 37 и 30 ° C соответственно.Все материалы и приложения предоставлены Oxoid (Милан, Италия).

Коммерческие пробиотические штаммы LGG, Bifidobacterium animalis BB12, B. longum BB536 и дикий штамм Lactobacillus paracasei N 24, выделенные из кротонского сыра пекорино, культивировали в бульоне Демана – Рогоза – Шарпа (MRS). при 37 ° C в течение ночи.

Ночные бактериальные культуры инкубировали при 37 ° C в течение 24 часов в анаэробных условиях, пока они не достигли плотности клеток приблизительно 1.0 × 10 9 КОЕ / мл.

Определение скорости роста

На основании результатов, полученных по активности PE в качестве акцептора свободных радикалов, и экспериментов по жизнеспособности преадипоцитов мышей 3T3-L1, для обработки штаммов пробиотиков или патогенов, как описано ниже, использовали различные концентрации.

Антимикробная активность PE оценивалась в отношении коммерческих штаммов патогенов, упомянутых выше. Ночные культуры патогенов совместно культивировали при 37 ° C в течение 24 ч с PE в различных концентрациях (1.7–0,34–0,17 мг / мл), а антимикробную активность оценивали подсчетом живых бактерий на чашках и выражали в КОЕ / мл.

Влияние PE на рост пробиотических штаммов, упомянутых выше, оценивали при совместном культивировании пробиотических штаммов с плотностью клеток приблизительно 1,0 × 10 9 КОЕ / мл с PE в различных концентрациях (0,085–0,042– 0,028 мг / мл). Влияние экстракта на рост пробиотических штаммов оценивали после инкубации при 37 ° C в течение 24 часов в анаэробных условиях путем посева на чашки живых бактерий и выражали в КОЕ / мл.

Все эксперименты проводились в двух экземплярах, а результаты выражались в виде средних значений и стандартного отклонения. Основываясь на предварительных результатах, для последующих анализов была выбрана LGG.

Свежие бульонные культуры центрифугировали при 5000 об / мин в течение 10 минут при 4 ° C, супернатант декантировали для сбора отработанного бульона (SB), который фильтровали (FSB) с использованием фильтра 0,22 мкм и затем использовали для дальнейшего использования. анализы.

Бактериальный осадок ресуспендировали в 1 мл PBS и пять раз обрабатывали ультразвуком с амплитудой 44% в течение 2 мин с 6 мин отдыха.Затем обработанный ультразвуком центрифугировали при 1100 × g в течение 15 мин при 4 ° C. Супернатант собирали, фильтровали через фильтр 0,22 мкм и меченный экстракт бактериальных клеток (CE). CE использовался для дальнейшего анализа.

Культура клеток и дифференцировка клеток адипоцитов

Преадипоциты мышей 3T3-L1 ресуспендировали в среде Игла, модифицированной по Дульбекко (DMEM), содержащей 10% фетальной бычьей сыворотки (FBS, Invitrogen, Карлсбад, Калифорния, США) и 1% антибиотика. / антимикотический раствор (Invitrogen, Карлсбад, Калифорния, США) и высевали в колбу размером 75 см 2 при плотности от 1 до 2 × 10 4 клеток.Дифференцировку клеток адипоцитов получали, как сообщалось ранее (Waldman et al., 2016).

Дифференцирующиеся преадипоциты 3T3-L1 обрабатывали в течение 7 дней PE (0,028 мг / мл), LGG CE (25 мкг / мл) и SB, профильтрованным через LGG (10 мкг / мл) из ночной бактериальной культуры, инкубированной с или без ПЭ (0,028 мг / мл).

Количественное определение содержания липидов

Для количественной оценки накопления липидов проводили масляное красное окрашивание, как сообщалось ранее (Barbagallo et al., 2017). Образование липидных капель измеряли с помощью инвертированного многоканального светодиодного флуоресцентного микроскопа (Evos, Life Technologies, Гранд-Айленд, Нью-Йорк, США).

Экстракция РНК и qRT-PCR

Экспрессии адипонектина, PPAR-γ, SREBP, FAS, IL-6 и IL-10 оценивали с помощью ПЦР в реальном времени. РНК экстрагировали и количественно оценивали, как сообщалось ранее (Raffaele et al., 2018). Использовали соответствующие последовательности праймеров (). Относительный уровень экспрессии мРНК измеряли по значению порогового цикла (Ct) каждого продукта ПЦР и нормализовали с таковым для GAPDH с использованием сравнительного метода 2 -ΔΔCt .

Таблица 1

ПЦР-праймеров, использованных в этом исследовании.

Gene Прямой праймер Обратный праймер
Адипонектин GAAGCCGCTTATGTGTATCGC GAATGGGTACATTGGGAACAGT
IL-6 TTCCTCTCTGCAAGAGACTTCC AGGAGAGCATTGGAAATTGGGG
FAS GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
GAPDH AGCTTCGGCACATATTTCATCTG CGTTCACTCCCATGACAAACA
IL-10 GCTGGACAACATACTGCTAACC ATTTCCGATAAGGCTTGGCAA
SREBP-1 GATGTGCGAACTGGACACAG CATAGGGGGCGTCAAACAG
PPAR-γ TCGCTGATGCACTGCCTATG ACCTGATGGCATTGTGAGACAT

Статистический анализ

Статистический анализ множественных сравнений был выполнен e Метод Фишера. P — значения ниже 0,05 были приняты как значимые. Данные были проанализированы с использованием либо однофакторного дисперсионного анализа (ANOVA) для нескольких групп, либо непарного t -теста для двух групп, и результаты представлены в виде среднего значения ± стандартное отклонение.

Результаты

HPLC – PDA – ESI / MS

n Анализ PE

Фенольный профиль PE () включал определение 1 гидроксибензойной кислоты и 19 эллагитаннинов. Основные пики соответствовали пуникалину (пик 4), гранатину B (пик 6), пуникалагину A и B (пики 10 и 14) и эллаговой кислоте (пик 19) ().Выявлено также присутствие галловой кислоты (пик 1) и производных эллаговой кислоты (пики 2, 3, 5, 7–9, 11–13, 15–18, 20). Как показано на хроматограмме, эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожуры), поскольку они составляют более 99% от общего содержания фенольных соединений граната. Пуникалагины, основные эллагитаннины побочных продуктов граната, составляют 47,6% от общего содержания фенольных соединений в ПЭ (). Производные эллаговой кислоты, эллаговая кислота и другие второстепенные фенольные соединения (пуникалин, гранатин B и галловая кислота) составили 38.4, 10,2 и 3,8% от общего содержания фенолов в ПЭ соответственно ().

ВЭЖХ-хроматограмма фенольных соединений ПЭ, обнаруженных при 378 нм. Об идентификации пиков см.

Таблица 2

Список пиков и количественное определение фенольных соединений в ПЭ.

907 0,07 907 907 907 0,07 907 907 909 ± 0,04 98 6 7

9 9,5

9 905 909 0,09 909 909 7 7 8 7

9

7

9 35,498 Ead d

9099 7.82

907 907 907 9024 9099 907 907 907 907 907 907 907 907
Номер пика a RT (мин) λ ​​(нм) [M – H] ( м / z ) MS n ( м / z ) Фенольные соединения г / 100 г b
1 3.9 269,310 169 125 Кислота галловая 0,07 ± 0,02
2 4,1 255,364 301 3 7,0 255,363 301 Ead d 0,41 ± 0,04
4 7,3 263,364
5 8,4 264,366 301 Ead d 0,19 ± 0,09
Гранатин B 0,28 ± 0,03
7 10,4 259,361 301 Ead d 0,02 ± 0,01 257,360 301 Ead d 0,05 ± 0,01
9 ​​ 13,5 256,362 0,07 0,07 909 0,07 EAD
10 14,0 258,378 1083 781/601 Пуникалагин А 3,05 ± 0,05
11 15,1 0.13 ± 0,09
12 15,9 257,361 301 Ead d 0,95 ± 0,03
13 9
13 4 Ead d 2,69 ± 0,11
14 17,7 257,378 1083 781/601 Пуникалагин 18 98 7 ± 0,21 257,362 301 Ead d 0,12 ± 0,01
16 25,2 256,363 0,163 0,12 9 0,07 909 0,07 909 0,07
17 29,3 254,361 301 Ead d 0,17 ± 0,01
18 32,2 99 9028 0.08 ± 0,03
19 33,6 256,367 301 229/185 Эллаговая кислота 1,68 ± 0,01
20
20 0,08 ± 0,02
Всего полифенолов c 16,48 ± 2,49
Производные эллаговой кислоты 6,31
Эллаговая кислота 0,62
Итого 16.43

Масс-спектрометрические свойства 20 идентифицированных фенольных соединений (пики 1–20) показаны на рис. Как сообщалось ранее (Romeo et al., 2015), наблюдались две изомерные формы (A и B) пуникалагинов (пики 10 и 14), а также было подчеркнуто присутствие гранатина B (пик 6). Кроме того, эти соединения также были охарактеризованы прямым анализом отрицательных ионов вливания ESI / MS n стандартных соединений.Пик 4 был идентифицирован как пуникалин ( m / z 781), тогда как пики 2, 3, 5, 7–9, 11–13, 15–18 и 20 были идентифицированы как производные эллаговой кислоты в соответствии с их УФ – видимой областью и массой. характеристики (λ max около 370 нм и фрагмент MS 1 на m / z 301, соответствующий эллаговой кислоте).

Активность PE по улавливанию свободных радикалов

Антиоксидантная активность PE проверялась по их способности восстанавливать стабильный радикал DPPH.

В частности, процент ингибирования DPPH достигал 75% при концентрациях ниже 0.21 мг / мл (76,78, 79 и 80% соответственно при концентрации ПЭ 0,17-0,11-0,085 и 0,028 мг / мл). При концентрациях выше 0,21 мг / мл процент ингибирования DPPH был ниже ().

Активность ПЭ по улавливанию радикалов DPPH в различных концентрациях. Результаты выражаются в процентах от скорости ингибирования ± стандартное отклонение.

Экстракт граната ингибировал образование супероксид-аниона дозозависимым образом (). Как правило, в этом тесте PE оказался более эффективным, чем в предыдущем.Это может быть связано с меньшим размером супероксид-аниона по сравнению с радикалом DPPH.

Таблица 3

Активность по улавливанию супероксидных ионов при различных концентрациях ПЭ.

78 ± 2
концентрации PE % ингибирования концентрации PE % ингибирования
PE (3,4 мг / мл) 65 ± 2 PE (0,21 мг / мл)
PE (1,7 мг / мл) 73 ± 3 PE (0.17 мг / мл) 80 ± 1
PE (0,85 мг / мл) 75 ± 1 PE (0,11 мг / мл) 85 ± 3
PE (0,56 мг / мл ) 70 ± 2 PE (0,085 мг / мл 88 ± 4
PE (0,42 мг / мл) 68 ± 1 PE (0,028 мг / мл) 95 ± 1
PE (0,34 мг / мл) 75 ± 4

Влияние PE на жизнеспособность клеток 3T3-L1

3- (4,5-диметилтиазол ил) -2,5-дифенилтетразолийбромид (МТТ) проводили для оценки жизнеспособности клеток 3T3-L1.Результаты показывают значительное снижение жизнеспособности клеток при высоких концентрациях PE (3,4, 1,7, 0,85, 0,56 и 0,42 мг / мл), тогда как при более низких (0,34, 0,21, 0,17, 0,11 и 0,085 мг / мл) концентрациях наблюдается умеренная ингибирующий эффект и концентрация 0,028 мг / мл не оказали значительного влияния на жизнеспособность клеток преадипоцитов мышей 3T3-L1 ().

Процент выживаемости преадипоцитов мышей 3T3-L1 в присутствии PE в различных концентрациях. Результаты выражены как среднее значение ± стандартное отклонение четырех экспериментов, проведенных в трех повторностях.Значимые по сравнению с необработанными контролями: * p <0,005; ∗∗ p <0,05.

Microbiology

Антимикробная активность PE в отношении штаммов патогенов

Данные анализа совместного культивирования показали, что патогены были по-разному чувствительны к PE. В деталях, как показано в, экстракт в концентрации 1,7 мг / мл показал наивысшую антимикробную активность против всех патогенов со значительным снижением на L. innocua (проксимально 4 log единицы).При концентрации 0,34 мг / мл экстракт был эффективен против E. coli , L. innocua и S. aureus , демонстрируя снижение плотности клеток на 1 и 2 log единицы соответственно. Когда PE тестировали при концентрации 0,17 мг / мл, штаммы S. aureus , S. enterica и L. innocua все еще подавлялись, в то время как рост E. coli не подвергался значительному влиянию.

Противомикробная активность PE различной концентрации в отношении патогенов, обнаруженных на T24 (24 ч инокулята).Плотность клеток выражается как Δlog КОЕ / мл.

Эффект PE на рост пробиотических штаммов

Результаты, показанные в, подчеркнули, что PE, при всех испытанных концентрациях, не обладал какой-либо ингибирующей активностью в отношении роста испытанных пробиотических штаммов. Небольшое увеличение роста наблюдалось для LGG, совместно культивируемых с PE в концентрации 0,028 мг / мл ().

Таблица 4

Количество бактерий, выраженное как log 10 КОЕ / мл в трех повторностях ± стандартное отклонение L. rhamnosus GG ATCC 53103, Bifidobacterium animalis BB12, B.longum BB536 и дикий штамм Lactobacillus paracasei N 24 после инкубации с PE в различных концентрациях.

мл ) b Б.longum 909 мг 9,57 ± 0,12 a
Журнал 10
L. rhamnosus GG Исходный уровень 8,83 ± 0,09 / PE 9,20 ± 0,10 b
PE (0.042 мг / мл) 9,24 ± 0,07 b
PE (0,028 мг / мл) 9,26 ± 0,04 b
Lactobacillus paracasei 23 907 a
N24 PE (0,085 мг / мл) 8,70 ± 0,08 a
PE (0,042 мг / мл) 8,79 ± 0,10 907 907 907 PE (0.028 мг / мл) 8,74 ± 0,09 a
Bifidobacterium animalis Исходный уровень 9,15 ± 0,05 a
BB12 мг / 0,07 мг / 0,07 0,12 a
PE (0,042 мг / мл) 9,44 ± 0,10 b
PE (0,028 мг / мл) 9,55 ± 0,07 907 Исходный уровень 9,77 ± 0,03 a
BB536 PE (0,085 мг / мл) 9,54 ± 0,10 a
PE (0,028 мг / мл) 9,44 ± 0,16 a

Влияние PE на содержание липидов Pomenate

9 фильтрованный SB значительно снизил содержание триглицеридов по сравнению с контрольной группой ().Однако эффект отфильтрованного SB, полученного из клеток, инкубированных с PE (LGG-T1) или без него (LGG-T0), был аналогичным. Одновременная обработка преадипоцитов мышей 3T3-L1 SB, отфильтрованным через PE и LGG, значительно снизила содержание триглицеридов по сравнению с обработкой только SB, отфильтрованного через LGG. Более того, эти данные свидетельствуют о том, что комбинированное лечение PE и LGG-T1 было наиболее эффективным для снижения содержания триглицеридов и накопления внутриклеточных липидов.

(A) Типичное окрашивание O масляным красным О клеток 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE. (B) Содержание липидов определяли количественно с помощью окрашивания Oil Red O (среднее ± SD , * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с LGG T0 + PE).

Обработка преадипоцитов мышей 3T3-L1 клеточным экстрактом LGG (CE), полученным из клеток, инкубированных с PE (CE + PE) или без него (CE), не оказала влияния на накопление внутриклеточных липидов по сравнению с контрольной группой ( Контроль: ABS 490 нм = 0.200 ± 0,07; CE: ABS 490 нм = 0,187 ± 0,09; CE + PE = ABS 490 нм = 0,190 ± 0,05).

Влияние PE на адипогенные маркеры

Уровни экспрессии мРНК основных транскрипционных факторов, участвующих в дифференцировке адипоцитов, были значительно менее выражены в клетках 3T3-L1, обработанных SB, отфильтрованным через PE и LGG. В частности, PE, LGG-T0 и LGG-T1 были способны снижать уровни гена адипонектина, PPAR-γ, SREBP, FAS и IL-6 и повышать уровни гена IL-10 ().

