Микробиота в мазке: Вагинальная микробиота | BIOCODEX BMI PRO

Содержание

Вагинальная микробиота | BIOCODEX BMI PRO

Микробиота влагалища, также называемая флорой Дедерлейна, описывается с 1894 года. Это очень сложная экосистема, находящаяся в динамическом равновесии. Ее состав у разных людей варьирует в широких пределах1–2.

Основным родом является Lactobacillus, вырабатывающие молочную кислоту и обеспечивающие pH 3,8–4,4 в нормальных условиях. Такой сдвиг pH в кислую сторону создает неблагоприятные условия для размножения условно патогенных микроорганизмов3–5. Вагинальная микробиота является ключевым фактором защиты от различных возбудителей бактериальной, грибковой и вирусной природы. Она также играет важнейшую роль в первичной колонизации новорожденных, что оказывает влияние на иммунную систему и на неврологическое развитие6. Наиболее часто встречающимися видами являются L. crispatus, L. iners, L. jensenii и L. gasseri. Они обладают антибактериальными свойствами, образуют биопленку и стимулируют иммунные механизмы, которые защищают слизистые оболочки влагалища

7.

Помимо упомянутых выше, были описаны почти 250 видов бактерий, прежде всего анаэробные бактерии, такие как Prevotella, Gardnerella vaginalis и Atopobium vaginae, а также Escherichia coli и дрожжевые грибки Candida albicans8. Их состав и количество варьируется в зависимости от генетических факторов, этнической принадлежности, медикаментозных факторов (антибиотики), окружающей среды и поведения (сексуальная активность, личная гигиена и т. д.), а также зависит от состава микрофлоры ротовой полости и кишечника9.

Вагинальная микробиота в течение жизни меняется (половые гормоны, менструация, беременность, менопауза и т. д.), и эти факторы влияют на состав данной экосистемы

10.

Хотя состав вагинальной микробиоты у разных женщин различен, для обеспечения здоровья половых путей необходимо поддержание ее определенного баланса4. Различные гинекологические заболевания могут быть вызваны или спровоцированы дисбалансом вагинальной микробиоты (дисбиозом), в особенности бактериальным вагинозом (A. vaginae, Clostridiales и G. vaginalis) и кандидозным вульвовагинитом. Местный или пероральный прием пробиотиков способствует восстановлению равновесия микробиоты и может уменьшить симптомы вагинальной инфекции, а также вероятность рецидива.

 

Источники
1.    Hummelen, R. et al. Vaginal microbiome and epithelial gene array in post-menopausal women with moderate to severe dryness. PloS One 6, e26602 (2011).
2.    Albert, A. Y. K. et al. A Study of the Vaginal Microbiome in Healthy Canadian Women Utilizing cpn60-Based Molecular Profiling Reveals Distinct Gardnerella Subgroup Community State Types. PloS One 10, e0135620 (2015)
3.    Tomusiak, A. et al. Efficacy and safety of a vaginal medicinal product containing three strains of probiotic bacteria: a multicenter, randomized, double-blind, and placebo-controlled trial. Drug Des. Devel. Ther. 9, 5345–5354 (2015). https://www.ncbi.nlm.nih.gov/pubmed/26451088

4.    Mizock, B. A. Probiotics. Dis Mon. 2015 ;61:259-90 https://www.ncbi.nlm.nih.gov/pubmed/25921792
5.    Romero, R. et al. The composition and stability of the vaginal microbiota of normal pregnant women is different from that of non-pregnant women. Microbiome 2014; 2, 4
https://www.ncbi.nlm.nih.gov/pubmed/24484853
6.    Dominguez-Bello, M.G.et al., Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proc. Natl. Acad. Sci. U.S.A. 2010; 107: 11971– 11975
7.    A. Schwiertz (Ed). Microbiota of the Human Body. Advances in Experimental Medicine and Biology 2016; 902: 83-93 http://link.springer.com/book/10.1007%2F978-3-319-31248-4
8.    Li J et al. Importance of vaginal microbes in Reproductive health. Reprod Sci 2012; 19:235-242 https://www.ncbi.nlm.nih.gov/pubmed/22383775
9.    Pretrocevic L et al. Characterisation of the oral, vaginal and rectal Lactobacillus flora in healthy pregnant and postmenopausal women. Eur J Gynecol Reprod Biol 2012; 160:93-99. 
https://www.ncbi.nlm.nih.gov/pubmed/22088236
10.    Petrova, M. I. et al. Lactobacillus species as biomarkers and agents that can promote various aspects of vaginal health. Front. Physiol 2015;. 6: 81 

 

Вагинальная микрофлора — Семейная Клиника


  Вагинальная  микрофлора (вагинальная флора) – микроорганизмы, которые населяют влагалище. Они являются частью общей человеческой микрофлоры. Количество и тип этой флоры определяет состояние здоровья женщины. 
В норме в мазке на микрофлору должны преобладать бактерии рода  Лактобациллы (лактобактерии), защищающие от патогенных микроорганизмов. Лактобактерии производят молочную кислоту, которая, как предполагается, препятствует развитию патогенных бактерий (золотистого стафилококка, кишечной палочки и др.). Также они вырабатывают перекись водорода, обладающую широким противомикробным спектром действия, и различные бактериоцины, которые также убивают других бактерий, но имеют более узкое направленное действие.

Правила забора материала для определения бактериальной микрофлоры 


Биологический материал берется во время профилактического осмотра, а также при жалобах, таких как боль выше лобка, зуд и жжение в наружных половых органах, а также выделения, указывающие на воспалительный процесс.
Процедура забора биологического образца проходит безболезненно. Доктор вводит гинекологическое зеркало с центральным фиксатором, позволяющее расширить влагалище для осмотра поверхности шейки матки. Материал со стенки половых органов берется специальной щеточкой или ватным тампоном.

Перед походом к «женскому врачу» необходимо соблюдать определенные правила, повышающие достоверность и информативность анализа:

  • за 2-3 дня не вступать в интимные отношения;
  • запрещаются спринцевания;
  • принимать ванную накануне визита к врачу не рекомендуется;
  • при проведении гигиенических интимных процедур пользоваться специальным невысушивающим мылом;
  • в период менструации посещение гинеколога не рекомендуется, лучше всего сдавать этот анализ сразу после ее прекращения;
  • минимум 2-3 часа не опорожнять мочевой пузырь.
Если женщина принимает какие-либо препараты, она должна об этом сообщить лечащему врачу. Проведение терапии некоторыми препаратами (например, антибиотиками) может исказить результат исследования.
При снижении иммунитета (к примеру, во время беременности, гормонального сбоя, после перенесенных стрессов) количество лактобактерий снижается. Это влечет за собою ослабление женского организма, что чревато усилением предрасположенности к инфекционным заболеваниям половой сферы.


В норме, кроме лактобактерий, в мазке допускается присутствие гарднерелл и кандид в малом количестве. При снижении иммунитета патогенные микроорганизмы начинают быстро размножаться, подавляя «молочные» бактерии. Это приводит к нарушению кислотности, что чревато развитием дисбактериоза влагалища, а также гарденелезом и кандидозом.

 В мазке на флору оцениваются следующие показатели:

  • Клетки плоского эпителия, выстилающего стенки влагалища. В норме они единичные. Большое количество  может указывать на воспаление. Отсутствие клеток плоского эпителия может говорить об атрофии слизистой при дефиците женских половых гормонов. 
  • Лейкоциты, функция которых обезвреживать возбудителей инфекции. Превышение их нормы (свыше 10 в поле зрения) также говорит о возможном воспалительном процессе;
  • Грамположительные палочки – лактобактерии (лактобациллы) или палочки Додерлейна. Эти микроорганизмы являются основой влагалищной флоры здоровой женщины. Снижение количества лактобацилл указывает на дисбактериоз влагалища и сопровождает большинство инфекционных заболеваний половых органов;
  • Слизь – секрет, выделяемый железами канала шейки матки. В стенках влагалища нет желез, вырабатывающих слизь. В норме количество слизи, выделяемое и впитываемое во влагалище, примерно равно, поэтому слизь обнаруживается лишь в небольших количествах. Увеличение количества слизи (более 5 мл в сутки) может говорить о воспалении в канале шейки матки;
  • «Ключевые» клетки – это клетки плоского эпителия, которые отделились от слизистой и со всех сторон окружены бактериями. Преимущественно гарднереллами. Наличие этих клеток свидетельствует о влагалищном дисбактериозе;
  • Различная флора, которая присутствует во влагалище. Указываются виды бактерий, которые были обнаружены при осмотре мазка под микроскопом. Палочковая флора считается нормой, поскольку лактобактерии имеют форму палочек. Коковая флора является тревожным признаком. Смешанная флора означает, что в мазке большое количество и палочковидных и кокковых микроорганизмов, что бывает при бактериальном вагинозе.
Микрофлора половых путей в различные периоды жизни женщины неодинакова и отражает влияния комплекса факторов внутренней и внешней среды. 
Исследование мазка на микрофлору – это важная и быстрая диагностика, позволяющая на ранних стадиях выявить серьезную патологию. Своевременное и правильное лечение позволит избавиться от заболевания, не допуская его перехода в хроническую стадию. Молодым девушка и женщинам, планирующим стать мамой, следует уделить большое внимание репродуктивному здоровью, чтобы в будущем не столкнуться с проблемой зачатия или благополучного вынашивания беременности.