(A – F) Анализ экспрессии генов с помощью qRT-PCR липогенного пути в клетках 3T3-L1 в отсутствие и в присутствии PE, LGG T0, LGG T1, LGG T0 + PE и LGG T1 + PE.Результаты выражены как средние значения ± стандартное отклонение четырех экспериментов, выполненных в трех повторностях ( * p <0,05 по сравнению с контролем; # p <0,05 по сравнению с LGG T0 и LGG T1; § p <0,05 по сравнению с контролем. LGG T0 + PE).

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно снизила уровни экспрессии мРНК основных транскрипционных факторов, участвующих в адипогенезе, по сравнению с обработкой SB, отфильтрованных через LGG ( LGGT0 и LGGT1) отдельно ().

Одновременная обработка преадипоцитов мышей 3T3-L1 SB (LGGT0 и LGGT1), отфильтрованных через PE и LGG, значительно увеличила уровни экспрессии мРНК IL10 по сравнению с обработкой только SB (LGGT0 и LGGT1), профильтрованных через LGG ( ). Более того, эти данные свидетельствуют о том, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10 (2).

Обсуждение

Благоприятные эффекты употребления плодов граната и / или сока вызвали значительный научный интерес (Basu and Penugonda, 2009).Многие исследователи сообщают, что полиэтилены, полученные из отходов перерабатывающих предприятий, обладают способностью улавливать свободные радикалы и обладают мощной антиоксидантной способностью (Panichayupakaranant et al., 2010; Fischer et al., 2011). ПЭ, использованный в настоящем исследовании, был растворим в воде и охарактеризован с помощью ВЭЖХ – PDA – ESI / MS n на содержание фенолов и антоцианов. В соответствии с предыдущими сообщениями (Fischer et al., 2011; Qu et al., 2012; Romeo et al., 2015), эллагитаннины являются преобладающим классом фенольных соединений в кожуре и выжимках граната (побочный продукт, состоящий из семян и кожура), поскольку они составляют более 99% от общего содержания фенольных соединений граната.Основными эллагитаннинами побочных продуктов граната, а также продуктов из граната (фруктов и соков) являются пуникалагины (Gil et al., 2000; Fischer et al., 2011; Qu et al., 2012).

Экстракт граната содержит высокий процент фенольных соединений и проявляет антиоксидантную активность в зависимости от концентрации, как показано для анализа как DPPH, так и анализа поглощения супероксид-анионов.

Сообщалось, что диетические полифенолы растений способны избирательно модулировать рост чувствительных микроорганизмов (Tabasco et al., 2011). Экстракты растений обычно подавляют рост бактерий, но степень эффекта зависит от состава экстракта и типа бактериального штамма.

Результаты, полученные в наших экспериментальных условиях, показали, что высокие концентрации полифенолов граната оказывают противомикробное действие на некоторые штаммы патогенов, такие как L. innocua и S. aureus. Эти результаты согласуются с исследованиями Panichayupakaranant et al. (2010), Fawole et al.(2012) и Su et al. (2012).

Однако при концентрациях PE ниже 0,34 мг / мл, хотя не было обнаружено концентраций ингибирующей активности против пробиотических штаммов, оценивалось только небольшое увеличение роста LGG. Эти результаты не согласуются с исследованиями Li et al. (2015) и Neyrinck et al. (2013), которые продемонстрировали, что полифенолы граната потенциально могут работать как пребиотики.

Ожирение — это состояние, при котором накопление липидов приводит к расширению жировой ткани, которая действует как метаболический и эндокринный орган.Молекулярные механизмы, которые модулируют рост, дифференцировку и липогенез преадипоцитов жировых клеток, были предметом обширных исследований (Vanella et al., 2012; Stechschulte et al., 2014; Moseti et al., 2016; Palmeri et al., 2016; Waldman et al., 2016; Carpene et al., 2018).

Во время дифференцировки адипоцитов преадипоциты дифференцируются в зрелые адипоциты (Lefterova and Lazar, 2009). Повышенное накопление жира сильно коррелирует с количеством клеток и / или размером адипоцитов (Jiang et al., 2008).

Сообщалось, что степень ожирения связана с дифференцировкой преадипоцитов в адипоцитах и ​​с увеличением адипоцитов в жировой ткани (Wang and Jones, 2004).

Другие авторы сообщили, что PEs способны подавлять дифференцировку преадипоцитов и адипогенез и уменьшать жировую дистрофию печени у крыс с ожирением и диабетом 2 типа (Xu et al., 2009).

В соответствии с данными Moon et al. (2012) и Park et al. (2014) в наших экспериментальных условиях PE, LGG-T0 и LGG-T1 приводили к значительному снижению накопления липидов в клетках 3T3-L1 во время дифференцировки в адипоциты, предполагая, что PE, LGG-T0 и LGG-T1 способны подавлять дифференцировка адипоцитов.Однако обработка LGG-фильтрованным SB, полученным из клеток, инкубированных с PE (LGG-T1) или без (LGG-T1), была аналогичной. В наших экспериментальных условиях фактически не наблюдалось пребиотического эффекта, продемонстрированного другими авторами. Более того, комбинированное лечение PE и LGG-T1 было наиболее эффективным в снижении внутриклеточного накопления липидов. Эти данные демонстрируют, что, даже если в наших экспериментальных условиях не наблюдалось пребиотического эффекта, фильтрованный SB, полученный из LGG, инкубированного с PE (LGG-T1), мог бы содержать, помимо полезных бактериальных секретируемых биоактивных соединений, также небольшие количества PE- производные биоактивные соединения.Последний, присутствующий в небольших количествах в LGG-T1, не будет иметь более сильных положительных эффектов, чем LGG-T0, но в сочетании с PE может иметь потенциальные синергетические преимущества для здоровья.

Адипоцит-специфический рецептор-активируемый пролифератором пероксисом-γ (PPARγ) участвует в ранней стадии дифференцировки адипоцитов (Rosen et al., 2000), регулируя экспрессию адипогенных генов, таких как синтаза жирных кислот (FAS) и регуляторный элемент стерола. -связывающие белки (SREBP), а затем запускают накопление жира в клетках (Kawada et al., 2001; Бергер и Моллер, 2002).

Жировая ткань — это не только первичный резервуар жира, но и эндокринный орган, контролирующий гомеостаз липидов. Измененные уровни адипокинов жировой ткани могут способствовать развитию воспаления, что приводит к нарушению липидного обмена (Armani et al., 2010). При хроническом воспалении провоспалительные цитокины, такие как IL-6, активируются, тогда как противовоспалительные цитокины, такие как IL-10, подавляются (Kershaw and Flier, 2004; Bradley et al., 2008; Лира и др., 2012; Лю и др., 2018).

Наши результаты демонстрируют, что комбинированное лечение PE + LGG-T1 значительно снижает уровень мРНК адипонектина, FAS и IL-6 и повышает уровень IL-10.

Можно сделать вывод, что комбинированное лечение PE + LGG-T1 обладает противовоспалительными свойствами и способно ингибировать дифференцировку адипоцитов, модулируя уровни экспрессии ключевых факторов адипогенной транскрипции, участвующих в адипогенезе.

Заключение

SB, отфильтрованный экстрактом граната и LGG, значительно снижал накопление внутриклеточных липидов.Наблюдали синергетический эффект пробиотиков и полифенолов, содержащихся в ПЭ. Более того, наши результаты показали, что комбинированное лечение PE + LGG T1 было наиболее эффективным в снижении уровней экспрессии мРНК адипонектина, IL-6, FAS и в повышении регуляции IL-10.

Эти результаты свидетельствуют о том, что пробиотики и полифенолы, содержащиеся в ПЭ, могут влиять на адипогенез in vitro. Более того, наши результаты демонстрируют, что синергетические свойства сочетания таких продуктов, как гранат и пробиотики, могут оказывать комбинированное воздействие на здоровье.

Тогда гранат и пробиотики, такие как штамм LGG, могут внести свой вклад в разработку новых нутрицевтических / пробиотических средств для профилактики и лечения ожирения.

Вклад авторов

VS, LV, CR, CC, FR и GB собрали исследовательские статьи, разработали эксперименты, проанализировали результаты и написали рукопись. CR, MR, SF и NT проводили эксперименты.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Источники

  • Аль-Зореки Н.С. (2009). Антимикробная активность кожуры плодов граната ( Punica granatum L.). Внутр. J. Food Microbiol. 134 244–248. 10.1016 / j.ijfoodmicro.2009.07.002 [PubMed] [CrossRef] [Google Scholar]
  • Армани А., Мамми К., Марцолла В., Каланчини М., Антелми А., Розано Г. М. и др. (2010). Клеточные модели для понимания адипогенеза, дисфункции жировой ткани и ожирения. J. Cell Biochem. 110 564–572.10.1002 / jcb.22598 [PubMed] [CrossRef] [Google Scholar]
  • Барбагалло И., Ли Вольти Г., Сорренти В., Ди Джакомо К., Аквавива Р., Раффаэле М. и др. (2017). Фенетиловый эфир кофейной кислоты восстанавливает экспрессию гена адипоцитов после обработки липополисахаридом. Lett. Drug Des. Discov. 14 481–487. 10.2174 / 1570180813666160

    4707 [CrossRef] [Google Scholar]

  • Бассири-Джахроми С. (2018). Активность Punica granatum (граната) в укреплении здоровья и профилактике рака. Онкол. Сборка 12: 345. 10.4081 / онкол.2018.345 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Басу А., Пенугонда К. (2009). Гранатовый сок: фруктовый сок, полезный для сердца. Nutr. Сборка 67 49–56. 10.1111 / j.1753-4887.2008.00133.x [PubMed] [CrossRef] [Google Scholar]
  • Бергер Дж., Моллер Д. Э. (2002). Механизмы действия PPAR. Annu. Rev. Med. 53 409–435. 10.1146 / annurev.med.53.082901.104018 [PubMed] [CrossRef] [Google Scholar]
  • Bialonska D., Касимсетти С. Г., Шредер К. К., Феррейра Д. (2009). Влияние побочных продуктов граната ( Punica granatum L.) и эллагитаннинов на рост кишечных бактерий человека. J. Agric. Food Chem. 57 год 8344–8349. 10.1021 / jf

    1b [PubMed] [CrossRef] [Google Scholar]