В СЕМЕЙНОЙ КЛИНИКЕ Вы можете сдать мазок на определение микрофлоры влагалища, а также на онкоцитологию. Наши врачи клинической лабораторной диагностики квалифицированно выполнят анализы, а врачи-гинекологи 

Состав микробиоты репродуктивного тракта женщин при бесплодии | Годовалов

1. Chen C., Song X., Wei W., Zhong H., Dai J., Lan Z., et al. The microbiota continuum along the female reproductive tract and its relation to uterine-related diseases. Nat. Commun. 2017; 8(1): 875. DOI: http://doi.org/10.1038/s41467-017-00901-0

2. Stone L. Infection: Vaginal microbiota and infectious infertility. Nat. Rev. Urol. 2018; 15(3): 136. DOI: http://doi.org/10.1038/nrurol.2018.11

3. Ding T., Schloss P.D. Dynamics and associations of microbial community types across the human body. Nature. 2014; 509(7500): 357-60. DOI: http://doi.org/10.1038/nature13178

4. Шишкова Ю.С., Долгушина В.Ф., Графова Е.Д., Завьялова С.А., Курносенко И.В., Евстигнеев а Н.П. и др. Взаимосвязь функционального статуса нейтрофилов цервикального секрета у беременных женщин с видовым составом лактофлоры. Журнал микробиологии, эпидемиологии и иммунобиологии. 2018; 95(4): 51-6. DOI: http://doi.org/10.36233/0372-9311-2018-4-51-56

5. Сычева М.В., Пешкова Ю.И., Карташова О.Л., Андреева А.В. Регуляция антимикробными пептидами чувствительности микроорганизмов к антагонистически активным представителям мутуалистической микрофлоры. Журнал микробиологии, эпидемиологии и иммунобиологии. 2017; 94(6): 21-5. DOI: http://doi.org/10.36233/0372-9311-2017-6-21-25

6. Ma B., Forney L.J., Ravel J. Vaginal microbiome: rethinking health and disease. Annu. Rev. Microbiol. 2012; 66: 371-89. DOI: http://doi.org/10.1146/annurev-micro-092611-150157

7. Sirota I., Zarek S.M., Segars J.H. Potential influence of the microbiome on infertility and assisted reproductive technology. Semin. Reprod. Med. 2014; 32(1): 35-42. DOI: http://doi.org/10.1055/s-0033-1361821

8. Franasiak J.M., Werner M.D., Juneau C.R., Tao X., Landis J., Zhan Y., et al. Endometrial microbiome at the time of embryo transfer: next-generation sequencing of the 16S ribosomal subunit. J. Assist. Reprod. Genet. 2016; 33(1): 129-36. DOI: http://doi.org/10.1007/s10815-015-0614-z

9. Campisciano G., Florian F., D’Eustacchio A., Stanković D., Ricci G., De Seta F., et al. Subclinical alteration of the cervical-vaginal microbiome in women with idiopathic infertility. J. Cell Physiol. 2017; 232(7): 1681-8. DOI: http://doi.org/10.1002/jcp.25806

10. van Oostrum N., De Sutter P., Meys J., Verstraelen H. Risks associated with bacterial vaginosis in infertility patients: a systematic review and meta-analysis. Hum. Reprod. 2013; 28(7): 1809-15. DOI: http://doi.org/10.1093/humrep/det096

11. Михайлова Н.А., Воеводин Д.А., Поддубиков А.В. Коррекция дисбиоза – основа регенеративной медицины. Журнал микробиологии, эпидемиологии и иммунобиологии. 2018; 95(5): 107-13. DOI: http://doi.org/10.36233/0372-9311-2018-5-107-113

12. Brotman R.M. Vaginal microbiome and sexually transmitted infections: an epidemiologic perspective. J. Clin. Invest. 2011; 121(12): 4610-7. DOI: http://doi.org/10.1172/JCI57172

13. Mastromarino P., Hemalatha R., Barbonetti A., Cinque B., Cifone M.G., Tammaro F., et al. Biological control of vaginosis to improve reproductive health. Indian J. Med. Res. 2014; 140(Suppl.): S91-7.

14. Donati L., Di Vico A., Nucci M., Quagliozzi L., Spagnuolo T., Labianca A., et al. Vaginal microbial flora and outcome of pregnancy. Arch. Gynecol. Obstet. 2010; 281(4): 589-600. DOI: http://doi.org/10.1007/s00404-009-1318-3

15. Богун А.Г., Кисличкина А.А., Галкина Е.В., Майская Н.В., Соломенцев В.И., Мухина Т.Н. и др. Использование современных методов идентификации бактерий в деятельности государственной коллекции патогенных микроорганизмов и клеточных культур (ГКПМ-Оболенск). Инфекция и иммунитет. 2016; 6(3): 8.

16. Onderdonk A.B., Delaney M.L., Fichorova R.N. The human microbiome during bacterial vaginosis. Clin. Microbiol. Rev. 2016; 29(2): 223-38. DOI: http://doi.org/10.1128/CMR.00075-15

17. Mendes-Soares H., Krishnan V., Settles M.L., Ravel J., Brown C.J., Forney L.J. Fine-scale analysis of 16S rRNA se quences reveals a high level of taxonomic diversity among vaginal Atopobium spp. Pathog. Dis. 2015; 73(4): pii: ftv020. DOI: http://doi.org.10.1093/femspd/ftv020

18. Copeland A., Sikorski J., Lapidus A., Nolan M., Del Rio T.G., Lucas S., et al. Complete genome sequ ence of Atopobium parvulum type strain (IPP 1246). Stand. Genomic Sci. 2009; 1(2): 166-73. DOI: http://doi.org/10.4056/sigs.29547

19. Lewis F.M., Bernstein K.T., Aral S.O. Vaginal microbiome and its relationship to behavior, sexual health, and sexually transmitted diseases. Obstet. Gynecol. 2017; 129(4): 643-54. DOI: http://doi.org/10.1097/AOG.0000000000001932

20. Gómez-Camarasa C., Fernández-Parra J., Navarro-Marí J.M., Gutiérrez-Fernández J. Moraxella osloensis emerging infection. Visiting to genital infection. Rev. Esp. Quimioter. 2018; 31(2): 178-81. (in Spanish)

21. Goto T., Hirakawa H., Morita Y., Tomida J., Sato J., Matsumura Y., et al. Complete genome sequence of Moraxella osloensis strain KMC41, a producer of 4-Methyl-3-Hexenoic acid, a major malodor compound in laundry. Genome Announc. 2016; 4(4): e00705-16. DOI: http://doi.org/10.1128/genomeA.00705-16

22. Tan L., Grewal P.S. Pathogenicity of Moraxella osloensis, a bac terium associated with the nematode Phasmarhabditis hermaphrodita, to the slug Deroceras reticulatum. Appl. Environ. Microbiol. 2001; 67(11): 5010-6. DOI: http://doi.org/10.1128/AEM.67.11.5010-5016.2001

23. Morais I.M.C., Cordeiro A.L., Teixeira G.S., Domingues V.S., Nardi R.M.D., Monteiro A.S., et al. Biological and physico chemical properties of biosurfactants produced by Lactobacillus jen senii P6A and Lactobacillus gasseri P65. Microb. Cell Fact. 2017; 16(1): 155. DOI: http://doi.org/10.1186/s12934-017-0769-7

24. Martin R., Suarez J.E. Biosynthesis and degradation of h3O2 by vaginal lactobacilli. Appl. Environ. Microbiol. 2010; 76(2): 400-5. DOI: http://doi.org/10.1128/AEM.01631-09

25. O’Hanlon D.E., Moench T.R., Cone R.A. In vaginal fluid, bacteria associated with bacterial vaginosis can be suppressed with lactic acid but not hydrogen peroxide. BMC Infect. Dis. 2011; 11: 200. DOI: http://doi.org/10.1186/1471-2334-11-200

26. Kim S., Gu S.A., Kim Y.H., Kim K.J. Crystal structure and thermodynamic properties of d-lactate dehydrogenase from Lactobacillus jensenii. Int. J. Biol. Macromol. 2014; 68: 151-7. DOI: http://doi.org/10.1016/j.ijbiomac.2014.04.048

27. Tsukida K., Takahashi T., Iida H., Kanmani P., Suda Y., Nochi T., et al. Immunoregulatory effects triggered by immunobiotic Lactobacillus jensenii TL2937 strain involve efficient phagocytosis in porcine antigen presenting cells. BMC Immunol. 2016; 17(1): 21. DOI: http://doi.org/10.1186/s12865-016-0160-1

28. Patnaik S., Davila C.D., Chennupati A., Rubin A. Endocarditis of the native aortic valve caused by Lactobacillus jensenii. BMJ Case Rep. 2015; 2015: bcr2014206288. DOI: http://doi.org/10.1136/bcr-2014-206288

Нормальная микрофлора влагалища | Румянцева, md

Cтоит напомнить, что каждый человек – существо в высшей степени нестерильное. В каждом из нас живет 2.5-3 кг бактерий (если быть до конца честными, не только бактерий, но еще грибов и простейших, но для простоты буду называть всех участников нашей микрофлоры бактериями). Интересно, что на самой «чистой» поверхности человека, коже, обитает около 1 миллиона бактерий на 1 см2. Самое «грязное» место в организме, думаю, угадают многие: кишечник (точнее, его самые финальные отделы). Как видите, самое «чистое» место более всего соприкасается с окружающей средой, а самое «грязное» — достаточно редко. Это значит, что подавляющее большинство бактерий нашего организма – это не что-то извне, а наша нормальная микрофлора, которая совершенно необходима для существования.

Если мы попытаемся «излечиться» от всех бактерий в нашем организме, скорее погибнем мы сами, чем они.

Микрофлора влагалища

Теперь непосредственно о микрофлоре влагалища женщин репродуктивного периода (у девочек до начала менструации и женщин в менопаузе состав микрофлоры совершенно иной).

Микрофлора влагалища – это очень сложная система, в которой участвуют многие и многие микроорганизмы. Так, в состав нормальной микрофлоры влагалища здоровой женщины могут входить более 300 видов бактерий (а далеко не только лактобактерии, о которых слышали многие). Интересен тот факт, что состав микрофлоры претерпевает значительные изменения в течение одного менструального цикла (концентрации бактерий могут меняться в миллион и более раз, и это не говорит о нарушениях микрофлоры, это вариант нормы). Чаще всего «худшее» состояние микрофлоры мы видим сразу после окончания менструации.

В норме во влагалище женщины обитает до ста миллионов бактерий на 1 г вагинальных выделений. Большинство бактерий – лактобактерии. На латинском языке лактобактерии обозначаются Lactobacillus, именно во влагалище должны главенствовать Lactobacillus crispatus, Lactobacillus jensenii, Lactobacillus iners или Lactobacillus gasseri. В обычном мазке (микроскопия мазка) они обозначаются как палочки (если написано, «палочки обильно», это хорошо).

Откуда берутся лактобактерии?

У девочек до наступления менструаций флора влагалища представлена другими бактериями, и pH существенно выше, чем после наступления менструаций. В результате действия половых гормонов (главным действующим лицом в этой ситуации являются эстрогены) изменяется кислотность влагалища, а на слизистой возрастает количество питательных веществ (а именно гликогена), подходящих для лактобактерий. Эти два фактора приводят к массовой “миграции” лактобактерий из кишечника во влагалище. Стоит отметить, что процесс этот не одномоментный, а после его завершения пути вагинальных и кишечных лактобактерий “расходятся” (во взрослой жизни в кишечнике и влагалище преобладают разные виды лактобактерий).