  • Бялонска Д., Рамнани П., Касимсетти С. Г., Мунта К. Р., Гибсон Г. Р., Феррейра Д. (2010). Влияние побочного продукта граната и пуникалагинов на отдельные группы кишечной микробиоты человека. Внутр.J. Food Microbiol. 140 175–182. 10.1016 / j.ijfoodmicro.2010.03.038 [PubMed] [CrossRef] [Google Scholar]
  • Брэдли Р. Л., Фишер Ф. Ф., Маратос-Флиер Э. (2008). Пищевые жирные кислоты по-разному регулируют продукцию TNF-альфа и IL-10 адипоцитами 3T3-L1 мышей. Ожирение 16 938–944. 10.1038 / обы.2008.39 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Карпен К., Пеженауте Х., Дель Мораль Р., Буле Н., Хихона Э., Андраде Ф. и др. (2018). Диетический антиоксидант пицеатаннол подавляет адипогенез мезенхимальных стволовых клеток жировой ткани человека и ограничивает транспорт глюкозы и липогенную активность в адипоцитах. Внутр. J. Mol. Sci. 19: E2081. 10.3390 / ijms181 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Дхумал С., Карале А. Р., Джадхав С. Б., Кад В. П. (2014). Последние достижения и разработки в области обработки и использования граната: обзор. J. Agric. Crop Sci. 1 1–17. [Google Scholar]
  • Ди Джакомо К., Ванелла Л., Сорренти В., Сантанджело Р., Барбагалло И., Калабрезе Г. и др. (2015). Эффекты tithonia diversifolia (Hemsl.) A.Серый экстракт о дифференцировке адипоцитов мезенхимальных стволовых клеток человека. PLoS One 10: e0122320. 10.1371 / journal.pone.0122320 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Фаволе О. А., Макунга Н. П., Опара Ю. Л. (2012). Метанольный экстракт кожуры плодов граната обладает антибактериальной, антиоксидантной и ингибирующей тирозиназой активностью. BMC Дополнение. Альтерн. Med. 12: 200. 10.1186 / 1472-6882-12-200 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Fischer U.А., Карл Р., Каммерер Д. Р. (2011). Идентификация и количественное определение фенольных соединений из кожуры граната ( Punica granatum L.), мезокарпа, арил и других соков с помощью HPLC-DAD-ESI / MS (n). Food Chem. 127 807–821. 10.1016 / j.foodchem.2010.12.156 [PubMed] [CrossRef] [Google Scholar]
  • Гил М. И., Томас-Барберан Ф. А., Хесс-Пирс Б., Холкрофт Д. М., Кадер А. А. (2000). Антиоксидантная активность гранатового сока и ее связь с фенольным составом и обработкой. J. Agric. Food Chem. 48 4581–4589. [PubMed] [Google Scholar]
  • Хоссин Ф. Л. А. (2009). Воздействие кожуры граната (Punica granatum) и его экстракта на крыс с ожирением и гиперхолестеринемией. Пак. J. Nutr. 8 1251–1257. 10.3923 / pjn.2009.1251.1257 [CrossRef] [Google Scholar]
  • Jiang L., Zhang N. X., Mo W., Wan R., Ma C. G., Li X., et al. (2008). Ремания подавляет дифференцировку адипоцитов и адипогенез. Biochem. Биофиз. Res. Commun. 371 185–190.10.1016 / j.bbrc.2008.03.129 [PubMed] [CrossRef] [Google Scholar]
  • Кавада Т., Такахаши Н., Фушики Т. (2001). Биохимические и физиологические характеристики жировой клетки. J. Nutr. Sci. Витаминол. 47 1–12. [PubMed] [Google Scholar]
  • Кершоу Э. Э., Флиер Дж. С. (2004). Жировая ткань как эндокринный орган. J. Clin. Эндокринол. Метаб. 89 2548–2556. 10.1210 / jc.2004-0395 [PubMed] [CrossRef] [Google Scholar]
  • Ким С. Х., Плутцки Дж. (2016). Бурый жир и потемнение для лечения ожирения и связанных с ним нарушений обмена веществ. Diabetes Metab. J. 40 12–21. 10.4093 / dmj.2016.40.1.12 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Лай С., Цай М. Л., Бадмаев В., Хименес М., Хо К. Т., Пан М. Х. (2012). Ксантиген подавляет дифференцировку преадипоцитов и адипогенез за счет подавления PPARgamma и C / EBP и модуляции путей SIRT-1, AMPK и FoxO. J. Agric. Food Chem. 60 1094–1101. 10.1021 / jf204862d [PubMed] [CrossRef] [Google Scholar]
  • Ли К.Дж., Чен Л. Г., Лян В. Л., Ван К. С. (2010). Противовоспалительное действие punica granatum Linne in vitro и in vivo. Food Chem. 118 315–322. [Google Scholar]
  • Лефтерова М. И., Лазарь М. А. (2009). Новые разработки в адипогенезе. Trends Endocrinol. Метаб. 20 107–114. 10.1016 / j.tem.2008.11.005 [PubMed] [CrossRef] [Google Scholar]
  • Лес Ф., Арбонес-Майнар Дж. М., Валеро М. С., Лопес В. (2018). Полифенолы граната и уролитин А ингибируют альфа-глюкозидазу, дипептидилпептидазу-4, липазу, накопление триглицеридов и гены, связанные с адипогенезом, в адипоцитоподобных клетках 3T3-L1. J. Ethnopharmacol. 220 67–74. 10.1016 / j.jep.2018.03.029 [PubMed] [CrossRef] [Google Scholar]
  • Ли Ю. Ф., Го К. Дж., Ян Дж. Дж., Вэй Дж. Ю., Сюй Дж., Ченг С. (2006). Оценка антиоксидантных свойств экстракта кожуры граната по сравнению с экстрактом мякоти граната. Food Chem. 96 254–260. [Google Scholar]
  • Ли З., Сумманен П. Х., Комория Т., Хеннинг С. М., Ли Р. П., Карлсон Э. и др. (2015). Эллагитаннины граната стимулируют рост кишечных бактерий in vitro: влияние на пребиотические и метаболические эффекты. Анаэроб 34 164–168. 10.1016 / j.anaerobe.2015.05.012 [PubMed] [CrossRef] [Google Scholar]
  • Лин Л. Т., Чен Т. Ю., Лин С. С., Чунг С. Ю., Лин Т. К., Ван Г. Х. и др. (2013). Широкий спектр противовирусной активности хебулаговой кислоты и пуникалагина против вирусов, которые используют гликозаминогликаны для проникновения. BMC Microbiol. 13: 187. 10.1186 / 1471-2180-13-187 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Lira F. S., Rosa J. C., Pimentel G. D., Seelaender M., Дамасо А. Р., Ояма Л. М. и др. (2012). И адипонектин, и интерлейкин-10 ингибируют LPS-индуцированную активацию пути NF-kappaB в адипоцитах 3T3-L1. Цитокин 57 год 98–106. 10.1016 / j.cyto.2011.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Лю Ю., Сюй Д., Инь С., Ван С., Ван М., Сяо Ю. (2018). Уровень IL-10 / STAT3 снижается при детском ожирении с гипертриглицеридемией и связан с уровнем триглицеридов у крыс с ожирением, вызванным диетой. BMC Endocr. Disord. 18:39.10.1186 / s12902-018-0265-z [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Moon Y. J., Soh J. R., Yu J. J., Sohn H. S., Cha Y. S., Oh S. H. (2012). Эффект ингибирования внутриклеточного накопления липидов Weissella koreensis OK1-6, выделенного из Kimchi, на дифференцировку адипоцитов. J. Appl. Microbiol. 113 652–658. 10.1111 / j.1365-2672.2012.05348.x [PubMed] [CrossRef] [Google Scholar]
  • Мосети Д., Регасса А., Ким В. К. (2016). Молекулярная регуляция адипогенеза и потенциальные антиадипогенные биоактивные молекулы. Внутр. J. Mol. Sci. 17: E124. 10.3390 / ijms17010124 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Нейринк А. М., Ван Хи В. Ф., Биндельс Л. Б., Де Бакер Ф., Кани П. Д., Делзен Н. М. (2013). Богатый полифенолами экстракт кожуры граната облегчает воспаление тканей и гиперхолестеринемию у мышей с ожирением, вызванных диетой с высоким содержанием жиров: потенциальное влияние на микробиоту кишечника. руб. J. Nutr. 109 802–809. 10.1017 / S0007114512002206 [PubMed] [CrossRef] [Google Scholar]
  • Палмери Р., Монтелеоне Дж. И., Спанья Г., Рестучча К., Раффаэле М., Ванелла Л. и др. (2016). Экстракт оливковых листьев сицилийского сорта уменьшал накопление липидов, вызывая термогенный путь во время адипогенеза. Фронт. Pharmacol. 7: 143. 10.3389 / fphar.2016.00143 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Panichayupakaranant P., Tewtrakul S., Yuenyongsawad S. (2010). Антибактериальное, противовоспалительное и противоаллергическое действие стандартизированного экстракта кожуры граната. Food Chem. 123 400–403. 10.1055 / s-0030-1264706 [CrossRef] [Google Scholar]
  • Парк Дж. Э., О С. Х., Ча Ю. С. (2014). Lactobacillus brevis OPK-3, выделенный из кимчи, подавляет адипогенез и оказывает противовоспалительное действие в адипоцитах 3T3-L1. J. Sci. Продовольственное сельское хозяйство. 94 2514–2520. 10.1002 / jsfa.6588 [PubMed] [CrossRef] [Google Scholar]
  • Ку В., Брекса III А. П., Пан З., Ма Х. (2012). Количественное определение основных составляющих полифенолов в продуктах из граната. Food Chem. 132 1585–1591. 10.1016 / j.foodchem.2011.11.106 [PubMed] [CrossRef] [Google Scholar]
  • Раффаэле М., Барбагалло И., Ликари М., Карота Г., Сферраццо Г., Спампинато М. и др. (2018). N-ацетилцистеин (NAC) улучшает липидную метаболическую дисфункцию в адипоцитах, происходящих из стромальных клеток костного мозга. Evid. На основе дополнения. Альтерн. Med. 2018: 9. 10.1155 / 2018/5310961 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Редди М. К., Гупта С.К., Джейкоб М. Р., Хан С. И., Феррейра Д. (2007). Антиоксидантное, противомалярийное и противомикробное действие богатых танинами фракций, эллагитаннинов и фенольных кислот из Punica granatum L. Planta Med. 73 461–467. 10.1055 / с-2007-967167 [PubMed] [CrossRef] [Google Scholar]
  • Ромео Ф. В., Баллистрери Г., Фаброни С., Пангалло С., Никосия М. Г., Шена Л. и др. (2015). Химическая характеристика различных экстрактов сумаха и граната, эффективных против гнили Botrytis cinerea. Молекулы 20 11941–11958. 10,3390 / молекул 200711941 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Розен Э. Д., Уолки К. Дж., Пучсервер П., Шпигельман Б. М. (2000). Транскрипционная регуляция адипогенеза. Genes Dev. 14 1293–1307. [PubMed] [Google Scholar]
  • Салерно Л., Модика М. Н., Ромео Г., Питтала В., Сиракуза М. А., Амато М. Э. и др. (2012). Новые ингибиторы синтазы оксида азота с антиоксидантными свойствами. Eur.J. Med. Chem. 49 118–126. 10.1016 / j.ejmech.2012.01.002 [PubMed] [CrossRef] [Google Scholar]
  • Синглтон В. Л., Ортофер Р., Ламуэла-Равентос Р. М. (1999). Анализ общих фенолов и других субстратов окисления и антиоксидантов с помощью реактива Фолина – Чокальто. Methods Enzymol. 299 152–178. 10.1016 / S0076-6879 (99) 99017-1 [CrossRef] [Google Scholar]
  • Смит К. Б., Смит М. С. (2016). Статистика ожирения. Prim Care 43 год 121–135. 10.1016 / j.поп.2015.10.001 [PubMed] [CrossRef] [Google Scholar]
  • Stechschulte L.A., Хайндс Т.Д., мл., Худер С.С., Шоу В., Наджар С.М., Санчес Э.Р. (2014). FKBP51 контролирует клеточный адипогенез посредством опосредованного p38 киназой фосфорилирования GRalpha и PPARgamma. Мол. Эндокринол. 28 год 1265–1275. 10.1210 / мне.2014-1022 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Su X., Howell A. B., D’Souza D. H. (2012). Антибактериальные эффекты растительных экстрактов на устойчивый к метициллину Staphylococcus aureus. Пищевой патоген. Дис. 9 573–578. 10.1089 / fpd.2011.1046 [PubMed] [CrossRef] [Google Scholar]
  • Табаско Р., Санчес-Патан Ф., Монагас М., Бартоломе Б., Виктория Морено-Аррибас М., Пелаез К. и др. (2011). Влияние полифенолов винограда на рост молочнокислых бактерий и бифидобактерий: устойчивость и метаболизм. Food Microbiol. 28 год 1345–1352. 10.1016 / j.fm.2011.06.005 [PubMed] [CrossRef] [Google Scholar]
  • Тегеранифар А., Селахварзи Ю., Харрази М., Бахш В.J. (2011). Высокий потенциал побочных продуктов агропромышленного производства граната ( Punica granatum L.) как мощных противогрибковых и антиоксидантных веществ. Инд. Сельскохозяйственные культуры 34 1523–1527. 10.1016 / j.indcrop.2011.05.007 [CrossRef] [Google Scholar]
  • Ванелла Л., Барбагалло И., Аквавива Р., Ди Джакомо К., Кардил В., Абрахам Н. Г. и др. (2013a). Эллаговая кислота: цитодифференцирующие и антипролиферативные эффекты в клеточных линиях рака предстательной железы человека. Curr. Pharm.Des. 19 2728–2736. [PubMed] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Кардил В., Ким Д. Х. и др. (2013b). Маркеры апоптоза в клеточной линии рака простаты: эффект эллаговой кислоты. Онкол. Реп. 30 2804–2810. 10.3892 / или 2013.2757 [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Ди Джакомо К., Аквавива Р., Барбагалло И., Ли Вольти Г., Кардил В. и др. (2013c). Влияние эллаговой кислоты на ангиогенные факторы в клетках рака простаты. Раки 5 726–738. 10.3390 / раки5020726 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ванелла Л., Сэнфорд К., мл., Ким Д. Х., Абрахам Н. Г., Эбрахейм Н. (2012). Окислительный стресс и гемоксигеназа-1 регулируют дифференцировку мезенхимальных стволовых клеток человека. Внутр. J. Hypertens. 2012: 8. 10.1155 / 2012/8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Waldman M., Bellner L., Vanella L., Schragenheim J., Sodhi K., Singh S.P., et al. (2016). Эпоксиэйкозатриеновые кислоты регулируют дифференцировку адипоцитов клеток 3T3 мыши посредством активации PGC-1alpha, которая необходима для экспрессии HO-1 и увеличения функции митохондрий. Stem Cells Dev. 25 1084–1094. 10.1089 / scd.2016.0072 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Wang Y. W., Jones P. J. (2004). Конъюгированная линолевая кислота и контроль ожирения: эффективность и механизмы. Внутр. J. Obes. Relat. Метаб. Disord. 28 год 941–955.10.1038 / sj.ijo.0802641 [PubMed] [CrossRef] [Google Scholar]
  • Сюй К. З., Чжу К., Ким М. С., Ямахара Дж., Ли Ю. (2009). Цветок граната уменьшает ожирение печени у животных с диабетом 2 типа и ожирением. J. Ethnopharmacol. 123 280–287. 10.1016 / j.jep.2009.03.035 [PubMed] [CrossRef] [Google Scholar]

Кожура граната как подходящий источник высокоактивных биологически активных веществ: адаптированные функциональные мясные продукты

Молекулы. 2020 июн; 25 (12): 2859.

Патрисия Гуллон

1 Группа по питанию и броматологии, Департамент аналитической и пищевой химии, Факультет пищевых наук и технологий, Университет Виго, кампус Оренсе, 32004 Оренсе, Испания; [email protected]

Гонсало Астрай

2 Кафедра физической химии, факультет естественных наук, Университет Виго (кампус Оренсе), Ас-Лагоас, 32004 Оренсе, Испания; [email protected]

3 CITACA, Кластер агропродовольственных исследований и передачи, Кампус Ауга, Университет Виго, 32004 Оренсе, Испания

Беатрис Гуллон

4 Кафедра химического машиностроения, Факультет естественных наук университета Виго (кампус Оренсе), Ас-Лагоас, 32004 Оренсе, Испания; se.ogivu @ nollugb

Игорь Томашевич

5 Кафедра технологии пищевых продуктов из животных источников, Белградский университет, сельскохозяйственный факультет, Неманьина 6, 11080 Белград, Сербия; [email protected]

José M. Lorenzo

6 Centro Tecnológico de la Carne de Galicia, Rúa Galicia № 4, Parque Tecnológico de Galicia, San Cibrao das Viñas 9 32900 Ourenas 9, 32900 9000, Испания 7 Área de Tecnología de los Alimentos, Facultad de Ciencias de Ourense, Universidad de Vigo, 32004 Ourense, Spain

Лилиан Баррос, академический редактор

1 Группа по питанию и броматологии, факультет аналитики и пищевой химии, факультет пищевой химии и технологии, Университет Виго, кампус Оренсе, 32004 Оренсе, Испания; se.ogivu @ nollugp 2 Кафедра физической химии, факультет естественных наук, Университет Виго (кампус Оренсе), Ас-Лагоас, 32004 Оренсе, Испания; [email protected]

3 CITACA, Кластер агропродовольственных исследований и передачи, Кампус Ауга, Университет Виго, 32004 Оренсе, Испания

4 Кафедра химического машиностроения, Факультет естественных наук, Университет Виго (Кампус Оренсе) , Ас-Лагоас, 32004 Оренсе, Испания; [email protected] 5 Кафедра технологии пищевых продуктов из животных источников, Белградский университет, факультет сельского хозяйства, Неманьина 6, 11080 Белград, Сербия; [email protected]

6 Centro Tecnológico de la Carne de Galicia, Rúa Galicia № 4, Parque Tecnológico de Galicia, San Cibrao das Viñas, 32900 Ourense, Spain

7 Alimentárica de la Teología Facultad de Ciencias de Ourense, Universidad de Vigo, 32004 Ourense, Spain

Поступила в редакцию 30 мая 2020 г .; Принято 19 июня 2020 г.

Лицензиат MDPI, Базель, Швейцария. Эта статья представляет собой статью в открытом доступе, распространяемую в соответствии с условиями лицензии Creative Commons Attribution (CC BY) (http: // creativecommons.org / licenses / by / 4.0 /). Эту статью цитировали в других статьях в PMC.

Abstract

В последние несколько лет интерес потребителей к взаимосвязи между здоровьем и диетой привел к поиску продуктов с функциональными свойствами, помимо питательных. В этой связи потребление граната увеличилось из-за их сенсорных свойств и значительного количества биоактивных соединений, которые в то же время генерируют огромное количество побочных продуктов. Поиск в базе данных Scopus за последние 10 лет выявил растущий интерес к кожуре граната (ПП), основному остатку от этого фрукта.Мясная промышленность — это пищевая отрасль, которой пришлось искать новые альтернативы замене синтетических консервантов новыми натуральными добавками, чтобы продлить срок службы и сохранить качественные характеристики продуктов их переработки. В этом обзоре описаны основные биоактивности экстрактов полипропилена, а также подробно описано их включение в мясные продукты. ПП является хорошим источником биологически активных соединений, включая фенольные кислоты, флавоноиды и гидролизуемые танины, которые оказывают благотворное влияние на здоровье. Можно сделать вывод, что изменение рецептуры мясных продуктов с использованием экстрактов полипропилена является подходящей стратегией для улучшения их технологических характеристик в дополнение к приданию функциональных свойств, которые делают их более полезными для здоровья и потенциально более приемлемыми для потребителя.

Ключевые слова: гранат, биоактивные соединения, мясные продукты, устойчивость к окислению

1. Введение

В западных диетах мясо и мясные продукты являются одним из основных источников белка с высокой биологической ценностью, помимо содержащихся в них микроэлементов, таких как в виде минералов (железо, магний, калий, селен и натрий) и витаминов (A, B 12 , фолиевая кислота и др.), которые являются высокобиодоступными [1]. Несмотря на эти превосходные питательные свойства, потребление мяса и мясных продуктов связано с более высокой частотой сердечно-сосудистых заболеваний и ожирения, что усиливает негативное восприятие потребителей этих пищевых продуктов в последние годы [2].С другой стороны, благодаря своему богатому питательному профилю, мясо имеет высокую подверженность порче из-за микробного роста и процессов окисления, которые происходят, когда мышцы трансформируются в мясо во время обработки и хранения мяса [3,4, 5,6]. Чтобы преодолеть эти недостатки и в соответствии с растущим осознанием потребителями взаимосвязи между диетой и здоровьем [7], в последние несколько лет мясная промышленность столкнулась с двойной задачей: предлагать более здоровые мясные продукты, а также гарантируя их стабильность [8,9,10,11].

До сих пор синтетические антиоксиданты, такие как бутилированный гидрокситолуол (BHT) и бутилированный гидроксианизол (BHA), широко использовались в пищевой промышленности в качестве консервантов для продления срока годности пищевых продуктов, но их включение должно быть уменьшено из-за их вредному воздействию на здоровье, как описано в исследованиях in vitro и in vivo [4]. Необходимость найти альтернативы замене синтетических добавок привела к тому, что научные исследователи и представители мясной промышленности стали прилагать большие усилия для использования возобновляемой биомассы в качестве естественного источника новых биомолекул с функциональными свойствами [7,12,13,14,15].В этом контексте агропродовольственная промышленность производит большое количество отходов и побочных продуктов, которые обычно используются недостаточно или выбрасываются, но которые содержат значительное количество биоактивных соединений со свойствами, которые делают их пригодными для использования в качестве натуральных ингредиентов [16,17, 18,19]. Таким образом, эта стратегия описывает многообещающий подход, который позволит удалять остатки, не имеющие экономической ценности, за счет извлечения экстрактов, богатых биомолекулами, которые затем могут быть включены в пищевую цепочку, внося свой вклад в модель экономики замкнутого цикла [20,21,22 , 23].