Функции лактобактерий

1. Лактобактерии названы так в связи со способностью вырабатывать молочную кислоту. Эта кислота отвечает за поддержание pH влагалища (в норме 3.8-4.2, то есть кислая среда). Важно отметить, что только лактобактерии хорошо себя чувствуют при таких значениях pH, для всех остальных микроорганизмов, которые могут попадать во влагалище, оптимальные значения pH сдвинуты в щелочную сторону, то есть им не очень комфортно при такой кислотности.

2. Продукция перекиси водорода и других веществ, губительных для микроорганизмов, пытающихся «вторгнуться» в микрофлору влагалища. Благодаря деятельности лактобактерий далеко не все чужеродные микроорганизмы (в том числе, инфекции, передаваемые половым путем) смогут остаться на слизистой влагалища и продолжить свою жизнедеятельность.

3. Есть еще одна важная функция лактобактерий: забота о потомстве. Как это происходит? Лактобактерии создают во влагалище очень кислую среду. У спермы же, наоборот, среда щелочная (значения pH 7.2-8.0), а это значит, что, попадая во влагалище, сперматозоиды погибают в огромном количестве. И только после того, как погибшие сперматозоиды покроют стенки влагалища, самый сильный сможет пробраться к шейке матки и далее к яйцеклетке.

Гениальная задумка природы: оплодотворение получится только при огромном количестве сперматозоидов в эякуляте (что косвенно характеризует здоровье мужчины), а к яйцеклетке доберется самый активный (то есть «здоровый») сперматозоид.

4. Важна и быстрая реакция лактобактерий на стресс. Установлено, что после полового контакта (когда pH изменяется кардинально) лактобактерии здоровой женщины восстанавливают исходную кислотность влагалища всего за 6 часов (то есть в здоровом теле лактобактериям не надо помогать отреагировать на раздражители внешней среды).

Прочие участники микрофлоры влагалища

Напомню, что помимо лактобактерий во влагалище здоровой женщины могут обитать разнообразные микроорганизмы (условно-патогенные микроорганизмы).

Само по себе наличие условно-патогенных микроорганизмов не является заболеванием и не требует лечения.

К таким организмам относятся уреаплазмы и микоплазмы (Mycoplasma hominis), гарднереллы, стафилококки, стрептококки и др. Когда эти микроорганизмы требуют лечения, можно прочитать в статьях про «уреаплазмоз», «микоплазмоз», «гарднереллез», «дисбиоз», «бактериальный вагиноз», «аэробный вагинит».

Однако есть и такие микроорганизмы, которых во влагалище быть не должно: возбудители инфекций, передаваемых половым путем. Список этих опасных возбудителей можно найти здесь.

Источники:

  1. ANNALS OF THE NEW YORK ACADEMY OF SCIENCES Issue: The Evolution of Infectious Agents in Relation to Sex The genital econiche: focus on microbiota and bacterial vaginosis Dan Danielsson, Per Kristen Teigen, and Harald Moi2Ann. Y. Acad. Sci. 1230 (2011) 48–58
  2. Tannock, G.W. 1999. The normal microflora: an introduction, in Medical Importance of the Normal Microflora. G.W. Tannock, Ed.: 1–23 Kluwer Academic Publishers. Dordrecht/Boston/London.
  3. Reid, G. & M. Habash. 1999. Urogenital microflora and urinary tract infection, in Medical Importance of the Normal Microflora. G.W. Tannock, Ed.: 423–440. Kluwer Academic Publishers, Dordrecht/Boston/London.
  4. Hillier, S.L. 2008. Normal genital flora, in Sexually Transmitted Diseases. K.K. Holmes, P.F. Sparling, W.E. Stamm, P. Piot, J.N. Wasserheit, L. Corey, M.S. Cohen & D.H. Watts, Eds.: 289–307. The McGraw-Hill Companies, New York.
  5. Bartlett, J.G. & B.F. Polk. 1984. Bacterial flora of the vagina: quantitative study. Inf. Dis. 6(Suppl.1): s67–s72.
  6. Gill, R.S., M. Pop, R.T. DeBoy, et al. 2006. Metagenomic analysis of the human distal gut microbiome. Science 312: 1355–1359.
  7. Andersson, A.F., M. Lindberg, H. Jacobsson, et al. 2008. Comparative analysis of human gut microbiota by barcoded pyrosequencing. PLoS ONE. 3: e2836.
  8. Costello, E.K., C.L. Lauter, M. Hamady,et al. 2009. Bacterial community variation in human body habitats across space and time. Science 326: 1694–1697.
  9. Gao, Z., T. Chi-hong, P. Zhiheng &M.L. Blaser. 2007.Molecular analysis of human forearm superficial skin bacterial biota. Natl. Acad. Sci. USA 104: 2927–2932.
  10. Aas, J.A., B.J. Paster, L.N. Stokes, et al. 2005. Defining the normal bacterial flora of the oral cavity. Clin. Microbiol. 43: 5721–5732.
  11. Fredricks, D.N., & J.M. Marazzo. 2005. Molecular methodology in determininng vaginal flora in health and disese: its time has come. Infect. Dis. Reports 7: 463– 470.
  12. Bik, E.M., P.B. Eckburg, S.R. Gill, et al. 2006. Molecular analysis of the bacterial microbiota in the human stomach. Natl. Acad. Sci. USA. 103: 732–737
  13. Doderlein, A. 1894. Die Scheidensekretuntersuchungen. ¨ Zentralbl. ¨ 18: 10–14.
  14. Thoma, M.E., R.H. Gray, N. Kiwanuka, et al. 2011. Longitudinal changes in vaginal microbiota composition assessed by Gram stain among never sexually active pre- and postmenarchaeal adolescents in Rakai, Uganad. Pediatr. Adolesc. Gynecol. 24: 42–47.
  15. Cadieux, P.A., J.P. Burton, E. Devillard & G. Reid. 2009. Lactobacillus by-products inhibit the growth and virulence of uropathogenic Escherichia coli. Physiol. Pharmacol, 60(Suppl 6): 13–18.
  16. Cherpes, T.L., L.A. Meyn, M.A. Krohn, et al. 2003. Association between acquisition of herpes simplex virus type 2 in women with bacterial vaginosis. Infect. Dis. 37: 319–325.
  17. Myer, L., L. Denny, R. Telerant, et al. 2005. Bacterial vaginosis and susceptibility to HIV infection in South African women: a nested case-control study.J. Infect. 192: 1372– 1380.
  18. Watts, D.H., M. Fazarri, H. Minkoff, et al. 2005. Effects of bacterial vaginosis and other genital infections on the natural history of human papillomavirus infection in HIV- 1-infected and high-risk HIV-1-infected women. Infect. Dis. 191: 1129–1139.
  19. Makarova, K., A. Slesarev, Y. Wolf, et al. 2006. Comparative genomics of the lactic acid bacteria. Natl. Acad. Sci. 103: 15611–15616.
  20. Makarova, K.S. & E.V. Koonin. 2007. Evolutionary genomics of lactic acid bacteria. Bacteriol. 189: 1199–1208.
  21. Ley, R.E., M. Hamady, C. Lozupone, et al. 2008. Evolution of mammals and their gut miocrobes. Science 320: 1647–1651
  22. Nicolas, P., P. Besseeres, S.D. Ehrlich, ` et al. 2007. Extensive horizontal transfer of core genome genes between Lactobacillus species found in the gastrointestinal tract. BMC Evol. Biol. 7: 141–155.
  23. Ley, R.E., D.A. Peterson & J.G. Gordon 2006. Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell 124: 837–848.

Похожее

Комментарии в Facebook

Гинеколог клиники AMC-Медионика о микрофлоре влагалища

Интервью с Мироновой Верой Амурхановной – врачом акушер-гинекологом о микрофлоре и микробиоте влагалища

В последние 10-15 лет благодаря достижениям микробиологии и генетики произошла настоящая революция во взглядах на роль микробов. Существование человека без микроорганизмов так же невозможно, как без воздуха. Итак, микробиота – что это? И чем отличается от микрофлоры?

Микробиом человека —  это совокупность всех микроорганизмов: бактерий, грибов, вирусов, простейших; которые обитают в нашем теле. Сам термин предложил американский генетик в 2001 году. Ранее более привычным для всех был термин «микрофлора», но он не совсем правильный, так как флора всё-таки растительный мир, а вот «биота» — совокупность микроорганизмов живого мира. 

Масса микробиома человека зависит от массы тела и доходит до 4 кг. Общее количество микроорганизмов в теле человека в 10 раз больше количества клеток, а наш геном в 1000 раз беднее совокупного генома микроорганизмов.

Микробиом регулирует многие жизненно важные процессы в организме и даже оказывает влияние на поведение человека! 

Микробиота – это термин, который характеризует микробиоценоз отдельных органов и систем. Например, микробиота влагалища. 

Изучение микробиома важно, т.к. изменение его состава, вызванное необоснованной терапией, неправильным образом жизни, повреждающими факторами внешней среды, может приводить к возникновению заболеваний и снижению качества жизни человека.

     

Бактерии в организме человека есть почти везде. Учеными установлено 5 мест в нашем теле, где концентрация бактерий максимальна: желудочно-кишечный тракт, кожа, дыхательные пути, полость рта и мочеполовая система. Расскажите о микробиоте влагалища. 


Микроорганизмы влагалища делятся на две группы – резидентную и транзиторную. Первая и самая многочисленная, примерно 95% всей микробиоты, состоит из лактобацилл. Этих бактерий может быть от 1 до 4 разновидностей, причём у разных женщин и в разные возрастные периоды соотношения различаются. Остальные 3-5% относятся ко второй группе. Это микроорганизмы, попавшие во влагалище с кожи промежности или во время полового контакта. 
При нарушении соотношения резидентной и транзиторной групп могут возникать

инфекционные воспалительные процессы. Появление неприятного запаха, зуда, жжения – верный признак изменений в микробиоте и повод обратиться к врачу.

  

Какие исследования и тесты существуют для анализа микробиоты влагалища? 


Инфекционный процесс во влагалище приводит к акушерским осложнениям, гинекологическим и урологическим заболеваниям, поэтому своевременная диагностика очень важна. Существует несколько методов диагностики: 

1. Микроскопия влажного мазка. Производится прямо у гинекологического кресла. Врач-гинеколог самостоятельно под прицелом микроскопа оценивает только что полученный мазок, не окрашивая его. 

2. Микроскопическое исследование окрашенного мазка. Наиболее дешевый и часто применяющийся метод. Однако, даёт достаточно много ложноположительных результатов, например, бактериального вагиноза. 

3. Измерение рН влагалищной среды с помощью тест-полосок. 

При изменении рН по сравнению с нормой обязательна хотя бы микроскопия мазка.

4. Микробиологическое исследование, т.н. «посев на флору». Используется повсеместно, но необходимо понимать, что более 50% микроорганизмов культивированию не поддаётся. Однако для определения типов Candida (молочницы) при хронической форме кандидоза метод вполне удовлетворителен. 

5. Наибольшей точностью на сегодня обладают молекулярно-биологические исследования, в том числе «Фемофлор-16», который мы часто используем в своей практике.

6. Тест «Микробиота влагалища по Осипову» также используется в последнее время. В ответе представлен состав обнаруженной нормальной и патогенной флоры, а также ее количество.

 

Можно ли говорить об отсутствии микробиоты, например, вследствие приема антибиотиков или при прохождении химиотерапии? Что делают в таких ситуациях? 

Говорить об отсутствии микробиоты в этих случаях мы не можем. А вот об изменении ее качественного и количественного состава — несомненно.

Количество резидентных бактерий резко снижается, что приводит к резкому размножению транзиторных. Поэтому, я не устаю повторять, что после любой антибактериальной терапии, в частности проведённой в связи с вагинальными инфекциями, необходим этап восстановления микробиоты. И сейчас для этого существует большое количество препаратов с разными формами введения. 

При химиотерапии достаточно часто может нарушаться или даже выключаться функция яичников, а значит, снижаться уровень эстрогенов, которые необходимы для постоянного процесса «созревания» эпителия влагалища. А именно, из отслоившихся поверхностных клеток лактобактерии получают гликоген, из которого потом образуется молочная кислота, обеспечивающая кислую среду этого биотопа. Эта же молочная кислота позволяет комфортно существовать самим лактобактериям и защищать влагалище от других микроорганизмов. Поэтому и в такой ситуации наша задача поддержать резидентную микрофлору соответствующей терапией. 

 

Может ли дисбаланс микробиоты влагалища привести к серьезным заболеваниям, повлиять на деторождение, зачатие, вынашивание?

Конечно! Изменение состава микробиоты влагалища не только вызывает дискомфорт, но и является причиной серьезных репродуктивных проблем, среди которых бесплодие, угроза прерывания беременности, преждевременные роды, послеродовые осложнения, воспалительные заболевания органов малого таза. Более того, согласно статистике, пациентки с нарушениями в составе микробиоты чаще, чем другие заражаются заболеваниями передающимися половым путём (ЗППП). 

И ещё очень важный момент. Известно, что папилломавирусная инфекция встречается в 85-90% случаев у людей, активно живущих половой жизнью. И, как правило, у молодых женщин устраняется самостоятельно. Но у 10-15% пациенток возникает дисплазия шейки матки разной степени тяжести, а в некоторых случая и рак шейки матки. По данным ряда мета анализов при сбалансированной микробиоте появление дисплазии и рака достоверно реже!

 

Вера Амурхановна, какие советы дадите женщинам для сохранения нормобиоты?

Чтобы сохранить здоровье и состав вагинальной микробиоты в пределах нормы: 

1. Возьмите за правило регулярно посещать гинеколога. Это позволит избежать многих проблем со здоровьем. 

2. Никогда не занимайтесь самолечением. Во всем мире растёт устойчивость к антибактериальным и противогрибковым препаратам. Бесконтрольное использование препаратов может негативно повлиять на процесс лечения.

3. Всегда доводите рекомендованную терапию до конца. Часты случаи, когда, почувствовав облегчение (уменьшилось количество выделений, ушёл зуд, жжение) пациентка бросает приём препаратов. Так делать нельзя!

4. Обязательно проводите восстанавливающую терапию пробиотиками и пребиотиками, как 2-ой этап лечения. Естественно, рекомендованную врачом. 

5. Не используйте спринцевания влагалища различными растворами. Нет «влагалищным ванночкам»! 

6. Отдавайте предпочтение белью из хлопка или шелка.

7. Откажитесь от ежедневных прокладок. Они затрудняют местную терморегуляцию, задерживают влагу, что приводит к размножению бактерий. 

8. Помните, что частая смена половых партнеров, а также орально-генитальные и ректально-вагинальные контакты могут приводить не только к ИППП, но и изменению состава микробиоты.

9. Обратите внимание на кишечник. Микробиота влагалища – это часть микробиоты организма и большинство патогенной флоры попадает во влагалище из кишечника. Поэтому изменения в кишечнике могут приводить и к нарушению состава вагинальной микробиоты. 

10. Знайте, о возможном изменении состава микробиоты на фоне системных заболеваний (например, при сахарном диабете) во время постменопаузы. Не бойся этого, а просто вовремя обратись к врачу!

 

Самый первый совет – регулярно ходить к гинекологу. И многие женщины зададутся вопросом: «Как выбрать хорошего врача?». Важен опыт или талант? 

Думаю, что нельзя противопоставлять эти два понятия!

Несомненно, опыт играет огромную роль в практике специалиста. Но вот, что интересно: чем больше опыта у врача, тем больше направлений, по которым он будет вести свой диагностический поиск. Хочется отметить, что многие современные врачи придерживаются холистического подхода — рассматривают организм, как единую систему. Не просто купируют симптомы заболевания, а ищут причину и, нередко, она лежит в другой области. Сейчас хороший врач-гинеколог при лечении пациента будет обращать внимание не только на показатели в своей сфере, но и назначать тестовые исследования других органов и систем, и это нормальная практика. Иногда бывает невозможно добиться полного излечения гинекологических недугов без коррекции дефицитов в обменных процессах щитовидной железы, гипофизе, нормализации работы кишечника и др.

 Все больше врачей сегодня работают на стыке разных специальностей. Конечно, это усложняет работу врача, увеличивает объем информации, требует от специалиста широкого кругозора, а иногда растягивает процесс лечения. Но на помощь приходят современные технологии и сейчас изобретено много алгоритмов для диагностики (правда, часто довольно упрощенных и нередко предоставленных фармкомпаниями), которые можно использовать даже на смартфонах. А вот уже талант или, вероятно, искусство, врача состоит в том, чтобы, имея лечебный опыт, владея всеми современными методиками обследования, используя данные мировой литературы — поставить правильный диагноз! 

Конечно, не забывая о персонализированном подходе. Сегодня при требованиях четко следовать клиническим рекомендациям и протоколам лечения талант врача заключается ещё и в балансировании на тонкой грани между стандартами и индивидуальным подходом!

Таким образом, важны и опыт, и талант!

      Беседовала Виктория Исакова

 


Воспалительные процессы шейки матки (цервициты)

На первый взгляд они кажутся безобидными, но при определенных условиях способны вызвать  развитие серьезной патологии, приводящей к большим проблемам с женским здоровьем.

 

Воспалительные заболевания, поражающие женские половые органы, составляют порядка 60-65% от всех гинекологических нарушений. Нередко эти заболевания протекают в скрытой форме, поэтому так важно регулярно посещать гинеколога.  

 

Во влагалище здоровой женщины обитает большое количество микроорганизмов. В норме микрофлора  содержит палочковидную флору – лактобациллы, которая  определяет кислую среду во влагалище и обладают защитными свойствами по отношению к патогенным микроорганизмам. Но даже те микроорганизмы, которые в небольших количествах могут постоянно присутствовать в половых путях, при определенных условиях, таких как изменение баланса  вагинальной РН среды, могут стать вирулентными  и участвовать в развитии воспаления.

 

К механизмам, изменяющим нормальную экосистему влагалища можно отнести:
1) гормональные факторы, которые определяют содержание гликогена в клетках эпителия слизистой оболочки; 
2) микробный антагонизм (взаимодействие «полезных» и патогенных микробов; 
3) нарушение иммунитета; 
4) сексуальное поведение.

 

Воспаление или инфекцию шейки матки —  ЦЕРВИЦИТ вызывают патогенные или условно-патогенные микроорганизмы: гонококки, стрептококки, стафилококки, хламидии, трихомонады, микоплазмы, уреаплазмы, кишечная палочка, грибы, вирусы (в частности вирус герпеса, паппиломовирус, цитомегаловирус) и т.д. Хронический цервицит развивается в результате рецидивов острого воспаления. К факторам, которые могут провоцировать наступление такого заболевания следует отнести большое количество половых партнеров, острые или хронические заболевания репродуктивной системы, беременность, роды, эндокринные заболевания.

 

Характерными проявлениями острого цервицита являются обильные выделения из влагалища (пенистые, зеленые, белые, творожистые с неприятным запахом и различной консистенции). Может появиться ощущение дискомфорта, зуда, жжения, покраснения в области половых органов. Также характерны болевые ощущения в области половых органов при половом акте, а иногда и боли в нижних отделах живота, которые отдают в спину или область поясницы. Могут появляться кровянистые выделения из половых путей после полового акта или в промежутке между менструациями, учащенные позывы к мочеиспусканию, которые становятся крайне неприятными.

 

Установить правильный диагноз  помогает осмотр, при котором выявляется характерная картина воспаления, наличие выделений патологического характера часто с неприятным запахом. Очень важно провести лабораторные исследования с определением всей микрофлоры (мазок на полный гинекологический профиль с ДНК-диагностикой), бактериологическую  диагностику и другие виды диагностики для того, чтобы исключить или подтвердить инфекционные факторы  воспаления. Необходимо также провести кольпоскопическое исследование, при котором признаки воспаления определяются более отчетливо. Кольпоскоп — это прибор,  имеющий 30-кратное увеличение  и оснащенный специальным галогеновым светом, позволяющий рассмотреть шейку матки в мельчайших деталях и заметить даже небольшие первоначальные изменения. Аппарат оборудован видеокамерой, а изображение передается на монитор, где пациентка может собственными глазами увидеть свои внутренние проблемы, а также впоследствии оценить результаты проведенного лечения. Все результаты проведенных исследований сохраняются в памяти компьютера.