Благодаря терапевтическим свойствам, связанным с гранатом, его потребление в виде свежих фруктов, соков, джемов или пищевых добавок значительно увеличилось за последнее десятилетие [5,7,8,12]. Промышленная переработка этого фрукта дает огромное количество побочных продуктов, в основном кожуры и семян, которые обычно выбрасываются как отходы без какой-либо оценки [24]. Среди этих остатков кожура граната (PP, около 40–50% от общей массы плода) является отличным источником фенольных соединений (флавоноидов, фенольных кислот и дубильных веществ), белков и биоактивных пептидов и полисахаридов, среди прочего [7,24 ].Некоторые виды биоактивности in vitro, такие как антиоксидантное, противовоспалительное, противоопухолевое и антипролиферативное действие, были описаны для экстрактов PP в литературе [25,26,27,28]. Большое разнообразие биомолекул с различными функциональными возможностями предполагает, что экстракты полипропилена могут использоваться в мясной промышленности в качестве функционального ингредиента [5,9,11,12]. В этом смысле изменение рецептуры мясных продуктов с добавлением экстрактов из полипропилена могло бы стать альтернативой для решения упомянутых неудобств, и это открывает возможность составления рецептур мясных продуктов, адаптированных к потребностям определенных групп населения.В связи с этим растущий интерес к полипропилену отражается в исследованиях, касающихся этого остатка.

Ключевым моментом в получении биомолекул из остатков сельскохозяйственных и пищевых продуктов является выбор соответствующей технологии экстракции, поскольку она должна быть эффективной и должна поддерживать биоактивность, чтобы гарантировать их функциональность, когда они включены в пищевую матрицу [2 ]. Традиционно традиционные методы, основанные на органических растворителях и их водных смесях, широко используются для извлечения фитохимических веществ из агропродовольственных источников.Однако из-за того, что они обладают недостатками, которые негативно влияют на биоактивные свойства извлеченных биомолекул, в последние несколько лет были разработаны и применяются экологически чистые и устойчивые авангардные технологии в сочетании с интеллектуальными растворителями, а именно глубокая эвтектика. растворители и природные глубокие эвтектические растворители в области восстановления натуральных функциональных ингредиентов. Среди этих методов экстракция с помощью микроволн (MAE), экстракция с помощью ультразвука (UAE), жидкостная экстракция под давлением (PLE) и сверхкритическая жидкостная экстракция (SFE) используются для извлечения биомолекул из полипропилена [23,25,29, 30].

В этом обзоре собраны результаты исследований, продвинутых за последние 10 лет, в отношении потенциального использования полипропилена в качестве подходящего источника биосоединений с высокой добавленной стоимостью для создания специально подобранных функционализированных мясных продуктов. Пересмотрены такие аспекты, как основные фитохимические вещества, присутствующие в полипропилене, и их биоактивность. Также показана роль экстрактов как в технологических, так и в полезных для здоровья свойствах мясных продуктов с измененной рецептурой.

2. Основные биоактивные компоненты, присутствующие в кожуре граната

Было описано, что полипропилен является отличным источником ценных биосоединений, включая фенольные кислоты (гидроксикоричная и гидроксибензойная кислоты), флавоноиды (антоцианы, катехины и другие сложные флавоноиды) и гидролизуемые танины. (эллаговая и галловая кислоты, педункулагин, пуникалин и пуникалагин), все они имеют доказанное благотворное воздействие на здоровье [26,27,31].Кроме того, побочные продукты граната также содержат органические кислоты, минералы (кальций, фосфор, магний, калий и натрий), белок и жирные кислоты (в основном пуниковую, линолевую и олеиновую кислоты, присутствующие в семенах) [27,31]. Далее кратко описаны некоторые из основных биологически активных компонентов. Химические структуры основных биомолекул, идентифицированных в PP, показаны в.

Химическая структура некоторых биомолекул, идентифицированных в кожуре граната [26].

2.1. Первичные метаболиты

2.1.1. Полисахариды

Несмотря на то, что большая часть исследований была сосредоточена на фенольных соединениях, полученных из полипропилена, в последние годы этот побочный продукт также был выделен как богатый источник биоактивных полисахаридов. Обширный обзор литературы показал, что пектин является основным полисахаридом, на его долю приходится примерно 20-25% полипропилена [32]. Пектин представляет собой смесь полисахаридов, состоящих из звеньев галактуроновой кислоты, связанных связью α (1 → 4), с тремя основными структурами: гомогалактуронан (HG), рамногалактуронан I (RG-I) и рамногалактуронан II (RG-II) [33 ].На сегодняшний день исследований полисахаридов PP недостаточно, особенно исследований их специфического состава среди различных сортов граната [34]. Гавлиги и др. [35] сообщили, что изолированные полисахариды из PP иранского сорта (не указано) содержат уроновые кислоты в диапазоне 19,9–30,8% и нейтральные сахара, а именно глюкозу (44,9–68,1%), галактозу (14,6–19,4%), маннозу. (3,4–18,1%), арабиноза (3,1–18,1%) и рамноза (3,5–6,0%). Пектин, экстрагированный из полипропилена сорта «Габси» из Туниса, показал общий уровень нейтрального сахара и галактуроновой кислоты, который варьировал от 16.От 1% до 32,6% и с 37,7% до 75,5% соответственно [36]. В другом исследовании Shakhmatov et al. [37] показали, что фрагменты высокоэтерифицированного метилом и низкоацетилированного 1,4-α-d-галактопиранозилуронана в основном составляют структуру полисахаридов PP.

PP также был описан как новый источник пищевых волокон, в частности β-глюканов [38]. β-глюкан представляет собой гетерогенный некрахмальный полисахарид, состоящий из звеньев β-d-глюкозы, связанных β- (1–4) и β- (1–3) гликозидными связями [39].Мы нашли только одно исследование, касающееся β-глюканов из PP [38]. В этой работе авторы получили 2,4% солюбилизированных β-глюканов из ПП сорта Акко.

2.1.2. Белки и аминокислоты

Данные о белке и аминокислотах в PP ограничены, и по этой теме было найдено лишь несколько исследований [29]. Сообщается, что содержание белка в кожуре составляет около 3% [40,41]. Однако эта фракция была обнаружена в более высоком содержании в семенах граната, достигающем около 14% [41].Что касается уровней аминокислот, эти же авторы указали, что PP имеет более высокое содержание незаменимых аминокислот, в частности, лизина, лейцина, фенилаланина, тирозина, треонина и валина, по сравнению с эталонным белковым составом Продовольственной и сельскохозяйственной организации Объединенных Наций. Наций / Всемирной организации здравоохранения (ФАО / ВОЗ).

С другой стороны, в последние 10 лет наблюдается рост интереса к поиску новых природных источников для получения белков и биоактивных пептидов из-за их важного благотворного воздействия на здоровье.В этой линии группа Эрнандеса-Каррото выделила и идентифицировала с помощью высокоэффективной жидкостной хроматографии в сочетании с ионизацией электрораспылением и квадрупольным временем пролета (HPLC-ESI-Q-TOF) несколько пептидов из белка PP [29, 42].

2.2. Вторичные метаболиты

2.2.1. Phenolic Acids

PP содержит значительное количество фенольных кислот, таких как галловая, эллаговая, ванилиновая, кофейная, феруловая, коричная и п-кумаровая кислоты [26,43]. Как концентрация, так и фенольный профиль побочных продуктов граната могут различаться для разных сортов граната [26,31].Например, уровни эллаговой кислоты 7,3 и 16,5 мг / г были количественно определены в экстрактах кожуры из сортов Тунис [44] и Испания [45], соответственно. Среднее общее содержание эллаговой кислоты 8,4 мг / г было определено в образцах ПП различных итальянских сортов [46]. В экстрактах кожуры египетского граната (разновидность Wonderful) основными фенольными кислотами, идентифицированными и количественно определенными, были эллаговая кислота (12,56 мг / г), галловая кислота (2,5 мг / г), коричная кислота (2,5 мг / г), хлорогеновая кислота ( 1,56 мг / г) и кумариновой кислоты (0.91 мг / г) [43]. В другом исследовании, проведенном Yan et al. [47], шесть сортов китайского граната были проанализированы с помощью сверхэффективной жидкостной хроматографии в сочетании с масс-спектром (UPLC-DAD / ESI-MS), и они сообщили, что среднее содержание галловой кислоты и эллаговой кислоты в кожуре составляло 0,57 мг / г. и 1,34 мг / г соответственно. Ли и др. [48] ​​обнаружили более высокие уровни этих соединений (2,59 мг / г галловой кислоты и 2,83 мг / г эллаговой кислоты) в экстрактах кожуры, полученных из гранатов, собранных в другом районе Шэньси Линтонг (Китай).

Используя HPLC-DAD-ESI / MS, Ambigaipalan et al. [49] выявили присутствие 15 фенольных кислот в ПП сорта граната, выращенного в Калифорнии. Фенольные кислоты были обнаружены в основном в нерастворимой связанной форме (около 2743 мкг / 100), по сравнению с этерифицированной и свободной формами (около 171 мкг / 100 и около 7 мкг / 100, соответственно).

2.2.2. Флавоноиды

Различные флавоноиды, включая катехин, эпикатехин, кверцетин, рутин, кемпферол, гесперидин, антоцианы и процианидины, были идентифицированы в полипропилене, этот побочный продукт считается отличным источником этих фитохимических веществ [26].Как и в случае фенольных кислот, относительные количества и состав флавоноидов зависят от сорта граната, части плода, стадии спелости и хранения плода [26,50]. Например, Masci et al. [51] обнаружили более высокое общее содержание флавоноидов (TFC) в этилацетатных экстрактах из кожуры [0,881 ммоль эквивалентов рутина (RE) / г] по сравнению с общим содержанием фруктов (0,561 ммоль RE / г) в гранатах итальянского происхождения. В другом исследовании, проведенном Russo et al. [46], содержание катехинов колебалось от 0.89–11,7 мг / г в метанольных экстрактах кожуры шести итальянских сортов граната, тогда как в их соответствующих мякотах это значение было намного ниже, в пределах от 0,015 до 0,234 мг / г. У этих сортов ПП имел среднее содержание рутина 4,5 мг / г, и это не было обнаружено в мякоти. Недавно Эль-Хадари и Рамадан [43] определили, что гесперидин (5,047 мг / г) является основным флавоноидом, за которым следует кверцетин (3,519 мг / г) в экстрактах египетского полипропилена. Некоторые авторы сообщают, что длительное хранение влияет на стабильность флавоноидов в плоде граната.Таким образом, Mphahlele et al. [50] изучали, как упаковочные системы влияют на содержание биологически активных соединений в цельном плоде граната, наблюдая потерю 65% рутина в кожуре после 3 месяцев хранения в холодильнике в полиэтиленовом пакете.

Среди различных флавоноидов, содержащихся в плодах граната, группа антоцианов считается одной из наиболее важных и вместе с гидролизуемыми танинами является одной из самых ценных биомолекул, обнаруженных в этом фрукте [52]. Это основные водорастворимые пигменты, отвечающие за оранжевый, красный и фиолетовый цвета плодов граната [53].В частности, фракция кожуры содержит около 30% от общего количества антоцианов плодов граната [54]. Во многих исследованиях предпринимались попытки идентифицировать и количественно оценить различные типы антоцианов в сортах граната из нескольких регионов мира с использованием передовых аналитических методов [31]. Abid et al. [55] с помощью жидкостной хроматографии-тандемной масс-спектрометрии (ЖХ-МС-МС) подтвердили присутствие пеларгонидин-3-пентозида, цианидин-3-рутинозида, цианидин-3-глюкозида и цианидин-3-пентозида в пилингах от четырех Тунисские экотипы.ВЭЖХ-DAD-ESI-TOF / MS позволила идентифицировать восемь различных антоцианов, а именно: (i) пеларгонидин-3-гликозид, (ii) пеларгонидин-3,5-дигликозид, (iii) дельфинидин-3-гликозид, (iv ) дельфинидин-3,5-дигликозид, (v) цианидин-3-гликозид, (vi) цианидин-3,5-дигликозид, (vii) цианидин-3-пентозид и (viii) цианидин-3-рутинозид в тунисском PP сорт под названием «Нана» [56]. Экстракт кожуры испанского сорта граната под названием «Mollar de Elche», собранный из фруктового сада в Ачиреале (Италия), показал высокие уровни цианидин-3-глюкозида (49.36%), пеларгонидин-3-глюкозид (24,62%) и цианидин-3,5-диглюкозид (12,41%) [54]. Другие антоцианы, такие как пеларгонидин-3,5-диглюкозид, дельфинидин-3-глюкозид и дельфинидин-3,5-диглюкозид, были обнаружены в гораздо более низких концентрациях [54].

2.2.3. Танины

Плоды граната также известны как отличный источник гидролизуемых танинов, в основном эллагитаннинов и галлотаннинов [26]. В ПП гидролизуемые таннины в основном находятся в форме пуникалагина (пуникалагин α- и β-изомеры), составляя около 85% от общего количества таннинов [31].Другие дубильные вещества, обнаруженные в кожуре плодов граната, включают пуникалин, педункулагин, гранатин А, гранатин В, корилагин, теллимаграндин, гексозид галлагила и т. Д. [26,31]. Используя HPLC-DAD-ESI-MS, Ambigaipalan et al. [49] идентифицировали 35 гидролизуемых танинов, из которых шесть (моногаллоилдиглюкоза, 2 изомера пуникалагина, тригаллоилглюкопираноза, тетрагаллоилглюкопираноза, пентагаллоилглюкопираноза) были впервые обнаружены в экстрактах полипропилена, выращенного в Калифорнии. В другом исследовании Wafa et al. [56] обнаружил с помощью HPLC-ESI-TOF / MS присутствие семи эллагитаннинов, а именно (i) пуникалин, (ii, iii) гранатин A и B, (iv) лагерстаннин, (v) педункулагин, (vi) HHDP-гексозид. и (vii) пуниглюконин в кожуре граната сорта «Нана» из Туниса.Кроме того, Abid et al. [55] проанализировали танинный состав PP из четырех тунисских экотипов и идентифицировали присутствие производного касталагина и производного галлоил-бис-HHDP-гексагона (казуаринина) только в одном из четырех сортов. Содержание дубильных веществ также варьируется между разными сортами граната. Например, в плодах граната египетского происхождения концентрация пуникалагина в водно-метанольных экстрактах кожуры составила 98,02 мг / г [43], в то время как гранаты из Израиля содержали значительно более высокое содержание, около 612.8 мг / г [57]. Концентрация пуникалагина в кожуре шести испанских сортов граната колебалась от 181 до 255 мг / г [45].

Среди различных частей плодов граната кожура содержала самое высокое содержание гидролизуемых танинов по сравнению с соком или семенами [58]. Эти авторы также указали, что содержание гидролизуемых танинов в испанском сорте граната «Mollar de Elche» постепенно снижалось на стадии созревания плодов. В частности, они обнаружили снижение содержания этих соединений на 48% от начала до конца созревания плодов.

Некоторые из наиболее часто используемых технологий извлечения биоактивных соединений из кожуры граната, а также аналитические методы, применяемые для его определения, собраны в.

Таблица 1

Технологии экстракции для получения биологически активных соединений из кожуры граната, а также аналитические методы их идентификации.

2
Технология Условия экстракции Метод идентификации Результаты Ссылка
SLE Метанол: вода (4: 1, v / v при днях) температура, LSR 5: 1 (мл / г) HPLC-PDA TPC: 188.9 мг ГАЭ / г живого веса; TFC: 13,95 мг QE / г dw
Идентификация 23 фенольных соединений и 20 флавоноидов
[43]
CPE Для общих фенолов: 8,22% Triton X-114, 4% NaCl при 36,80 ° C и pH 4
Для флавоноидов: 8,27% Triton X-114, 4,06% NaCl при 34,30 ° C и pH 5,07
Не указано TPC: 205,2 мг GAE / г; TFC: 60,05 мг QE / г [59]
СКВ, ИК и ОАЭ Растворители: вода, 50% этанол и 8 различных DES.Температура для трех технологий была фиксированной на уровне 50 ° C. HPLC-DAD Комбинация DES и IR приводит к наивысшему выходу полифенолов (152 мг / г) с высокой антиоксидантной активностью и хорошими антимикробными свойствами.
Идентификация кофейной кислоты, кемпферола, лютеолина, протокатеховой кислоты, эллаговой кислоты, хлорогеновой кислоты, гидроксибензойной кислоты, галловой кислоты и кверцетина
[60]
MAE и UAE Для этанола: 50% водный раствор; LSR: 60: 1 мл / г; мощность, 600 Вт за 4 мин
Для ОАЭ: вода, LSR: 32.2: 1 мл / г, уровень амплитуды: 39,8%, отношение длительности импульса к интервалу между импульсами, 1,2 / 1 при 34,7 ° C в течение 10 мин.
ВЭЖХ-УФ – vis TPC (MAE): 199,4 мг GAE / г; TPC (ОАЭ): 119,82 мг ГАЭ / г.
Идентификация и количественное определение пуникалагина: 143,64 мг / г для MAE и 138,8 мг / г для ОАЭ
[25]
MASE TPC: 600 Вт, 24% этанол в течение 35 мин; TFC: 800 Вт, 30% этанол в течение 25 мин; TTC: 800 Вт, 30% этанол в течение 15 минут UHPLC / ESI / MS TPC: 373 мг GAE / г; TFC: 155 мг RE / г; ТТС: 317 мг ГАЭ / г.
Идентификация 13 фенольных соединений, в основном эллагитаннинов и гранатина
[61]
PUAE Уровень интенсивности: 105 Вт / см 2 ; рабочий цикл: 50% в течение 10 мин. HPLC-UV-DAD Пуникалагин: 146,58 мг / г; эллаговая кислота: 20,66 мг / г; галловая кислота: 0,053 мг / г [62]
UAE Амплитуда ультразвука 60% в течение 6,2 мин Не указано Выход: 13,1%; TPC: 42,2 мг GAE / г; DPPH: 88%; FRAP: 1824 г.6 мкмоль Fe 2+ / г; IC50: 0,51 мг / мл [23]
UAE Мощность ультразвука 148 Вт, 55 ° C в течение 63 минут с использованием LSR: 24 мл / г Не указано Выход полисахаридов: 13,658% [63]
HIFU Хлорид холина: уксусная кислота: вода (1: 1: 10 M), амплитуда 60% в течение 11 минут HPLC-ESI-Q-TOF / MS Белок: 20 мг /грамм.
Идентификация 23 различных пептидов и 20 различных фенольных соединений, в основном пуникалин, пуникалагин, галлоил-HHDP-гексозид, гексозид эллаговой кислоты и эллаговая кислота
[29]
HPE В зависимости от оцениваемой переменной условия колеблется от 356 до 600 МПа и 32-80% этанола в течение 23-30 минут UHPLC-DAD / LC-DAD / ESI-MS Выход: 31 мг / г; TPC: 52 мг GAE / г; TFC: 20 мг QE / г; ТТС: 2.02 мг САЕ / г; ТАС: 86 мг цид-3-глю / г; ABTS: 269 мг TE / г; DPPH: 314 мг TE / г; FRAP: 436 мг TE / г [64]
HPE + EE Условия HPE: 300 МПа в течение 15 мин; EE: 4% пектиназы и 4% целлюлазы в течение 15 минут HPLC-DAD-MSn Общий выход экстракции: 41%; TPC: 207 мг GAE / г; DPPH: 334 мг TE / г
Идентификация хинной кислоты, изомера пуникалина, двух изомеров бис-HHDP-глюкозида, 2-O-галлоилпуникалагина, двух изомеров пуникалагина, галлоил-HHDP-глюкозида и дигаллоилпентозида
[24] EASCFE EE: коктейльный фермент (смесь целлюлазы, пектиназы и протеазы; 50:25:25) при 3.8%, 49 ° C, pH 6,7 в течение 85 мин; SCFE: этанол в качестве сорастворителя (2 г / мин), 55 ° C, 300 бар в течение 100–120 мин HPLC-DAD-ESI-MS TPC: 301,53 мг GAE / г
Идентификация п-кумаровой кислоты , ванильная кислота, галловая кислота, кофейная кислота, феруловая кислота, сиринговая кислота, синапиновая кислота
[30]

3. Биологическая активность кожуры граната

Как упоминалось ранее, PP содержит разнообразную группу биоактивных молекул, с широким спектром биологического действия и признанными терапевтическими свойствами, включая антиоксидантные, противомикробные, противовоспалительные, антигипергликемические, антигиперлипидемические, противоопухолевые и т. д.[26,28,42,44].

3.1. Антиоксидантная активность

Природные антиоксиданты все чаще используются в пищевой промышленности как заменители менее безопасных синтетических антиоксидантов [7,65]. В связи с этим в литературе широко сообщалось об антиоксидантной активности экстрактов PP. Исмаил и др. [66] протестировали антиоксидантную способность различных экстрактов (водный, 70% этанол, 70% метанол, 70% ацетон) пакистанского сорта граната под названием «Суфайд Алипури». Наибольшее общее содержание фенолов (ОФФ) обнаружено в экстрактах из ацетона (427.2 мг GAE / г экстракта), затем метанол (367,9 мг GAE / г экстракта), этанол (361,8 мг GAE / г экстракта) и вода (273,5 мг GAE / г экстракта). Экстракты ацетона также показали наивысшую антиоксидантную активность, как определено с помощью анализа FRAP (91,40 ммоль Fe / г), в то время как экстракты метанола показали самую высокую антиоксидантную активность методом DPPH (α, α-дифенил-β-пикрилгидразил) [32 мг аскорбиновой кислоты эквивалент на грамм (мг AAE / г)]. В другом исследовании Эль-Хадари и Рамадан [43] сообщили, что метанольный экстракт граната проявляет сильную антиоксидантную активность, измеренную методами DPPH (93.97%) и ABTS (2,2’-азино-ди (3-этилбензотиазолин-6-суслфоновая кислота)) (90,92%), а общее содержание фенолов (TPC) составляет приблизительно 189 мг GAE / г экстракта. Fazio et al. [38] обнаружили значение IC50 0,58 мкг / мл по радикалу DDPH в ацетоновых экстрактах из PP, тогда как для TROLOX (6-гидрокси-2,5,7,8-тетраметилхроман-2-карбоновой кислоты), используемого в качестве стандарт — 0,89 мкг / мл. Напротив, эти экстракты показали меньшее присутствие через радикал ABTS, обнаружив значения 8,02 против 4,06 мкг / мл [38].

3.2. Противомикробная активность

Устойчивость многих микроорганизмов к доступным антибиотикам является серьезной проблемой во всем мире. Это, наряду с растущим интересом потребителей к «натуральным пищевым продуктам», побудило исследователей и пищевую промышленность искать новые альтернативные соединения, которые могут подавлять широкий спектр микроорганизмов [67,68]. В этой связи в нескольких исследованиях сообщалось, что полипропилен является важным источником противомикробных агентов, которые могут защитить пищевые продукты от микроорганизмов, вызывающих порчу, а также минимизировать возникновение болезней пищевого происхождения [26].Гуллон и др. [69] продемонстрировали, что метанольный экстракт в диапазоне 30–60 мг / мл был эффективен против Staphylococcus aureus , Listeria monocytogenes , Listeria innocua , Escherichia coli , Pseudomonas aeruginosa и Salmonella sp. . Другие исследования показали, что ацетоновые экстракты более активны, чем экстракты, полученные с метанолом, этанолом и водой, с зонами ингибирования 21,3, 19,4, 17,5 и 11,6 мм соответственно против Bacillus subtilis [66].Согласно Wafa et al. [56], этанольный экстракт тунисского PP был активен в отношении Salmonella Kentucky, выделенной из куриного мяса, давая значения минимальной ингибирующей концентрации (МИК) и минимальной бактерицидной концентрации (МБК) 10,75 и 11,5 мг / мл соответственно. В интересном исследовании, проведенном Нур Ханани и соавт. [70], полипропилен был использован для разработки активной системы упаковки для предотвращения микробной порчи пищевых продуктов. Результаты показали, что эта пленка проявляла ингибирующий эффект против всех тестируемых бактерий, а именно Listeria monocytogenes , Bacillus cereus , Escherichia coli и Salmonella typhimurium .Авторы объясняют этот антимикробный потенциал высоким содержанием фенольных соединений в ПП, особенно танинов. Эти соединения могут проявлять свою антимикробную активность за счет осаждения мембранных белков, вызывая лизис микробных клеток [68].

3.3. Другие полезные свойства для здоровья

Несколько исследований выявили потенциал экстрактов РР для предотвращения сердечно-сосудистых заболеваний, связанных с диабетом, гиперлипидемией и гипертонией. Ambigaipalan et al. [49] указали, что экстракты PP могут иметь антидиабетический потенциал, связанный с ингибирующим эффектом α-глюкозидазы.Об этом же открытии сообщили Arun et al. [71], которые обнаружили, что очищенные фракции метанольных экстрактов PP улучшают усвоение глюкозы. В этой последней работе авторы также продемонстрировали, что эта фракция более эффективна в ингибировании окисления липопротеинов низкой плотности (ЛПНП), чем аскорбиновая кислота, используемая в качестве эталона (IC50 для экстракта граната составляла 16,2 мг / мл против 24,3 мг / мл для аскорбиновой кислоты). кислота). В исследовании in vivo, проведенном как на диабетических, так и на гиперлипидемических крысах, пероральное введение гидрометанольного экстракта из PP в дозе 200 мг / кг в течение 56 дней лечения значительно снизило уровень глюкозы, гликированный гемоглобин, общий липид, общий холестерин, холестерин ЛПНП и холестерин липопротеинов очень низкой плотности (ЛПОНП), а также повысил уровень холестерина липопротеинов высокой плотности (ЛПВП) [43].Кроме того, авторы также отметили, что прием этого натурального экстракта улучшает функции печени и почек по сравнению с лекарствами, обычно используемыми для лечения этих заболеваний.

PP также содержит фитохимические вещества, способные ингибировать активность ангиотензинпревращающего фермента (АПФ), который участвует в регуляции артериального давления в ренин-ангиотензиновой системе [26]. Arun et al. [71] подтвердили, что экстракт, богатый полифенолами (в основном галловая кислота, п-кумаровая кислота, коричная кислота, кофейная кислота и хлорогеновая кислота), эффективен в качестве ингибитора АПФ.Совсем недавно Эрнандес-Коррото и др. [29,42] связывают эту гипотензивную способность PP с присутствием белков и пептидов.

Некоторые авторы подтвердили, что экстракты PP играют важную роль в инактивации активности тирозиназы, участвующей в процессе меланогенеза (пролиферация меланоцитов и синтез меланина) [34,72,73]. В недавнем исследовании Laosirisathian et al. [73] сообщили, что этанольный экстракт из PP имел более высокую ингибирующую активность в отношении тирозиназы, чем койевая кислота, коммерчески используемая в качестве отбеливающего агента (IC50 для экстракта составляла 0.10 мкг / мл, а для койевой кислоты 7,88 мкг / мл).

Рак стал ведущей причиной смерти в 21 -м веке. Учитывая важное влияние этого заболевания как на человеческие жизни, так и на затраты систем здравоохранения, растет интерес к разработке новых потенциальных методов лечения, которые могут предотвратить, замедлить или замедлить прогрессирование рака. Недавно некоторые исследователи также сообщили о способности экстрактов PP подавлять рост опухолевых клеток [74]. Среди активных агентов, присутствующих в ПП, антиканцерогенные эффекты в основном приписываются пуникалагину, эллаговой кислоте и галловой кислоте [26].Ли и др. [44] протестировали на модели мышей с опухолью BCPAP противоопухолевую эффективность экстракта РР, богатого пуникалагином и эллаговой кислотой, против рака щитовидной железы. Авторы обнаружили, что введение экстракта PP в дозе 125 мг / кг / день привело к снижению роста опухоли на 69,8%. Deng et al. [75] также продемонстрировали, что пуникалагин и эллаговая кислота индуцируют апоптоз в двух клеточных линиях рака простаты человека (DU145, PC3) и в клеточной линии рака простаты мыши (TRAMP-C1). Результаты этого исследования показали, что действие PP на апоптоз опухолевых клеток опосредовано повышением отношения экспрессии Bax / Bcl2 и активацией каспазы-3.Антипролиферативная активность в отношении клеток Т24 рака мочевого пузыря человека также была связана с эллаговой кислотой [51]. В другом исследовании Fazio et al. [38] доказали, что β-глюкан, выделенный из PP, проявляет антипролиферативную активность в отношении клеток рака груди человека MCF-7 и HeLa матки. В целом, результаты этих исследований позволяют предположить, что экстракты полипропилена могут быть использованы в качестве многообещающего лекарства, ориентированного на лечение и профилактику различных типов рака.

Пуникалин, пуникалагин и эллаговая кислота также эффективны в подавлении воспалительных процессов.Недавнее исследование с использованием in vitro модели клеток аденокарциномы толстой кишки человека Caco-2 показало, что водный экстракт PP в дозе 10 мкг / мл приводит к снижению секреции CXCL8 (провоспалительный цитокин с хемотаксической активностью по отношению к T лимфоцитов, базофилов и нейтрофилов) 43% по сравнению с положительным контролем [76]. Стоянович и др. [77] также предположили, что фитохимические вещества, присутствующие в кожуре граната, могут играть важную роль в лечении аутоиммунных и хронических воспалительных заболеваний, таких как рассеянный склероз и диабет 1 типа.В другом исследовании пектины, выделенные из PP, регулировали воспалительный ответ иммунной системы посредством стимуляции макрофагов, естественных клеток-киллеров, дендритных клеток и Т- и В-клеток [35].

4. Роль побочных продуктов граната в приготовлении мясных продуктов

Мясо представляет собой сложную систему, которая содержит воду, белки, липиды, минералы и небольшую часть углеводов. Благодаря этому богатому питательному профилю мясо и мясные продукты легко подвержены микробному росту и реакциям окисления (разложение липидов, белков и пигментов), что приводит к потере их качественных характеристик во время обработки и хранения [4].Более того, микробная порча мяса способствует развитию непривлекательных запахов и привкусов, обесцвечиванию, газообразованию и визуальному восприятию слизи [4]. Чтобы преодолеть эти проблемы, как мясная промышленность, так и академические исследователи предложили различные альтернативы для улучшения качества и срока хранения мяса и мясных продуктов [2].

Синтетические антиоксиданты широко применяются в пищевой промышленности как для уменьшения окислительного разложения, так и для подавления роста бактерий порчи в мясных продуктах [2,7].Однако использование этих синтетических консервантов должно быть ограничено из-за их токсичности и канцерогенности, как сообщалось в нескольких исследованиях [78,79]. Замена синтетических добавок натуральными антиоксидантами является подходящей стратегией для поддержания сенсорных и микробиологических качеств и увеличения срока хранения мясных продуктов [2,4,7]. В этом контексте включение побочных продуктов граната, которые содержат большое количество фенольных соединений, флавоноидов и дубильных веществ с превосходными антиоксидантными свойствами, могло бы заменить искусственные добавки для консервирования скоропортящихся продуктов.Кроме того, субпродукты граната являются хорошим источником пищевых волокон, которые не только улучшают физико-химические свойства мясных продуктов, но и повышают их питательную ценность, придавая им полезные для здоровья функциональные свойства.

Один из мясных продуктов, который был переработан с добавлением побочных продуктов граната и изучен несколькими исследователями, — это фрикадельки. Например, Тургут и др. [80] оценили добавление экстракта кожуры граната (PPE) для замедления окисления липидов и белков в этом мясном продукте.В их исследовании экстракты граната были включены в концентрации 0,5% и 1%, и результаты были сопоставимы с результатами, полученными с использованием синтетического антиоксиданта (BHT на 0,01%) и контрольного эксперимента (без какого-либо антиоксиданта) в течение 8 дней хранения в холодильнике. Авторы обнаружили, что говяжьи фрикадельки, приготовленные с использованием PPE, обладают большей липидной и белковой стабильностью, а также улучшенными сенсорными оценками. В частности, значения TBARS, зарегистрированные в конце хранения, составляли 1,19, 0,71, 0,60 и 0,56 мг МДА / кг для контроля, 0.5% PPE, BHT и 1% PPE соответственно. Что касается белка, окисление оценивали по уровням карбонила и сульфгидрила белка. Процент снижения содержания карбонила белка составлял 25% для 1% PPE и BHT и 12% для 0,5% PPE по сравнению с контролем. В случае уровней сульфгидрила наибольшее значение (40,17 нмоль / мг белка) было получено для 1% PPE, а минимальное значение было для контрольного образца (24,53 нмоль / мг белка). Кроме того, сенсорная оценка показала, что включение СИЗ поддерживало темно-красную или вишнево-красную окраску и предотвращало образование прогорклого запаха в фрикадельках в течение 8 дней хранения в холодильнике.Эти авторы также сообщили о таком же защитном эффекте СИЗ в говяжьих фрикадельках при хранении в замороженном виде в течение 6 месяцев [81]. В целом полученные результаты демонстрируют, что высокое содержание фенольных соединений в PPE, а также их высокая антиоксидантная способность оказывают защитное действие против окисления липидов и белков в мясных продуктах, даже превосходя BHT.