 

Как правило, при своевременном обращении к врачу (если в течение одного-двух дней перечисленные симптомы самостоятельно не проходят —  нужно обратиться на прием к гинекологу) диагностика заболевания не вызывает особых трудностей.  К сожалению, нередко создается ошибочное представление о характере болезни и, как следствие, снисходительного к ней отношения. Поэтому, на сегодняшний день от 30 до 40% острых цервицитов переходят в хроническое заболевание.  Часто, именно первый эпизод инфекции,  является «стартовой площадкой» для возникновения в будущем проблем с женским здоровьем.  Проникновение инфекции в верхние отделы половых органов приводит к острым и хроническими заболеваниями органов малого таза: аднекситу, эндометриту, эндометриозу, спаечному  процессу в малом  тазу. Инфекционные факторы воспаления могут приводить к возникновению эрозии шейки матки, развитию гиперпластических процессов в тканях, онкологической патологии шейки матки и наружных половых органов, хроническим заболеваниям  мочевыводящих путей, потерям беременности, бесплодию.

 

Таким образом, если женщина хочет сохранить свое репродуктивное здоровье, чтобы в последующем не иметь повышенного риска развития таких неприятных осложнений, необходимо сразу же при появлении жалоб обратиться на прием к врачу.

 

Если женщина чувствует себя здоровой,  для профилактики возникновения серьезных проблем в сфере женского здоровья необходимо посещать врача гинеколога два раза в год. Такое правильное отношение к своему здоровью позволит обнаружить вероятную патологию как можно раньше и предотвратить более серьезные проблемы, в том числе развитие онкологических процессов  на шейке матки.

 

«Женщина, это приглашение к счастью»,  сказал Шарль Бодлер – классик французской и мировой литературы XIX века. Он  был абсолютно прав! Ведь здоровая женщина, — это счастливая женщина, которая может приглашать разделить свое счастье со всеми  окружающими ее близкими людьми.

Гаменюк Ольга Юрьевна – врач гинеколог-эндокринолог.

Посев из влагалища чувствительность к антибиотикам

Посев на микрофлору из влагалища с определением чувствительности к антибиотикам

Бактериальный посев микрофлоры влагалища – это определение состава микроорганизмов, населяющих половые органы женщины. Выяснение бактериальной флоры является залогом успешной антибиотикотерапии.

Подготовка к исследованию:

  • Не рекомендуется сдавать материал во время приема антибактериальных препаратов, во время менструации
  • За 2-3 дня до сдачи материала следует прекратить местное лечение (кремы, мази, свечи)
  • В день сдачи материала не рекомендуется подмываться
  • За 1,5-2 часа до сдачи следует воздержаться от мочеиспускания

Тип биоматериала: Влагалищное отделяемое, мазок

Синонимы (rus): Бактериальный посев, посев на флору, посев на определение чувствительности флоры к антибиотикам

Синонимы (eng): Genitourinary tract Culture, Bacteria Identification and Antibiotic Susceptibility testing

Методы исследования: микробиологический

Единицы измерения: КОЕ/мл, возведенное в степень

Сроки выполнения: 3-5 дней

Что такое посев на влагалищную микрофлору?

В норме у половозрелой женщины облигатная влагалищная микрофлора находится в количественном и качественном равновесии, не позволяя патогенной флоре развиваться на женских половых органах. Биоценоз влагалища представлен анаэробными бактериями, в их число входят:

  • Грамположительные облигатные бактерии – лактобациллы, клостридии, бифидобактерии.
  • Грамотрицательные микроорганизы – вейлонеллы, бактероиды, фузобактерии.
  • Факультативные бактерии – гарднереллы, стафилококки/стрептококки, кандидобактерии, микоплазма.

В норме в женском влагалище присутствует около 45 видов микроорганизмов, а их общее количество составляет 107-109 колониеобразующих единиц в миллилитре (КОЕ/мл). Большую часть влагалищной флоры составляют лактобактерии. Снижение их количества влечет за собой рост условно-патогенной флоры, в результате чего развивается дисбиоз, который выражается неприятными симптомами – жжение, характерные выделения, сильный зуд.

Методика бактериологического посева основана на свойстве всех бактерий активно размножаться в питательной среде, что помогает легко выявить состав микрофлоры слизистой оболочки влагалища. При выявлении возможного возбудителя заболевания его перемещают на среды, пропитанные разными видами антибиотиков, и наблюдают за ростом бактерий.

В некоторых лабораториях используют дисковый метод – микроорганизмы высеивают на специальные диски, пропитанные противомикробными препаратами. Отсутствие роста микроорганизма на каком-то определенном диске означает высокую чувствительность к данному препарату, бурное размножение свидетельствует об обратном.

Метод бактериологического исследования с определением антибиотикочувствительности позволяет избежать бессмысленных назначений препаратов, что значительно ускоряет выздоровление и восстановление баланса микрофлоры.

Для чего назначают исследование?

  • Для выявления возбудителя гинекологического заболевания.
  • Выявление нарушения баланса микроорганизмов влагалища.
  • Выяснение чувствительности бактерий к лекарственным препаратам (подбор рациональной схемы лечения).
  • Диагностика неспецифических заболеваний репродуктивных органов женщины.

В каких случаях врач назначает анализ?

Бактериологическое исследование влагалищного отделяемого с определением антибиотикочувствительности показано в тех случаях, когда у женщины отмечаются симптомы воспалительного процесса – сильный зуд, нехарактерные выделения, жжение, боль при половом акте. Помимо этого, показанием к обследованию является отклонения в обычном гинекологическом мазке.

Расшифровка результатов анализа.

В заключение вносят данные о составе и количестве условно-патогенных микроорганизмов, их чувствительность к антибактериальным препаратам. Отдельным списком представлены антибиотики, которые были задействованы в исследовании. В норме во влагалищном отделяемом преобладают лактобациллы, условно-патогенная флора не обнаружена или не превышает значение в 104. Увеличение этого параметра свидетельствует о развитии бактериального вагиноза.

Роль микробиома мазка с поверхности в образовании дефектного мазка на созревшем на поверхности сыре с красным мазком

Реферат

Сложная микробиота мазка, заселяющая поверхность сыра с красным мазком, существенно влияет на процесс созревания, внешний вид и срок хранения сыр. Чтобы расшифровать прокариотический состав микробиома мазка сыра, поверхность созревшего сыра с полутвердой поверхностью исследовали после созревания с помощью молекулярных подходов, основанных на культуре и не зависящих от культуры.Цель состояла в том, чтобы выявить возможные бактериальные изменения в составе микробиоты мазка сыра в результате хранения сыра в вакуумной упаковке с пленкой, что часто сопровождается развитием дефекта мазка на поверхности. Секвенирование следующего поколения амплифицированных фрагментов гена 16S рРНК выявило неожиданно высокое разнообразие в общей сложности 132 различных родов из доменов Bacteria и Archaea на поверхности сыра. Помимо типичных микроорганизмов, обнаруженных в мазках, наше исследование выявило присутствие нескольких микроорганизмов, которые пока не связаны с сыром, но связаны с молоком, фермой и сырной молочной средой.Анализ общей РНК на основе 16S рибосомной РНК выявил основные метаболически активные популяции в мазке с поверхности сыра: Actinobacteria из родов Corynebacterium , Brevibacterium , Brachybacterium и Agrococcus . Сравнение данных на более высоком филогенетическом уровне выявило явные различия в составе микробиома мазка сыра из разных образцов. В то время как пропорции Proteobacteria и Bacteroidetes увеличивались в мазке предварительно упакованных образцов и, в частности, в дефектном мазке, стафилококки демонстрировали противоположную тенденцию и, как оказалось, сильно уменьшались в дефектном мазке.В заключение, секвенирование следующего поколения амплифицированных генов 16S рРНК и 16S рРНК из экстрактов тотальной РНК обеспечило гораздо более глубокое понимание бактериального состава микробиоты мазка из сырного мазка. Наблюдаемые сдвиги в микробном составе образцов мазка с дефектной поверхности позволяют предположить, что определенные представители Proteobacteria вносят вклад в наблюдаемые отрицательные органолептические свойства мазка на поверхности сыра после фасовки в пластиковую фольгу.

Ключевые слова: микробиом, секвенирование следующего поколения, созревший сыр на поверхности, сыр с красным мазком, дефект мазка

1.Введение

Сыр — это пищевой продукт на основе ферментированного молока, появившийся 8000 лет назад на Ближнем Востоке. Производство сыра изначально предназначалось для биоконсервации питательных продуктов питания для питания человека, а в настоящее время превратилось в пищевой продукт премиум-класса, включающий более 1000 сортов сыра [1]. Разновидности сыров с поверхностным созреванием имеют давнюю традицию в Европе и подразделяются на сыры с бактериальным поверхностным созреванием с красной мазью и сыры с поверхностным созреванием [2] — [4].

Бактериальные сыры с красной мазью, созревшие на поверхности, такие как Конте, Грюйер, Лимбургер или Тильзит, характеризуются высоким содержанием влаги и высоким соотношением площади поверхности к объему [5]. Эти физические свойства способствуют влиянию протеолитической и липолитической активности микробов на формирование интенсивного ароматного вкуса, характерного для этого типа сыра [4], [6]. Вязкий красно-оранжевый мазок, образующийся на поверхности сыра во время созревания, определяет не только органолептические свойства этих сыров, но также служит защитой от высыхания и потери аромата [4], [7].Более того, быстрый рост поверхностной микробиоты во время созревания и ингибирующие свойства обитающих в нем микроорганизмов защищают сыр от колонизации патогенными бактериями пищевого происхождения или плесневыми грибами, продуцирующими микотоксины [8] — [10].

Созревание на поверхности сыров для мазков — это динамический процесс, который начинается с раскисления поверхности сыра дрожжами, за которым следует последовательный рост характерных красных бактерий мазка [2], [11], [12]. Смазанный слой, состоящий из экосистемы мультимикробных видов, естественным образом развивается на поверхности сыра, когда молодой сыр подвергается воздействию воздуха при высокой относительной влажности (> 95%) и подходящей температуре (13–15 ° C) [2], [ 13].Чтобы усилить формирование стабильной микробиоты поверхности и подавить рост плесени, поверхность периодически смазывают рассолом в период созревания [2], [6]. Встречающиеся в природе местные микроорганизмы мазков происходят из среды производства сыра, такой как сырные рассолы, сырое молоко, и из «домашней микробиоты» в камерах созревания или сырных помещениях, включая деревянные полки, чаны, водопроводную воду и воздух в помещении [11 ], [14] — [17]. В конце процесса созревания поверхность зрелого сыра, покрытая красным мазком, в основном состоит из грамположительных бактерий и солеустойчивых дрожжей [2], [4].

Для контроля качества и безопасности пищевых продуктов понимание микробного состава, динамики и взаимодействий имеет важное значение для улучшения вкуса, аромата, текстуры и безопасности сыра [18]. Традиционно состав сложной микробиоты поверхности сыра изучали методами культивирования с последующей фенотипической или генотипической идентификацией изолятов [19] — [21]. До сих пор менее трудоемкие молекулярные методы дополняли или заменяли подходы, зависимые от культивирования [19], [21].Современные молекулярные методы позволяют не только анализировать микробное разнообразие, но также отслеживать динамику и развитие микробов в пространстве и времени [18], [22]. Применение технологий секвенирования следующего поколения для высокопроизводительного анализа открывает новые возможности в области микробиологии пищевых продуктов, обеспечивая более глубокое и всестороннее понимание структуры сообщества и метаболической активности микробных экосистем [18], [21], [23] ], [24].

Целью этого исследования был анализ микробиоты мазка на поверхности сыра, чтобы изучить роль бактерий мазка в развитии ухудшения качества мазка.Сегодня сыр, созревший в мазке, хранят в вакуумной упаковке с пленкой, что способствует возникновению дефекта мазка, который выглядит как очень влажная, липкая и неприятная поверхность сыра с неприятным запахом [25]. Предыдущие исследования исключили вклад дрожжей и указали на изменения в составе или метаболической активности бактерий мазка из-за изменений физико-химических характеристик мазка сыра после вакуумной упаковки в пленку [25], [26]. Следовательно, целью этого исследования было провести углубленный анализ для сравнения бактериального состава и выявления метаболически активных членов поверхностной микробиоты в неупакованных и упакованных в вакуумную пленку образцах сыра разного качества.С этой целью прокариотический состав микробиоты мазка поверхности был проанализирован с помощью секвенирования следующего поколения мультиплексированных ампликонов 16S рДНК. Кроме того, метаболически активные члены микробиоты мазка сыра были определены секвенированием следующего поколения 16S рРНК из экстрактов тотальной РНК. Полученные данные 16S рДНК и рРНК сравнивали с результатами одновременного культивирования тех же образцов мазка.

2. Материалы и методы

2.1. Образцы сыра

Сыр с красной мазью, исследованный в этом исследовании, представлял собой швейцарский сорт полутвердого сыра с защитой происхождения (АОП), полученный из сырого молока коров, которых кормили без силоса.Использование добавок при производстве сыра запрещено, а произведенные сыры созревают на еловых досках не менее 75 дней при 13–14 ° C и относительной влажности воздуха около 90%.

Для анализа и сравнения микробиома мазка поверхности сыров, различающихся по качеству мазка, все исследованные образцы были получены из сыров, произведенных в один и тот же день из одного и того же молока и созревших в одном и том же сырном погребе. Все сыры обрабатывались одинаково до упаковки в конце периода созревания.Затем порции сыра были предварительно упакованы производителем в газо- и водонепроницаемую стандартную пластиковую пленку (Csf) в соответствии с применяемой стандартной процедурой и впоследствии хранились при 8 ° C в течение трех недель. Температура 8 ° C имитировала условия хранения в витрине или домашнем холодильнике [27], [28]. В качестве контроля одна порция сыра не была предварительно упакована в пленку и хранилась в сырном погребе до отбора проб. Во время хранения неупакованные и одна из предварительно упакованных в вакуумную пленку порций сыра (без дефектов) сохраняла качественный мазок поверхности (определяемый как сухая, немаскируемая поверхность с типичным сырным запахом).На других порциях сыра, предварительно упакованных в вакуумную пленку, во время хранения образовался сильный дефект размазывания (дефект, предварительно упакованный в вакуумную пленку), который был охарактеризован в соответствии с ранее описанной схемой определения дефектов [26] как влажная и смазанная консистенция с очень сильным выраженным неприятным запахом. с привкусом животного происхождения.

2.2. Анализ на основе культур образцов мазков с поверхности сыра

Образцы мазков с поверхности сыра от сыров с различным качеством мазка собирали, как описано ранее [25].Вкратце, с поверхности сыра стерильным ножом вырезали прямоугольник размером 8 см 2 и толщиной 2–3 мм (что соответствует весу 2,3 ± 0,2 г). Образцы мазков сыра разбавляли 50 мл предварительно нагретого (45 ° C) раствора пептона (pH 7), состоящего из 1% ( мас. / Об. ) пептона из казеина и 8,5% ( мас. / Об. ) NaCl (оба Merck, Дармштадт, Германия), а затем гомогенизировали в течение 4 минут в гомогенизаторе (Colworth Stomacher 400; Bender & Hobein, Цюрих, Швейцария). Колониеобразующие единицы определяли путем посева на поверхность последовательных разведений на различных неселективных и селективных средах для выращивания.Общее количество аэробных мезофильных и общих анаэробных бактериальных колоний определяли на триптическом глюкозно-дрожжевом агаре (TGYA; Biolife, Милан, Италия) с добавлением 1% ( мас. / Об. ) пептона из казеина (Merck, Дармштадт, Германия), гетеротрофных морских бактерий. (галотолерантные бактерии) на агаре с морским бульоном (MB; Becton Dickinson AG, Allschwil, Швейцария), факультативные анаэробные галофильные и алкалифильные (FAHA) бактерии на агаре с глюкозным дрожжевым экстрактом, пептоном и говяжьим экстрактом (GYPB) [10], энтерококки на стрептококке KF Агар (KFS; Becton Dickinson AG, Allschwil, Швейцария), строго анаэробные бактерии на дифференциально усиленной клостридиальной среде (DRCM; Becton Dickinson AG, Allschwil, Швейцария) с добавлением 1 мг л -1 резазурина (Sigma-Aldrich, Steinheim, Германия) ) и 500 мг цистеина -1 (VWR, Dietikon, Швейцария) и Enterobacteriaceae на фиолетово-красном желчном глюкозном агаре (VRBG; Biolife, Милан, Италия).Инкубационные свойства были следующими: TGYA аэробная, соответственно анаэробная (3 дня 30 ° C аэробная или анаэробная инкубация, затем 7 дней инкубация при комнатной температуре 22 ° C при дневном свете), MB Agar (7 дней аэробная инкубация при 22 ° C при комнатной температуре в условиях дневного света). дневной свет), агар GYPB (4 дня анаэробной инкубации при 30 ° C), агар KFS (3 дня аэробной инкубации при 42 ° C), агар DRCM (4 дня строгой анаэробной инкубации при 22 ° C в анаэробной камере), агар VRBG (1 день 37 ° C аэробная инкубация), PY Agar (3 дня аэробной инкубации при 30 ° C для подсчета колоний дрожжей, соответственно, 6 дней при 30 ° C аэробной инкубации для подсчета колоний плесени).Подсчет колоний определяли как средневзвешенное.

2.3. Анализ секвенирования следующего поколения амплифицированных фрагментов гена 16S рРНК

Из каждого типа образца (неупакованного, предварительно упакованного в вакуумную пленку, недефектного и предварительно упакованного в вакуумную пленку) была выделена общая ДНК и общая РНК для последующего анализа секвенирования следующего поколения. ДНК

экстрагировали из 350 мкл предварительно приготовленного сырого экстракта мазка сыра с помощью набора GenEluteTM Bacterial Genomic DNA Kit (Sigma-Aldrich Chemie GmbH, Штайнхайм, Германия) в соответствии с инструкциями производителя со следующими изменениями: Время инкубации при нагревании было вдвое.Для разрушения жестких клеточных стенок дополнительно выполняли стадию механической обработки клеток, добавляя 500 мкл гранул диоксида циркония-диоксида кремния (Ø 0,1 мм и 0,5 мм, смешанных 1: 1 (об. / Об.)) (Carl Roth GmbH Co. KG, Karlsruhe , Германия) к лизату с последующим энергичным встряхиванием в миксере (Retsch mill MM301; Retsch GMBH & CO.KG, Хаан, Германия) в течение 2,5 минут с максимальной частотой 30 с. лед в течение 3 мин. Этап механического разрушения клеток повторяли перед центрифугированием анализа в течение 1 мин при 12000 × g.Жидкий супернатант, за исключением жирового слоя наверху, переносили в колонку набора GenEluteTM Bacterial Genomic DNA Kit, и ДНК дополнительно экстрагировали в соответствии с рекомендациями производителя. Концентрацию ДНК определяли с помощью спектрофотометра ND-1000 (NanoDrop Technologies, Уилмингтон, США).

Для генерации ампликонов 16S рДНК были применены различные наборы праймеров, покрывающие всю последовательность 16S рДНК, соответствующую положению EC1 – EC1510 гена 16S рРНК Escherichia coli [29], что привело к фракциям размером примерно 450 п.н., 550 или длиной 650 п.н. ().ПЦР проводили, как описано ранее, в общем объеме 50 мкл, используя 53 нг метагеномной ДНК и 25 пмоль праймеров, каждый в отдельной реакции ПЦР. Характеристики этапов амплификации были следующими: начальная денатурация при 98 ° C в течение 2 минут, затем 25 циклов, каждый из которых составляет 10 с 98 ° C, 15 с при соответствующей температуре отжига, указанной в таблице для соответствующих нанесенных праймеров, 30 с 72. ° C и окончательное удлинение при 72 ° C в течение 5 мин. Отдельные продукты ПЦР объединяли для создания библиотеки секвенирования.

Таблица 1.

Праймеры, используемые для амплификации генов 16S рРНК.