Стремясь продлить срок хранения и повысить безопасность говяжьих фрикаделек, Morsy et al. [82] применили лиофилизированные наночастицы кожуры граната (LPP-NP) в качестве природного антиоксиданта и антимикробного средства в своих рецептурах.После 15 дней хранения при 4 ° C показатели деградации белка (общий азот летучих оснований) и перекисного окисления липидов (пероксидное число и TBARS) фрикаделек, содержащих 1,5% LPP-NP, были ниже, чем показатели, зарегистрированные для образцов с BHT (0,01 %), так и для контроля без антиоксидантов. Кроме того, фрикадельки, обработанные LPP-NP, показали меньший рост микробов во время хранения, что объясняется присутствием фенольных соединений и дубильных веществ в LPP-NP, которые проявляют антимикробную активность. Результаты также показали, что включение LPP-NP улучшило водоудерживающую способность говяжьих фрикаделек.Этот положительный эффект может быть связан с наличием в кожуре граната клетчатки, которая действует как связывающий воду агент. Как и в ранее описанных работах, фрикадельки на основе LPP-NP показали хорошую приемку с высокими показателями по цвету и запаху до 15 дней хранения в холодильнике.

Недавно Fourati et al. [83] исследовали влияние этанольного экстракта кожуры граната (PPEE) в трех различных дозировках (0,1%, 0,5% и 1%) на микробиологическую, окислительную стабильность и сенсорные свойства мясного фарша.После 21 дня хранения в холодильнике значения реакционноспособных веществ с тиобарбитуровой кислотой (TBARS) были значительно ниже ( p <0,05) в образцах мяса с 1% PPEE, чем значения, найденные для контроля без антиоксиданта. Результаты также показали, что та же самая доза экстракта привела к снижению MetMb (56,68%), образованию карбонильных групп (65,71%) и потере сульфгидрильных групп (59,69%) по сравнению с контролем. Кроме того, PPEE подавлял рост микроорганизмов порчи, проявляя дозозависимый защитный эффект.Наконец, сенсорная оценка, касающаяся признаков цвета, внешнего вида и запаха, а также общей приемлемости, показала, что мясо, обработанное 1% PPEE, имело самые высокие баллы. В предыдущем исследовании Qin et al. [84] также сообщили, что экстракт порошка из кожуры граната (PRPE) в дозе 0,02 г экстракта / 100 г мяса показал защитный эффект против окисления липидов в сыром фарше из свинины. Несмотря на то, что обработанные образцы показали изменения цвета и запаха, общая приемлемость была выше, чем в контрольной группе.

Другими переработанными мясными продуктами на основе граната были сосиски и вареные колбасы. Например, Firuzi et al. [85] включили PRPE в количестве 10 мг эквивалента галловой кислоты / 100 г в сосиски, и они отметили, что обработанные образцы демонстрируют более высокую устойчивость к окислению липидов. К концу периода хранения (60 дней при 4 ° C) PRPE достоверно ( p <0,05) снизил пероксидное число на 65,05% и 59,22% соответственно по сравнению с контрольной группой (без добавок).Использование PRPE, а также BHT и нитрита привело к повышению светлоты и тенденции к снижению значений покраснения и желтизны во всех образцах сосисок. Кроме того, образцы, содержащие антиоксиданты (натуральные или синтетические), приводили к меньшему изменению цвета (ΔE), что указывает на их эффективность в замедлении обесцвечивания сосисок во время их хранения в холодильнике.

В другом исследовании вареные колбасы, приготовленные с использованием двух концентраций (5 и 10) коммерческой смеси экстрактов граната и цитрусовых (Naturmix WM ® , MEC Import, Рим, Италия), привели к значительному снижению ( p <0.01) значений TBARS при хранении в холодильном вакууме. Что касается органолептического анализа, результаты показали, что добавление натуральных экстрактов продлевает срок хранения вареных колбас до 60 и 50 дней для доз 10 ‰ и 5, соответственно, по сравнению с контрольной партией (42 дня) [86 ].

Использование побочных продуктов граната в бургерах из говядины [87], а также в котлетах из баранины и говядины [88,89] также оценивалось другими авторами. Шахамирян и др. [87] сообщили, что изменение рецептуры говяжьих гамбургеров с экстрактом порошка из кожуры граната (PRPE) на уровне 0.01% привел к значительно более низким значениям TBARS, задержал количество аэробных бактерий и оказал положительное влияние на стабилизацию цвета по сравнению с контрольным образцом во время хранения в замороженном виде в течение 90 дней. Точно так же гамбургеры, содержащие PRPE, имели наивысшие оценки с точки зрения цвета, вкуса, запаха, текстуры и общей приемлемости. В другом исследовании Bouarab-Chibane et al. [89] также наблюдали, что включение кожуры граната в количестве 10 г / кг в говяжьи котлеты ингибировало окисление липидов и миоглобина и замедляло изменение цвета в конце хранения в атмосфере с высоким содержанием кислорода в течение 12 дней при 4 ° C.Однако авторы заметили, что гамбургеры, содержащие полипропилен, имели более сухую текстуру, что было связано с большим количеством добавленного экстракта. Вопреки результатам этих исследований Andrés et al. [88] обнаружили, что добавление водных экстрактов побочных продуктов граната (1000 мг / кг) в котлеты из баранины приводило к показателям TBARS и свободного тиола, аналогичным контрольному лечению. На основании микробного анализа экстракты граната показали сильное ингибирующее действие на мезофильные и психотропные показатели, что позволяет сделать вывод, что эти экстракты могут применяться в качестве естественных противомикробных добавок для продления срока хранения баранины.

В попытке улучшить как пищевой профиль, так и сенсорные и технологические характеристики мясных продуктов, несколько исследований были сосредоточены на разработке функциональной мышечной пищи на основе пищевых волокон с антиоксидантами [1]. Более того, пищевые волокна (включая пектин), как сообщается, обладают способностью удерживать воду, что может обеспечивать смазывающую способность и ощущение плавления нежирным мясным продуктам [90]. Например, Sharma et al. [91] приготовили котлеты из куриного мяса, добавив кожуру граната (2%) или водный экстракт порошка гранатовой кожуры (6%).Оба типа котлет с измененным составом имеют более высокое содержание фенолов, клетчатки и золы, что обеспечивает дополнительную питательную ценность. Более того, водоудерживающая способность, стабильность эмульсии и выход варки были немного улучшены в обработанных образцах. Как обсуждалось в некоторых из ранее процитированных работ, куриные котлеты с кожурой граната продемонстрировали лучшую защиту от окисления липидов и микробной порчи при хранении в холодильнике по сравнению с образцами, обработанными BHT. Аналогичным образом, Santhi et al.[92] предложили укрепляющий эффект порошка жмыха граната (PPP) при разработке нежирных куриных фрикаделек. По мнению авторов, включение пищевых волокон в куриное мясо было бы подходящим и недорогим выбором для разработки функциональных мясных продуктов с улучшенной питательной ценностью.

Другое исследование, проведенное Devatkal et al. [93] оценили влияние вакуумной упаковки и СИЗ на аспекты качества фарша из козьего мяса и приготовленных наггетсов из козьего мяса в течение 25 дней хранения в холодильнике.Были изучены три вида обработки: аэробная упаковка (AP), вакуумная упаковка (VP) и вакуумная упаковка с PPE в концентрации 1% (VP + PPE). Образцы, обработанные PPE, показали большую устойчивость к окислению липидов со значительно более низкими значениями TBARS, чем AP или VP. Добавление СИЗ снизило уровень TBARS на 41% в мясном фарше и на 40% в наггетсах. Результаты, полученные в этой работе, показали, что комбинация PPE и VP является адекватной стратегией для продления срока хранения козьего мяса и наггетсов.

объединяет результаты исследований, разработанных за последние 10 лет, по включению продуктов из граната в мясные продукты и их основным эффектам.

Таблица 2

Мясные продукты с добавлением экстрактов кожуры граната.

% 4 955 на 8 дней
Мясной продукт Материал Используемое количество Условия хранения Основные эффекты Ссылки
Фрикадельки из говядины PPAE Снижение окисления липидов и белков. Предотвращает образование прогорклого запаха. Увеличенный срок хранения [80]
Замороженные при -18 ° C в течение 6 месяцев [81]
LPP-NPs 1% и 1.5% Охлажден при 4 ° C в течение 15 дней Пониженное содержание пероксида, TBARS и общего содержания летучего основного азота. Повышенное микробиологическое качество. Отсутствие отрицательного воздействия на органолептические свойства [82]
Мясной фарш PPEE 0,1%, 0,5% и 1% Охлаждение при 4 ° C в течение 21 дня Уменьшение окислительного разрушения. Подавление роста микроорганизмов, вызывающих порчу. Более высокий балл по цвету, внешнему виду, запаху и общей приемлемости [83]
Сырой свиной фарш PRPE 0.02% Охлаждение при 4 ° C в течение 12 дней Снижение значений пероксида и TBARS. Пониженное значение яркости. Лучшая общая переносимость обработанных образцов [84]
Франкфуртер PRPE 10 мг GAE / 100 г Охлаждение при 4 ° C в течение 60 дней Снижение значений пероксида и TBARS. Увеличение значения L * и уменьшение значений a * и b * [85]
Вареные колбасы Naturmix WM ® 5 ‰ и 10 ‰ Охлаждение при 4 ° C в течение 60 дней в в вакуумной упаковке Задержка роста общего количества жизнеспособных микроорганизмов, количества психротрофных микробов и Lactobacillus spp.Лучшая переносимость продукта. Увеличенный срок хранения [86]
Бургеры из говядины PRPE 0,01% Замороженные при -18 ° C в течение 90 дней Замедленное окисление липидов. Уменьшение роста аэробных бактерий. Повышение общей приемлемости продукта [87]
Котлеты из говядины PP 10 г / кг Охлаждение при 4 ° C в течение 12 дней в атмосфере с высоким содержанием O 2 Уменьшение TBARS уровни.Уменьшите значение покраснения. Изменены текстура и вкус [89]
Котлеты из баранины POM 1000 мг / кг Охлаждение при 2 ° C в течение 7 дней Уменьшает рост мезофильных и психротрофных бактерий [88 ]
Куриные котлеты PP / PPAE 2% и 6% Охлаждение при 4 ° C в течение 16 дней Повышенное содержание фенолов, клетчатки и золы. Улучшение водоудерживающей способности, стабильности эмульсии и выхода готовки.Замедленное окисление липидов и разрушение микробов. [91]
Куриные котлеты с низким содержанием жира PPP 0,5%, 1%, 1,5% и 2% Не указано Повышение уровня клетчатки. Снижение сенсорных оценок с увеличением% PPP [92]
Козий фарш и вареные наггетсы PPE 1% AP и VP в течение 25 дней при 4 ° C Уменьшение содержания TBARS . Увеличенный срок хранения [93]
Паштет из мяса СИЗ 7.5% ( v / v ) Охлаждение при 4 ° C в течение 46 дней Ингибирование Listeria monocytogenes [94]

5. Выводы и будущие тенденции

Потребление плодов граната выросло за последние десятилетия из-за их превосходной пользы для здоровья и образования огромного количества побочных продуктов, которые обычно выбрасываются или используются недостаточно. Однако эти остатки содержат значительные количества биоактивных соединений с потенциальными функциональными свойствами.В частности, PP был описан как богатый и многообещающий источник биомолекул с продемонстрированной биоактивностью, такой как антиоксидант, антимикробное, противовоспалительное, антигипергликемическое, антигиперлипидемическое и противоопухолевое средство, что делает его пригодным для использования в качестве натуральной добавки в пищевые продукты. В этом контексте мясная промышленность ищет альтернативы синтетическим консервантам, чтобы гарантировать стабильность и в то же время продлить срок хранения, что привело бы к более здоровым мясопродуктам. Исследования, собранные в этом обзоре, показали, что включение полипропилена и его экстрактов в эти продукты является подходящей стратегией для улучшения их качественных и функциональных свойств.Такой подход открывает новое поле в мясном секторе: функциональность переработанных мясных продуктов с учетом новых требований потребителей. Более того, повторное использование этих агропродовольственных остатков в другой пищевой промышленности будет способствовать модели замкнутой экономики, основанной на устойчивых процессах. Тем не менее, дальнейшие будущие исследования, сфокусированные на биодоступности биоактивных соединений из полипропилена, добавленных в мясные продукты, являются обязательными, чтобы доказать их влияние на здоровье.

Благодарности

г.A. благодарит Университет Виго за его контракт, поддержанный «Programa de retención de talentovestigador da Universidade de Vigo para o 2018». Б.Г. благодарит за поддержку постдокторских стипендий со стороны Министерства экономики и конкурентоспособности (MINECO, Испания) программы «Рамон и Кахаль» (номер гранта RYC2018-026177-I). Г.А. благодарит CITACA за лицензию на программное обеспечение ChemDraw Professional v.19.0, финансируемую CITACA Strategic Partnership ED431E 2018/07 (Xunta de Galicia, Испания). J.M.L. является членом сети HealthyMeat, финансируемой CYTED (исх.119RT0568).

Вклад авторов

Концептуализация, Б.Г .; письменность — подготовка оригинала черновика, П.Г., Б.Г .; написание — просмотр и редактирование, P.G., G.A., B.G., I.T., J.M.L. Все авторы прочитали и согласились с опубликованной версией рукописи.

Финансирование

Спасибо GAIN (Axencia Galega de Innovación) за поддержку этого исследования (номер гранта IN607A2019 / 01).