9009 CC 900CR 900CR 900C 900C 900C 900C 900 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 8 9 9 8 9 9 8 9 9 9 9 9 8 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 10 V3 _ ___10
Цель Область гена 16S рРНК Название праймера Последовательность (5′ – 3 ′) Температура (° C) Ссылки
Бактерии V1– V3 TPU1 AGAGTTTGATCMTGGCTCAG 61 [30] — [33]
U529R ACCGCGGCKGCTGGC
CCi
CCi

92

Unin CCi CCi
Uni806R GGACTACNNGGGTATCTAAT
V4 – V6 U515F GTGCCAGCMGCCGCGGTAA 70 [30], [35] — [37] — [37]
TPU4 GGATTAGATACCCTGGTAGTCC 63 [32], [38], [39]
BS-R1407 GAC GGGCGGTGWGTRC
V7 – V9 BS-F1099 GYAACGAGCGCAACCC 56 [39]
pB-00545
pB-00545 ACGGYTACCTT1 99092

0 99092

A2Fa_minusGA TTCCGGTTGATCCYGCCG 59 [41]
U529R ACCGCGGCKGCTGGC [30], [33]
U529R 9001 [30], [33]
[30], [33]
[30], [33]
U5 70 [30], [35] — [37]
1048arcR-major CGRCGGCCATGCACCWC
1048arcR-minor CGRCRGCCATGYACCWC
мин. 63 [33], [42]
UA1406R ACGGGCGGTGWGTRCAA

Amplifi Ампликоны рДНК ed 16S секвенировали с использованием химии GS FLX Titanium на платформе 454 Genome Sequencer FLX (Roche Diagnostics Ltd., Берджесс-Хилл, Западный Суссекс, Великобритания) согласно протоколам Roche 454. Последовательности, не прошедшие контроль качества FLX, не рассматривались для биоинформатического анализа, 454-специфические части праймеров были обрезаны, необработанные последовательности были отсортированы по последовательностям меток и считывались с низкими показателями качества (оценка качества ниже 40) и короткими длинами ( менее 200 п.н.) были удалены. Полученные считывания последовательностей были проверены на наличие химерных конструкций с помощью программы UCHIME на основе выравнивания полноразмерных высококачественных и нехимерных эталонных последовательностей 16S рДНК (загруженных с RDP) [43].

Присвоение

OTU было выполнено с использованием классификатора RDP (Ribosomal Database Project) v2.7 [44] с таксономической классификацией, основанной на таксономии NCBI (http://www.ncbi.nlm.nih.gov/taxonomy). OTU, представленные менее чем 5 чтениями, были исключены из дальнейшего анализа. Результирующие OTU были объединены в различных точках выборки и нормализованы до процентных значений с помощью статистического пакета R.

2.4. Следующее поколение секвенирования общей РНК для таксономического определения транскриптов 16S рРНК

Полная РНК была извлечена из образцов мазков с поверхности сыра, применяя протокол, описанный Monnet и коллегами [45], и преобразована в кДНК.Впоследствии кДНК была разрезана, и область, соответствующая 16S рРНК, была селективно обогащена с помощью установки, называемой вектороретте [46], с использованием универсального праймера U515F в качестве специфического праймера и 13 циклов амплификации. После выбора размера (около 600 п.н.) библиотеки секвенировали с использованием химии GS FLX Titanium на платформе 454 Genome Sequencer FLX (Roche Diagnostics Ltd., Burgess Hill, West Sussex, United Kingdom) в соответствии с протоколами Roche 454. Последовательности, не прошедшие контроль качества FLX, не рассматривались для биоинформатического анализа, 454-специфические части праймеров были обрезаны, необработанные последовательности были отсортированы по последовательностям меток и считывались с низкими показателями качества (ниже 40) и короткими длинами (менее чем 200 п.н.) были удалены.Полученные считывания 16S рРНК использовали для последующей таксономической классификации метаболически активной микробиоты поверхности сыра, как описано ранее для секвенирования ампликонов 16S рДНК.

2,5. Номера доступа нуклеотидных последовательностей

Данные секвенирования ДНК и кДНК (РНК) доступны через базу данных NCBI GenBank Sequence Read Archive (SRA) под номером доступа SRP063818.

2.6. Статистический анализ

Для визуализации порядка образцов мазков сыра в уменьшенном измерении (2D пространство) и для сравнения технических подходов был проведен анализ основных компонентов (ПК) на основе корреляционной матрицы, рассчитанной с помощью JMP 10.0 (SAS Institute AG, Валлизеллен, Швейцария). Были вычислены основные компоненты для первых трех измерений, а результаты для первых двух основных компонентов (ПК) были визуализированы в виде графиков ПК. Чтобы оценить корреляцию между применяемыми методами микробиологического анализа, результаты анализа ДНК и РНК были объединены для каждого подхода.

3. Результаты

3.1. Анализ микробного состава на основе культур

Средневзвешенное количество колоний в КОЕ на см -2 было определено для неупакованных, предварительно упакованных в вакуумную пленку недефектных и предварительно упакованных в вакуумной пленке дефектных образцов мазка с поверхности сыра.Результаты исследования на основе культивирования и сравнения микробного состава различных образцов мазков с поверхности представлены в. Подсчет общего количества мезофильных аэробных бактерий, общего количества анаэробных бактерий, галотолерантных бактерий и факультативных анаэробных галофильных и алкалифильных (FAHA) бактерий находился в диапазоне от 2,5 × 10 8 до 5,5 × 10 9 КОЕ см −2 для всех образцов проанализированы. Энтерококки и строго анаэробные бактерии выявили 1,5 × 10 5 до 3.4 × 10 6 КОЕ см −2 , энтеробактерии варьировались от 1,9 × 10 3 до 2 × 10 4 КОЕ см −2 во всех образцах.

Результаты подсчета на чашках представлены как средневзвешенные в колониеобразующих единицах (КОЕ см -2 ) для всех аэробных мезофильных бактерий, общих анаэробных бактерий, галотолерантных бактерий, факультативных анаэробных галофильных и алкалифильных (FAHA) бактерий и энтеробактерий для неупакованных исправная, предварительно упакованная в вакуумной пленке, исправная и предварительно упакованная в вакуумной пленке, дефектная микробиота мазка сыра.Предел обнаружения обозначен горизонтальной штриховой линией.

В целом не было обнаружено существенных различий, которые могли быть связаны с предварительной упаковкой в ​​вакуумную пленку или дефектным мазком поверхности сыра. Это также становится очевидным из анализа основных компонентов, показывающего эквидистантное разделение трех типов выборки по первым двум основным компонентам, объясняющим в общей сложности 90% вариации данных ().

Графики анализа основных координат для сравнения микробного состава, определенного культуральным анализом (A) и анализом секвенирования следующего поколения (B) неупакованных недефектных [1], недефектных материалов, предварительно упакованных в вакуумную пленку [2] и предварительно упакованные в вакуумную пленку дефектные [3] образцы мазков с поверхности сыра.Процентное изменение, объясняемое соответствующим главным компонентом (PC), указано на соответствующей оси x или y.

3.2. Состав и разнообразие микробиоты поверхности сыра проанализировано секвенированием следующего поколения амплифицированных фрагментов гена 16S рРНК и общей РНК

Чтобы выполнить наиболее комплексный подход, доступный в настоящее время для исследования сложных микробных экосистем, микробный состав поверхности сыра мазок анализировали путем секвенирования следующего поколения амплифицированных фрагментов гена рибосомной РНК 16S.Кроме того, доля метаболически активных бактерий была исследована путем высокопроизводительного секвенирования общей РНК с последующим таксономическим отнесением полученных считываний 16S рРНК.

Секвенирование амплифицированных фрагментов 16S рДНК из микробиоты мазка образцов сыра, предварительно упакованных в вакуумную пленку, дало в общей сложности 10 688 считываний из дефектного и 10780 считываний из недефектного мазка, соответственно. Для образца из неупакованного сыра было сгенерировано 19 121 считывание. Количество считываний, прошедших проверку качества и примененных для таксономического профилирования, составило 14 413 считываний для образца из неупакованного сыра.Образец сыра, предварительно упакованного в вакуумную пленку, с дефектным мазком дал 7910 считываний, а 7708 считываний были получены для образца сыра, предварительно упакованного в вакуумную пленку, с исправным мазком, соответственно. Что касается секвенирования общей РНК, от 6361 до 17 952 считываний общей РНК были получены из образцов сыра, предварительно упакованных в вакуумную пленку, и 40 308 считываний общей РНК из неупакованных образцов сыра. После проверки качества и ограничения считываний, происходящих от 16S рРНК, числа считываний, используемых для анализа, составили 2285 считываний для сыра, предварительно упакованного в вакуумную пленку, с дефектным мазком, 2518 считываний для сыра, предварительно упакованного в вакуумную пленку, с исправным мазком и 2774 считывания для неупакованного сыра. соответственно.

Секвенирование амплифицированных фрагментов 16S рДНК выявило чрезвычайно разнообразную микробиоту мазка поверхности, содержащую 132 различных OTU (), тогда как анализ считываний 16S рРНК дал только 59 различных OTU (). Однако 105 из 132 OTU, обнаруженных с помощью подхода, основанного на 16S рДНК, показали довольно низкую относительную численность — менее 0,5% на образец (что соответствует менее 37 считываний на образец). Поэтому они были объединены как «другие таксоны» в Таблице S1. В подходе, основанном на 16S рРНК, 28 из 59 обнаруженных OTU составляли менее 0.Относительная численность 5% на образец (соответствует менее 14 показаний на образец), которые были суммированы как «другие таксоны» в таблице S2. Таксономическое назначение считываний рДНК 16S на уровне рода показало, что половина считываний принадлежала факультативным анаэробным бактериям, до трети — строгим аэробным бактериям и только от 4 до 15% считываний были получены от строго анаэробных бактерий.

Сравнение микробиома сырного мазка неупакованных, предварительно упакованных в вакуумную пленку недефектных и дефектных образцов сырного мазка, предварительно упакованных в вакуумную пленку, определенное секвенированием следующего поколения ампликонов 16S рДНК.Столбцы показывают относительную численность (%) прокариотических родов, обнаруженных в каждом образце. Наиболее распространенные филотипы показаны разными цветами, а таксоны, показывающие менее 0,5% от общего числа прочтений, объединены и показаны черным цветом.

Анализ микробиома мазка сыра неупакованных, предварительно упакованных в вакуумную пленку недефектных и дефектных образцов мазка, предварительно упакованных в вакуумную пленку, выполняется путем секвенирования нового поколения общей РНК, выделенной из образцов мазка. В столбцах отображается относительное содержание (%) считываний 16S рРНК для разных родов прокариот в каждом образце сыра.Наиболее распространенные филотипы показаны разными цветами, таксоны, показывающие менее 0,5% от общего числа прочтений, объединены и показаны черным цветом.