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Ссылки

1.Das A.K., Nanda P.K., Madane P., Biswas S., Das A., Zhang W., Lorenzo J.M. Комплексный обзор функциональных продуктов на основе мяса, обогащенных антиоксидантными пищевыми волокнами. Trends Food Sci. Technol. 2020; 99: 323–336. DOI: 10.1016 / j.tifs.2020.03.010. [CrossRef] [Google Scholar] 2. Gullón B., Gagaoua M., Barba F.J., Gullón P., Zhang W., Lorenzo J.M. Морские водоросли как многообещающий источник биологически активных соединений: Обзор новых стратегий экстракции и дизайн мясных продуктов, приготовленных по индивидуальному заказу. Trends Food Sci. Technol. 2020; 100: 1–18.DOI: 10.1016 / j.tifs.2020.03.039. [CrossRef] [Google Scholar] 3. Cunha L.C.M., Monteiro M.L.G., Lorenzo J.M., Munekata P.E.S., Muchenje V., de Carvalho F.A.L., Conte-Junior C.A. Натуральные антиоксиданты при переработке и стабильности при хранении продуктов из мяса овец и коз. Food Res. Int. 2018; 111: 379–390. DOI: 10.1016 / j.foodres.2018.05.041. [PubMed] [CrossRef] [Google Scholar] 4. Lorenzo J.M., Munekata P.E.S., Sant A.S., Baptista R., Barba F.J., Toldrá F., Mora L., Trindade M.A. Основные характеристики кожуры арахиса и ее роль в сохранении мясных продуктов.Trends Food Sci. Technol. 2018; 77: 1–10. DOI: 10.1016 / j.tifs.2018.04.007. [CrossRef] [Google Scholar] 5. Домингес Р., Патейро М., Гагауа М., Барба Ф. Дж., Чжан В., Лоренцо Дж. М. Комплексный обзор окисления липидов в мясе и мясных продуктах. Антиоксиданты. 2019; 8: 429. DOI: 10.3390 / antiox8100429. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 6. Лоренцо Дж. М., Батлле Р., Гомес М. Увеличение срока хранения мяса жеребенка с помощью двух систем упаковки с активными антиоксидантами. LWT Food Sci. Technol.2014; 59: 181–188. DOI: 10.1016 / j.lwt.2014.04.061. [CrossRef] [Google Scholar] 7. Smaoui S., Hlima H.B., Mtibaa A.C., Fourati M., Sellem I., Elhadef K., Ennouri K., Mellouli L. Кожура граната как источник фенольных соединений: передовые аналитические стратегии и практическое использование в мясных продуктах. Meat Sci. 2019; 158: 107914. DOI: 10.1016 / j.meatsci.2019.107914. [PubMed] [CrossRef] [Google Scholar] 8. Lorenzo J.M., Munekata P.E.S., Pateiro M., Campagnol P.C.B., Domínguez R. Здоровый испанский сальчичон, обогащенный инкапсулированными жирными кислотами с длинной цепью n-3 в матрице конжака глюкоманнана.Food Res. Int. 2016; 89: 289–295. DOI: 10.1016 / j.foodres.2016.08.012. [PubMed] [CrossRef] [Google Scholar] 9. de Carvalho FAL, Lorenzo JM, Pateiro M., Bermúdez R., Purriños L., Trindade MA Влияние семян гуараны ( Paullinia cupana ) и экстрактов листьев питанги ( Eugenia uniflora L.) на бургеры из баранины с заменой жира Эмульсия масла чиа при хранении в течение срока годности при 2 ° C. Food Res. Int. 2019; 125: 108554. DOI: 10.1016 / j.foodres.2019.108554. [PubMed] [CrossRef] [Google Scholar] 10.Heck R.T., Saldaña E., Lorenzo J.M., Correa L.P., Fagundes M.B., Cichoski A.J., de Menezes C.R., Wagner R., Campagnol P.C.B. Гидрогелированная эмульсия из масел чиа и льняного семени: многообещающая стратегия для производства обезжиренных гамбургеров с более здоровым липидным профилем. Meat Sci. 2019; 156: 174–182. DOI: 10.1016 / j.meatsci.2019.05.034. [PubMed] [CrossRef] [Google Scholar] 11. Franco D., Martins A.J., López-Pedrouso M., Cerqueira M.A., Purriños L., Pastrana L.M., Vicente A.A., Zapata C., Lorenzo J.M. Оценка олеогелей льняного масла для частичной замены свиного шпика в ферментированных колбасах.J. Sci. Продовольственное сельское хозяйство. 2020; 100: 218–224. DOI: 10.1002 / jsfa.10025. [PubMed] [CrossRef] [Google Scholar] 12. Патейро М., Барба Ф.Дж., Домингес Р., Сант’Ана А.С., Мусави Ханегха А., Гавахиан М., Гомес Б., Лоренцо Дж.М. Эфирные масла в качестве натуральных добавок для предотвращения реакций окисления в мясе и мясных продуктах: обзор. Food Res. Int. 2018; 113: 156–166. DOI: 10.1016 / j.foodres.2018.07.014. [PubMed] [CrossRef] [Google Scholar] 13. Лоренцо Дж. М., Патейро М., Домингес Р., Барба Ф. Дж., Путник П., Ковачевич Д.Б., Шпигельман А., Гранато Д., Франко Д. Экстракты ягод как природные антиоксиданты в мясных продуктах: обзор. Food Res. Int. 2018; 106: 1095–1104. DOI: 10.1016 / j.foodres.2017.12.005. [PubMed] [CrossRef] [Google Scholar] 14. Falowo A.B., Mukumbo F.E., Idamokoro E.M., Lorenzo J.M., Afolayan A.J., Muchenje V. Многофункциональное применение Moringa oleifera Lam. в питании и пищевых продуктах животного происхождения: обзор. Food Res. Int. 2018; 106: 317–334. DOI: 10.1016 / j.foodres.2017.12.079. [PubMed] [CrossRef] [Google Scholar] 15.Ugčić T., Abdelkebir R., Alcantara C., Collado MC, García-Pérez JV, Meléndez-Martínez AJ, Režek Jambrak A., Lorenzo JM, Barba FJ От экстракции ценных соединений до полезных свойств оливковых листьев благодаря биодоступности, биодоступность и влияние на микробиоту кишечника. Trends Food Sci. Technol. 2019; 83: 63–77. DOI: 10.1016 / j.tifs.2018.11.005. [CrossRef] [Google Scholar] 16. Кальдерон-Оливер М., Лопес-Эрнандес Л.Х. Пищевые овощные и фруктовые отходы, используемые в мясных продуктах. Food Rev.Int. 2020; 00: 1–27. DOI: 10.1080 / 87559129.2020.1740732. [CrossRef] [Google Scholar] 17. Munekata P.E.S., Rocchetti G., Pateiro M., Lucini L., Domínguez R., Lorenzo J.M. Добавление растительных экстрактов к мясу и мясным продуктам для увеличения срока хранения и улучшения здоровья: обзор. Curr. Opin. Food Sci. 2020; 31: 81–87. DOI: 10.1016 / j.cofs.2020.03.003. [CrossRef] [Google Scholar] 18. Эчегарай Н., Гомес Б., Барба Ф. Дж., Франко Д., Эстевес М., Карбалло Дж., Маршалек К., Лоренцо Дж. М. Каштаны и побочные продукты как источник природных антиоксидантов в мясе и мясных продуктах: обзор.Trends Food Sci. Technol. 2018; 82: 110–121. DOI: 10.1016 / j.tifs.2018.10.005. [CrossRef] [Google Scholar] 19. Домингес Р., Гуллон П., Патейро М., Мунеката П.Э.С., Чжан В., Лоренцо Дж. М. Томат как потенциальный источник натуральных добавок для мясной промышленности. Обзор. Антиоксиданты. 2020; 9: 73. DOI: 10.3390 / antiox

73. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 20. Путник П., Бурсач Ковачевич Д., Резек Ямбрак А., Барба Ф. Дж., Кравотто Г., Бинелло А., Лоренцо Дж. М., Шпигельман А. Инновационные «зеленые» и новые стратегии извлечения биоактивных соединений с добавленной стоимостью из цитрусовых отходов — A рассмотрение.Молекулы. 2017; 22: 680. DOI: 10,3390 / молекулы22050680. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 21. Franco D., Pateiro M., Rodríguez Amado I., López Pedrouso M., Zapata C., Vázquez J.A., Lorenzo J.M. Антиоксидантная способность экстрактов кожуры картофеля ( Solanum tuberosum ) ингибировать окисление соевого масла. Евро. J. Lipid Sci. Technol. 2016; 118: 1891–1902. DOI: 10.1002 / ejlt.201500419. [CrossRef] [Google Scholar] 22. Роселло-сото Э., Барба Ф.Дж., Лоренцо Х.М., Мунеката П.Э.С., Гомес Б., Карлос Дж. Фенольный профиль масел, полученных из побочных продуктов «орчаты» с помощью сверхкритического CO 2 , и его взаимосвязь с параметрами антиоксидантного и липидного окисления: Тройная характеристика TOF-LC-MS-MS. Food Chem. 2019; 274: 865–871. DOI: 10.1016 / j.foodchem.2018.09.055. [PubMed] [CrossRef] [Google Scholar] 23. Sharayei P., Azarpazhooh E., Zomorodi S., Ramaswamy H.S. Экстракция биологически активных соединений из кожуры граната ( Punica granatum L.) с помощью ультразвука.LWT Food Sci. Technol. 2019; 101: 342–350. DOI: 10.1016 / j.lwt.2018.11.031. [CrossRef] [Google Scholar] 24. Alexandre E.M.C., Silva S., Santos S.A.O., Silvestre A.J.D., Duarte M.F., Saraiva J.A., Pintado M. Противомикробная активность экстрактов кожуры граната, полученная путем экстракции под высоким давлением и с помощью ферментов. Food Res. Int. 2019; 115: 167–176. DOI: 10.1016 / j.foodres.2018.08.044. [PubMed] [CrossRef] [Google Scholar] 25. Кадеридис К., Папаоиконому Л., Серафим М., Гула А.М. Экстракция фенольных соединений из кожуры граната с помощью микроволн: оптимизация, кинетика и сравнение с экстракцией ультразвуком.Chem. Англ. Процесс. Process Intensif. 2019; 137: 1–11. DOI: 10.1016 / j.cep.2019.01.006. [CrossRef] [Google Scholar] 26. Сингх Б., Сингх Дж. П., Каур А., Сингх Н. Фенольные соединения как полезные фитохимические вещества в кожуре граната ( Punica granatum L.): обзор. Food Chem. 2018; 261: 75–86. DOI: 10.1016 / j.foodchem.2018.04.039. [PubMed] [CrossRef] [Google Scholar] 27. Пирзаде М., Капорасо Н., Рауф А., Шариати М.А., Есимбеков З., Хан М.Ю., Имран М., Мубарак М.С. Гранат как источник биоактивных компонентов: обзор их характеристик, свойств и применения.Крит. Rev. Food Sci. Nutr. 2020; 0: 1–18. DOI: 10.1080 / 10408398.2020.1749825. [PubMed] [CrossRef] [Google Scholar] 28. Андраде М.А., Лима В., Санчес Сильва А., Вилариньо Ф., Кастильо М.С., Хвалдиа К., Рамос Ф. Побочные продукты из граната и винограда и их активные соединения: являются ли они ценным источником для пищевых продуктов? Trends Food Sci. Technol. 2019; 86: 68–84. DOI: 10.1016 / j.tifs.2019.02.010. [CrossRef] [Google Scholar] 29. Эрнандес-Коррото Э., Plaza M., Marina M.L., García M.C. Устойчивое извлечение белков и биологически активных веществ из кожуры граната ( Punica granatum L.) с использованием жидкостей под давлением и глубоких эвтектических растворителей. Иннов. Food Sci. Emerg. Technol. 2020; 60: 102314. DOI: 10.1016 / j.ifset.2020.102314. [CrossRef] [Google Scholar] 30. Муштак М., Султана Б., Анвар Ф., Аднан А., Ризви С.С.Х. Ферментная сверхкритическая жидкостная экстракция фенольных антиоксидантов из кожуры граната. J. Supercrit. Жидкости. 2015; 104: 122–131. DOI: 10.1016 / j.supflu.2015.05.020. [CrossRef] [Google Scholar] 31. Бар-Яаков И., Тиан Л., Амир Р., Холланд Д. Первичные метаболиты, антоцианы и гидролизуемые танины в плодах граната.Передний. Plant Sci. 2019; 10: 1–19. DOI: 10.3389 / fpls.2019.00620. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32. Талекар С., Патти А.Ф., Виджайрагхаван Р., Арора А. Комплексный экологический подход к биопереработке, направленный на одновременное извлечение пектина и полифенолов в сочетании с производством биоэтанола из отходов кожуры граната. Биоресурсы. Technol. 2018; 266: 322–334. DOI: 10.1016 / j.biortech.2018.06.072. [PubMed] [CrossRef] [Google Scholar] 33. Дранка Ф., Ороян М. Извлечение, очистка и характеристика пектина из альтернативных источников с потенциальными технологическими применениями.Food Res. Int. 2018; 113: 327–350. DOI: 10.1016 / j.foodres.2018.06.065. [PubMed] [CrossRef] [Google Scholar] 34. Балли Д., Чекки Л., Хатиб М., Беллумори М., Кайрон Ф., Каррадори С., Зенгин Г., Чеза С., Инноченти М., Мулиначчи Н. Характеристика сока плодов и отвара кожуры пятнадцати разновидностей punica Granatum L .: Акцент на антоцианы, эллагитаннины и полисахариды. Антиоксиданты. 2020; 9: 238. DOI: 10.3390 / antiox

38. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 35. Гавлиги Х.А., Табарса М., Ю С.Г., Сурайот У., Гадери-Гахфарохи М. Экстракция, характеристика и иммуномодулирующие свойства пектинового полисахарида из кожуры граната: энзиматический и традиционный подход. Int. J. Biol. Макромол. 2018; 116: 698–706. DOI: 10.1016 / j.ijbiomac.2018.05.083. [PubMed] [CrossRef] [Google Scholar] 36. Абид М., Ренар С.М.Г.С., Ватрелот А.А., Фендри И., Аттиа Х., Аяди М.А. Выход и состав пектина, экстрагированного из кожуры тунисского граната. Int. J. Biol. Макромол. 2016; 93: 186–194.DOI: 10.1016 / j.ijbiomac.2016.08.033. [PubMed] [CrossRef] [Google Scholar] 37. Шахматов Е.Г., Макарова Е.Н., Белый В.А. Структурные исследования биологически активных пектинсодержащих полисахаридов граната Punica granatum . Int. J. Biol. Макромол. 2019; 122: 29–36. DOI: 10.1016 / j.ijbiomac.2018.10.146. [PubMed] [CrossRef] [Google Scholar] 38. Fazio A., Iacopetta D., La Torre C., Ceramella J., Muià N., Catalano A., Carocci A., Sinicropi M.S. Поиск решений для сельскохозяйственных отходов: антиоксидантные и противоопухолевые свойства экстрактов кожуры граната Akko и восстановление β-глюкана.Food Funct. 2018; 9: 6619–6632. DOI: 10.1039 / C8FO01394B. [PubMed] [CrossRef] [Google Scholar] 39. Хан Б., Баруа К., Кокс Э., Ванромпей Д., Босье П. Взаимосвязь структурно-функциональной активности β-глюканов с точки зрения иммуномодуляции: мини-обзор. Передний. Иммунол. 2020; 11: 1–8. DOI: 10.3389 / fimmu.2020.00658. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 40. Джалал Х., Пал М.А., Ахмад С.Р., Скорее М., Андраби М., Хамдани С. Физико-химические и функциональные свойства кожуры и порошка семян граната.J. Pharm. Иннов. 2018; 7: 1127–1131. [Google Scholar] 41. Ровайшед Г., Салама А., Абул-Фадл М., Акила-Хамза С., Эмад А.М. Пищевая и химическая оценка порошков кожуры плодов и семян граната ( Punica granatum L.). Ближний Восток J. Appl. Sci. 2013; 3: 169–179. [Google Scholar] 42. Эрнандес-Коррото Э., Марина М.Л., Гарсия М.С. Экстракция и идентификация с помощью масс-спектрометрии высокого разрешения биоактивных веществ в различных экстрактах, полученных из кожуры граната.J. Chromatogr. А. 2019; 1594: 82–92. DOI: 10.1016 / j.chroma.2019.02.018. [PubMed] [CrossRef] [Google Scholar] 43. Эль-Хадари А.Е., Рамадан М.Ф. Фенольные профили, антигипергликемические, антигиперлипидемические и антиоксидантные свойства экстракта кожуры граната ( Punica granatum ). J. Food Biochem. 2019; 43: 1–9. DOI: 10.1111 / jfbc.12803. [PubMed] [CrossRef] [Google Scholar] 44. Ли Ю., Е Т., Ян Ф., Ху М., Лян Л., Хэ Х., Ли З., Цзэн А., Ли Ю., Яо Ю. и др. Punica granatum (гранатовый) экстракт кожуры оказывает сильное противоопухолевое и антиметастазное действие при раке щитовидной железы.RSC Adv. 2016; 6: 84523–84535. DOI: 10.1039 / C6RA13167K. [CrossRef] [Google Scholar] 45. Росас-Бургос E.C., Бургос-Эрнандес А., Ногера-Артиага Л., Качаниова М., Эрнандес-Гарсия Ф., Карденас-Лопес Х.Л., Карбонелл-Баррачина А.А. Противомикробная активность экстрактов кожуры граната в зависимости от сорта. J. Sci. Продовольственное сельское хозяйство. 2017; 97: 802–810. DOI: 10.1002 / jsfa.7799. [PubMed] [CrossRef] [Google Scholar] 46. Руссо М., Фанали С., Триподо Г., Дуго П., Мулео Р., Дуго Л., Де Гара Л., Монделло Л. Анализ фенольных соединений в различных частях плодов граната ( Punica granatum ) с помощью ВЭЖХ -PDA-ESI / MS и оценка их антиоксидантной активности: Применение к различным итальянским сортам.Анальный. Биоанал. Chem. 2018; 410: 3507–3520. DOI: 10.1007 / s00216-018-0854-8. [PubMed] [CrossRef] [Google Scholar] 47. Янь Л., Чжоу X., Ши Л., Шалиму Д., Ма К., Лю Ю. Фенольные профили и антиоксидантная активность шести сортов китайского граната ( Punica granatum L.). Int. J. Food Prop. 2017; 20: S94 – S107. DOI: 10.1080 / 102.2017.1289960. [CrossRef] [Google Scholar] 48. Ли Дж., Хе X., Ли М., Чжао В., Лю Л., Конг X. Химический анализ отпечатков пальцев и количественный анализ для контроля качества полифенолов, экстрагированных из кожуры граната с помощью ВЭЖХ.Food Chem. 2015; 176: 7–11. DOI: 10.1016 / j.foodchem.2014.12.040. [PubMed] [CrossRef] [Google Scholar] 49. Амбигайпалан П., Де Камарго А.С., Шахиди Ф. Фенольные соединения побочных продуктов граната (внешняя кожа, мезокарпий, разделительная мембрана) и их антиоксидантная активность. J. Agric. Food Chem. 2016; 64: 6584–6604. DOI: 10.1021 / acs.jafc.6b02950. [PubMed] [CrossRef] [Google Scholar] 50. Мфахлеле Р.Р., Фаволе О.А., Макунга Н.П., Линус Опара У. Функциональные свойства частей плодов граната: влияние систем упаковки и времени хранения.J. Food Meas. Charact. 2017; 11: 2233–2246. DOI: 10.1007 / s11694-017-9608-0. [CrossRef] [Google Scholar] 51. Masci A., Coccia A., Lendaro E., Mosca L., Paolicelli P., Cesa S. Оценка различных методов экстракции из цельных плодов или кожуры граната, а также антиоксидантной и антипролиферативной активности полифенольной фракции. Food Chem. 2016; 202: 59–69. DOI: 10.1016 / j.foodchem.2016.01.106. [PubMed] [CrossRef] [Google Scholar] 52. Гардели К., Варела К., Крокида Э., Маллоучос А. Исследование стабильности антоцианов из гранатового сока ( Punica Granatum L.Cv Ermioni) при моделировании процесса пищеварения. Лекарства. 2019; 6: 90. DOI: 10.3390 / лекарства6030090. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 53. Бен-Симхон З., Юдейнштейн С., Трейнин Т., Харель-Бежа Р., Бар-Яаков И., Борохов-Неори Х., Голландия Д. «Белый» гранат без антоцианов ( Punica granatum L. ), вызванного вставкой в ​​кодирующую область гена лейкоантоцианидиндиоксигеназы (LDOX; ANS). PLoS ONE. 2015; 10: 1–21. DOI: 10.1371 / journal.pone.0142777. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 54.Ромео Ф.В., Баллистрери Г., Фаброни С., Пангалло С., Ли Дестри Никосия М.Г., Шена Л., Раписарда П. Химическая характеристика различных экстрактов сумаха и граната, эффективных против гнили Botrytis cinerea . Молекулы. 2015; 20: 11941–11958. DOI: 10,3390 / молекулы200711941. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 55. Абид М., Яич Х., Чейхроуху С., Хемахем И., Буазиз М., Аттиа Х., Аяди М.А. Антиоксидантные свойства и характеристика фенольного профиля с помощью ЖХ-МС / МС выбранных тунисских корок граната.J. Food Sci. Technol. 2017; 54: 2890–2901. DOI: 10.1007 / s13197-017-2727-0. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 56. Wafa BA, Makni M., Ammar S., Khannous L., Hassana AB, Bouaziz M., Es-Safi NE, Gdoura R. Противомикробный эффект тунисского сорта Nana Punica granatum L. экстракты против Salmonella enterica ( serovars Kentucky и Enteritidis), выделенный из куриного мяса и фенольный состав экстракта его кожуры. Int. J. Food Microbiol. 2017; 241: 123–131.DOI: 10.1016 / j.ijfoodmicro.2016.10.007. [PubMed] [CrossRef] [Google Scholar] 57. Морейра Х., Слезак А., Шижка А., Ошмиански Дж., Гасиоровски К. Антиоксидантная и химиопрофилактическая активность полифенолов ладанника и граната в отношении рака. Acta Pol. Pharm. 2017; 74: 688–698. [PubMed] [Google Scholar] 58. Fernandes L., Pereira J.A.C., Lopéz-cortés I., Salazar D.M., Ramalhosa E.C.D. Физико-химические изменения и антиоксидантная активность сока, кожицы, пленки и семян граната (сорт Mollar de Elche) на разных стадиях созревания.Food Technol. Biotechnol. 2015; 53: 397–406. DOI: 10.17113 / ftb.53.04.15.3884. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 59. Подробнее P.R., Arya S.S. Новая экстракция зеленой точки помутнения и отделение фенолов и флавоноидов из кожуры граната: исследование оптимизации с использованием RCCD. J. Environ. Chem. Англ. 2019; 7: 103306. DOI: 10.1016 / j.jece.2019.103306. [CrossRef] [Google Scholar] 60. Раджа Х.Н., Мханна Т., Эль Кантар С., Эль Хури А., Лука Н., Марун Р.Г. Инновационный процесс извлечения полифенолов из кожуры граната путем сочетания зеленых глубоких эвтектических растворителей и новой инфракрасной технологии.LWT Food Sci. Technol. 2019; 111: 138–146. DOI: 10.1016 / j.lwt.2019.05.004. [CrossRef] [Google Scholar] 61. Oualcadi Y., Sebban M.F., Berrekhis F. Улучшение микроволновой экстракции Сокслета биологически активных соединений, применяемых для кожуры граната. J. Food Process. Консерв. 2020; 44: 1–12. DOI: 10.1111 / jfpp.14409. [CrossRef] [Google Scholar] 62. Каземи М., Карим Р., Мирхоссейни Х., Абдул Хамид А. Оптимизация технологии с использованием импульсного ультразвука для извлечения фенольных соединений из кожуры граната сорта Malas: Пуникалагин и гидроксибензойные кислоты.Food Chem. 2016; 206: 156–166. DOI: 10.1016 / j.foodchem.2016.03.017. [PubMed] [CrossRef] [Google Scholar] 63. Zhu C.P., Zhai X.C., Li L.Q., Wu X.X., Li B. Оптимизация поверхности отклика при экстракции полисахаридов с помощью ультразвука из кожуры граната. Food Chem. 2015; 177: 139–146. DOI: 10.1016 / j.foodchem.2015.01.022. [PubMed] [CrossRef] [Google Scholar] 64. Alexandre E.M.C., Araújo P., Duarte M.F., de Freitas V., Pintado M., Saraiva J.A. Экспериментальный дизайн, моделирование и оптимизация экстракции биологически активных соединений из кожуры граната под высоким давлением.Food Bioprocess Technol. 2017; 10: 886–900. DOI: 10.1007 / s11947-017-1867-6. [CrossRef] [Google Scholar] 65. Кандылис П., Коккиномагулос Э. Пищевые применения и потенциальная польза для здоровья граната и его производных. Еда. 2020; 9: 122. DOI: 10.3390 / foods

22. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 66. Исмаил Т., Ахтар С., Сестили П., Риаз М., Исмаил А., Лаббе Р.Г. Богатые фенолами водно-спиртовые экстракты кожуры граната обладают антиоксидантным, антимикробным и ингибирующим действием на уреазу.J. Food Biochem. 2016; 40: 550–558. DOI: 10.1111 / jfbc.12250. [CrossRef] [Google Scholar] 67. Алирезалу К., Патейро М., Ягуби М., Алирезалу А., Пейгамбардуст С.Х., Лоренцо Дж.М. Фитохимические компоненты, передовые технологии экстракции и техно-функциональные свойства выбранных средиземноморских растений для использования в мясных продуктах. Комплексный обзор. Trends Food Sci. Technol. 2020; 100: 292–306. DOI: 10.1016 / j.tifs.2020.04.010. [CrossRef] [Google Scholar] 68. Морейра Д., Гуллон Б., Гуллон П., Гомес А., Тавария Ф. Биоактивная упаковка с использованием экстрактов антиоксидантов для предотвращения микробной порчи пищевых продуктов. Food Funct. 2016; 7: 3273–3282. DOI: 10.1039 / C6FO00553E. [PubMed] [CrossRef] [Google Scholar] 69. Гуллон Б., Пинтадо М.Е., Перес-Альварес Я.А., Виуда-Мартос М. Оценка полифенольного профиля и антибактериальной активности муки из кожуры граната ( Punica granatum ), полученной из побочного продукта экстракции сока. Контроль пищевых продуктов. 2016; 59: 94–98. DOI: 10.1016 / j.foodcont.2015.05.025. [CrossRef] [Google Scholar] 70.Нур Ханани З.А., Эльма Хусна А.Б., Нурул Сяхида С., Нор Хайзура М.А.Б., Джамила Б. Влияние различных фруктовых кожуры на функциональные свойства двухслойных пленок из желатина / полиэтилена для активной упаковки. Пищевая упаковка. Срок годности. 2018; 18: 201–211. DOI: 10.1016 / j.fpsl.2018.11.004. [CrossRef] [Google Scholar] 71. Арун К.J. Food Process. Консерв. 2017; 41: 1–12. DOI: 10.1111 / jfpp.13108. [CrossRef] [Google Scholar] 72. Кан С.Дж., Чой Б.Р., Ли Е.К., Ким С.Х., Йи Х.Й., Пак Х.Р., Сон Ч., Ли Й.Дж., Ку С.К. Ингибирующее действие концентрированного порошка сушеного граната на меланогенез в клетках меланомы B16F10; вовлечение сигнальных путей p38 и PKA. Int. J. Mol. Sci. 2015; 16: 24219–24242. DOI: 10.3390 / ijms161024219. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 73. Лаосирисатиан Н., Саенджум К., Сиритхуньялуг Дж., Eitssayeam S., Sirithunyalug B., Chaiyana W. Химический состав, антиоксидантная и антитирозиназная активность, а также раздражающие свойства экстракта кожуры sripanya Punica granatum . Косметические средства. 2020; 7: 7. DOI: 10.3390 / cosmetics7010007. [CrossRef] [Google Scholar] 74. Tortora K., Femia AP, Romagnoli A., Sineo I., Khatib M., Mulinacci N., Giovannelli L., Caderni G. Побочные продукты граната в химиопрофилактике колоректального рака: эффекты на Apc-мутантных pirc крысах и механистические исследования In Vitro и Ex Vivo .Мол. Nutr. Food Res. 2018; 62: 1–10. DOI: 10.1002 / mnfr.201700401. [PubMed] [CrossRef] [Google Scholar] 75. Дэн Ю., Ли Ю., Ян Ф., Цзэн А., Ян С., Ло Ю., Чжан Ю., Се Ю., Е Т., Ся Ю. и др. Экстракт кожуры Punica granatum (гранат) вызывает апоптоз и препятствует метастазированию в раковые клетки простаты. Биомед. Фармакотер. 2017; 93: 976–984. DOI: 10.1016 / j.biopha.2017.07.008. [PubMed] [CrossRef] [Google Scholar] 76. Мастрогиованни Ф., Мухопадхья А., Ласетера Н., Райан М.Т., Романи А., Бернини Р., Суини Т. Противовоспалительное действие экстрактов кожуры граната на клетки caco-2 кишечника человека in vitro и эксплантаты ткани толстой кишки свиньи ex vivo. Питательные вещества. 2019; 11: 548. DOI: 10.3390 / nu11030548. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 77. Стоянович И., Шавикин К., Жедович Н., Живкович Ю., Саксида Т., Момчилович М., Копривица И., Вуичич М., Станисавлевич С., Милькович Э. и др. Экстракт кожуры граната улучшает аутоиммунитет на животных моделях рассеянного склероза и диабета 1 типа.J. Funct. Еда. 2017; 35: 522–530. DOI: 10.1016 / j.jff.2017.06.021. [CrossRef] [Google Scholar] 78. EFSA (European Food Safety Authority) Научное заключение о переоценке бутилированного гидроксианизола — BHA (E 320) в качестве пищевой добавки. EFSA J. 2011; 9: 2392. DOI: 10.2903 / j.efsa.2011.2392. [CrossRef] [Google Scholar] 79. EFSA (European Food Safety Authority) Научное заключение о переоценке бутилированного гидрокситолуола BHT (E 321) в качестве пищевой добавки. EFSA J. 2012; 10: 2588. DOI: 10.2903 / j.efsa.2012.2588. [CrossRef] [Google Scholar] 80. Тургут С.С., Сойер А., Ишикчи Ф. Влияние экстракта кожуры граната на окисление липидов и белков в говяжьих фрикадельках при хранении в холодильнике. Meat Sci. 2016; 116: 126–132. DOI: 10.1016 / j.meatsci.2016.02.011. [PubMed] [CrossRef] [Google Scholar] 81. Тургут С.С., Ишикчи Ф., Сойер А. Антиоксидантная активность экстракта кожуры граната в отношении окисления липидов и белков в говяжьих фрикадельках при хранении в замороженном виде. Meat Sci. 2017; 129: 111–119. DOI: 10.1016 / j.meatsci.2017.02.019. [PubMed] [CrossRef] [Google Scholar] 82. Морси М.К., Мекави Э., Эльсабаг Р. Влияние наночастиц кожуры граната на качественные характеристики фрикаделек при хранении в холодильнике. LWT Food Sci. Technol. 2018; 89: 489–495. DOI: 10.1016 / j.lwt.2017.11.022. [CrossRef] [Google Scholar] 83. Fourati M., Smaoui S., Ben Hlima H., Ennouri K., Chakchouk Mtibaa A., Sellem I., Elhadef K., Mellouli L. Синхронизированная взаимосвязь между анализом окисления липидов / белков и сенсорными характеристиками в охлажденном мясном фарше. с экстрактом кожуры Punica granatum .Int. J. Food Sci. Technol. 2020; 55: 1080–1087. DOI: 10.1111 / ijfs.14398. [CrossRef] [Google Scholar] 84. Qin Y.Y., Zhang Z.H., Li L., Xiong W., Shi J.Y., Zhao T.R., Fan J. Антиоксидантное действие экстракта порошка кожуры граната, сока граната и экстракта порошка семян граната в качестве антиоксидантов в сыром фарше из свинины. Food Sci. Biotechnol. 2013; 22: 1063–1069. DOI: 10.1007 / s10068-013-0184-8. [CrossRef] [Google Scholar] 85. Фирузи М.Р., Ниакусари М., Эскандари М.Х., Керамат М., Гахруи Х.Х., Мусави Ханегах А.Добавление концентрата гранатового сока и экстракта порошка гранатовой цедры для улучшения окислительной стабильности сосиски при хранении в холодильнике. LWT Food Sci. Technol. 2019; 102: 237–245. DOI: 10.1016 / j.lwt.2018.12.048. [CrossRef] [Google Scholar] 86. Рануччи Д., Ройла Р., Андони Э., Бракони П., Бранчиари Р. Punica granatum и Citrus spp. смесь экстрактов влияет на скорость роста микроорганизмов порчи в вареных колбасах в вакуумной упаковке из свинины, пшеницы эммер ( Triticum dicoccum Schübler), миндаля ( Prunus dulcis Mill.) и фундук ( Corylus avellana L.) Foods. 2019; 8: 664. DOI: 10.3390 / foods8120664. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 87. Шахамирян М., Эскандари М.Х., Ниакусари М., Эстеглал С., Хашеми Гахруи Х., Мусави Ханегах А. Включение экстракта порошка гранатовой цедры и гранатового сока в замороженные гамбургеры: окислительная стабильность, сенсорные и микробиологические характеристики. J. Food Sci. Technol. 2019; 56: 1174–1183. DOI: 10.1007 / s13197-019-03580-5. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 88.Андрес А.И., Петрон М.Дж., Адамес Д.Д., Лопес М., Тимон М.Л. Побочные продукты питания как потенциальные антиоксидантные и противомикробные добавки в сырых котлетах из баранины, хранящихся в охлажденном виде. Meat Sci. 2017; 129: 62–70. DOI: 10.1016 / j.meatsci.2017.02.013. [PubMed] [CrossRef] [Google Scholar] 89. Bouarab-Chibane L., Ouled-Bouhedda B., Leonard L., Gemelas L., Bouajila J., Ferhout H., Cottaz A., Joly C., Degraeve P., Oulahal N. Сохранение котлет из свежего говяжьего фарша с использованием экстракты растений в сочетании с упаковкой в ​​модифицированной атмосфере.Евро. Food Res. Technol. 2017; 243: 1997–2009. DOI: 10.1007 / s00217-017-2905-3. [CrossRef] [Google Scholar] 90. Зиб Б., Шёк В., Шмид Н., Майер Л., Херрманн К., Хинрихс Дж., Вайс Дж. Поведение при смешивании комплексов WPI-пектин в мясных дисперсиях: влияние соотношений биополимеров. Food Funct. 2017; 8: 333–340. DOI: 10.1039 / C6FO01436D. [PubMed] [CrossRef] [Google Scholar] 91. Шарма П., Ядав С. Влияние включения цедры граната и порошка жома и их экстрактов на качественные характеристики котлет из куриного мяса.

Leave a Reply

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2021 © Все права защищены.