Анализ на основе 16S рРНК выявил до 1% прочтений строго анаэробных бактерий в образцах из упакованного в вакуумную пленку сыра, тогда как образцы сыра без упаковки не содержали строгих анаэробов. Метаболически активное сообщество мазков было в основном представлено аэробными Actinobacteria из родов Corynebacterium , Brevibacterium , Brachybacterium и Agrococcus , которые обеспечили наибольшее количество считываний 16S рРНК.Взятые вместе, они способствовали относительному содержанию в образце неупакованного сыра 73%. Corynebacterium также был наиболее распространенным таксоном, обнаруженным с помощью подхода на основе 16S рДНК, тогда как Brevibacterium , Brachybacterium и Agrococcus составили гораздо меньше считываний. Остальные Actinobacterium , такие как Clavibacter , Plantibacter , Klugiella , Microbacterium и Leucobacter , составили 19 особей.75–37,11% относительное содержание считываний 16S рРНК (и таблица S2). Staphylococcus Показания 16S рРНК составляли значительную часть микробиоты небезупречного образца сыра, предварительно упакованного в вакуумную пленку, в то время как для других образцов мазков этого не было. Однако в анализе на основе 16S рДНК считывания из Firmicutes были гораздо более заметными во всех трех типах образцов мазка с относительной численностью 8,10–23,90%. Тогда как Proteobacteria выявили до 35.20% относительной численности и были представлены различными родами, такими как Halomonas , Psychrobacter , Herbaspirillum , Sphingomonas и Fulvimonas в подходе, основанном на рДНК, они были гораздо меньше представлены лишь несколькими прочтениями из Halomonas. и Psychrobacter в подходе на основе 16S рРНК. Архей были в принципе представлены чтениями 16S рДНК (относительная численность 3–12%) из родов Thermocladium , Sulfurisphaera , Methanohalobium и Methanomicrobium , так как 16S рРНК считываются из Archaea.Относительная численность 5%. Наиболее разительным отличием в составе микробного сообщества в мазке от неупакованного, не дефектного сыра, предварительно упакованного в вакуумную пленку, и дефектного сыра, предварительно упакованного в вакуумную пленку, было сильное увеличение популяций грамотрицательных бактерий Proteobacteria и Bacteroidetes , в частности для образца из дефектного мазка. Обилие грамположительных стафилококков, которые относятся к типичной микробиоте мазка, выявило выраженное уменьшение мазка дефектного сыра, упакованного в вакуумную пленку.

В целом, различия в структуре микробного сообщества, определенные путем сравнения результатов подхода, основанного на 16S рДНК и 16S рРНК, показали, что большинство рибосомных РНК происходит из нескольких таксонов, которые представляют собой метаболически активную часть микробиоты мазка из сырного мазка. Когда результаты секвенирования 16S рДНК и 16S рРНК рассматривались отдельно при анализе основных компонентов, первый главный компонент четко сгруппировал отдельные образцы в соответствии с целевыми молекулами (данные не показаны).Однако, когда были приняты во внимание все данные высокопроизводительного секвенирования на микробиоту мазка, первые два основных компонента, которые в общей сложности объясняли 99,48% вариации, равноудаленно разделяли микробиоту неупакованной, предварительно упакованной вакуумной пленки, не дефектной и дефектный сырный мазок, предварительно упакованный в вакуумную пленку ().

Кроме того, он показывает, что различные подходы, применяемые для анализа микробиоты мазка поверхности, дали соответствующие результаты. Низкое разрешение анализа на основе культур выявило менее различную структуру сообщества неупакованных, предварительно упакованных в вакуумную пленку недефектных и дефектных образцов мазков сыра, предварительно упакованных в вакуумную пленку ().Одновременно с высочайшим разрешением в глобальном масштабе высокопроизводительный анализ секвенирования привел к самым большим различиям в составе микробного сообщества различных образцов мазка (). Таким образом, примененный подход к секвенированию следующего поколения позволил провести углубленный анализ микробиоты мазка сыра. В то время как обнаружение считываний 16S рДНК продемонстрировало присутствие широкого до сих пор неизвестного спектра специфических микробных таксонов, полученные считывания 16S рРНК подтвердили метаболическую активность определенного подмножества аэробных и факультативно анаэробных Actinobacteria , представленных в основном типичными бактериями мазка сыра.

4. Обсуждение

Традиционные культуральные анализы сложной микробиоты в пищевых системах ограничены в их способности обеспечить глубокое понимание фактического микробного состава и сильно зависят от выбранной среды для культивирования и способности культивирования микроорганизмов [47] . Будучи более быстрым и точным методом, обеспечивающим более высокую специфичность и чувствительность, методы отпечатков пальцев молекулярных сообществ представляют собой новейшие методы изучения микробного разнообразия сложных экосистем, прежде чем они будут заменены технологиями секвенирования следующего поколения для высокой производительности. цели [20], [48].Предыдущие исследования, основанные на секвенировании микробиоты сыра следующего поколения, в основном были сосредоточены на анализе отдельных амплифицированных «гипервариабельных участков» генов 16S рРНК [49] — [54]. В этом исследовании микробиом поверхности сыра был проанализирован с помощью подхода секвенирования следующего поколения, учитывающего не только различные «гипервариабельные области» V1 – V9 гена рибосомной РНК 16S, но и прямое секвенирование общей РНК без предварительной амплификации. Таким образом, в дополнение к составу и разнообразию, также была проанализирована метаболически активная доля микробиоты поверхности сыра для различных образцов из неупакованного, предварительно упакованного в вакуумную пленку недефектного сыра и предварительно упакованного в вакуумную пленку дефектного сыра.Это предварительное исследование, проведенное только на одной партии сыра, произведенной в один день и созревшей в одном и том же сырном погребе в идентичных условиях, которое требует дальнейшего изучения в будущем, чтобы улучшить наши знания о влиянии различных стратегий упаковки на сырный мазок. микробиом.

Паттерны микробного сообщества, полученные из различных образцов, выявили измененный состав, в первую очередь вызванный увеличением популяций грамотрицательных бактерий Proteobacteria и Bacteroidetes и уменьшением количества стафилококков, которые являются частью типичной микробиоты мазка.Эти изменения были особенно заметны в образцах сыра, упакованного в вакуумную пленку, с дефектным мазком. Это наблюдение противоречит данным культурального исследования дефекта мазка на поверхности сыра, которое не выявило явных различий между разными типами образцов. Предыдущее исследование развития дефекта сырного мазка [25], стабильный микробный состав, определенный в течение периода хранения сыра, указывал на сложную этиологию, когда более чем один фактор способствует развитию дефекта мазка.В более позднем исследовании было показано, что такие факторы, как анаэробные условия, увеличение активности воды, а также снижение pH коррелировали со снижением транскрипционной активности рРНК микробиоты мазка [26]. В настоящем исследовании микробиота мазка образцов сыра, упакованных в вакуумную пленку, показала значительно меньше считываний 16S рРНК, а состав микробной структуры сообщества оказался менее затронутым по сравнению с подходом секвенирования следующего поколения на основе 16S рДНК, который выявил явные изменения. в структурах микробной популяции различных образцов.

В частности, считывание с микроорганизмов, характерных для поверхности созревшего по мазку сыра, таких как Corynebacterium , Staphylococcus , Brevibacterium , Arthrobacter , Micrococcus 00050005, Alibacterium 000, Micrococcus , 0006 Micrococcus преобладали в результатах анализа на основе 16S рДНК. За исключением Micrococcus , большинство бактерий, характерных для смазанной поверхности сыра, было выделено с поверхности того же сорта сыра в предыдущем исследовании [25].В этом исследовании, основанном на культуре, типичные бактерии мазка составляли основную часть микробиоты мазка с количеством колоний от 10 7 до 10 8 КОЕ на см −2 . Это также имело место в настоящем исследовании: на Corynebacterium , Brevibacterium и Brachybacterium приходилась основная часть идентифицированных прочтений 16S рДНК. Это открытие кажется разумным, поскольку известно, что представители этих родов вносят значительный вклад в типичные характеристики сырного мазка во время процесса созревания, производя внеклеточные протеиназы и липазы, пигменты и ароматические соединения [4], [8], [55], [ 56].Из-за известного применения в заквасочных культурах для производства сыра рДНК 16S, считываемая из Lactobacillus , обнаруженных в этом исследовании, могла происходить из бактерий сырного матрикса [4], [57].

Было обнаружено, что помимо микроорганизмов, преобладающих на поверхности сыра, микробиота мазка поверхности содержит неожиданно высокое микробное разнообразие, подразумевающее наличие многих таксонов, до сих пор не связанных с экосистемой сыра. Поскольку образцы сыров были произведены из сырого молока, а для сырого молока характерно высокое биоразнообразие местных микроорганизмов, основная часть микробиоты сырного мазка может происходить из этого источника [57], [58].Сравнение родов, представленных последовательностями 16S рДНК и 16S рРНК, с научной литературой выявило многочисленные взаимосвязи изначально неожиданных таксонов с окружающей средой фермы, такие как микробиота крупного рогатого скота, а также дальнейшие отношения с водой, морскими и солеными экосистемами или почвой. Род Trueperella , как известно, распространен в коровьем молоке и преобладает в основном в молоке крупного рогатого скота при мастите [54], [58] — [65], в то время как Asteroleplasma является частью экосистемы рубца крупного рогатого скота [66], [67]. Herbaspirillum — это род, связанный с корнями травянистых растений, а Humibacter и Fulvimonas связаны с почвой или компостом [68] — [71]. Известно, что микроорганизмы, связанные с фермой, также могут передаваться в сыр через сырое молоко, используемое для производства сыра, в то время как кристаллы соли могут служить источником микроорганизмов, когда образцы сыра проходят в солевой ванне во время производства сыра или регулярно смазываются рассолом во время созревания. процесс.Кроме того, подход, основанный на 16S рДНК, выявил присутствие архей в микробиоте мазка сыра. Однако чтения рДНК из Archaea были редкими, а чтения 16S рРНК составляли менее 0,5% всех чтений. Подход, основанный на 16S рДНК, выявил Thermocladium , таксон, недавно обнаруженный путем пиросеквенирования в пахте, и Methanomicrobium , который естественным образом встречается в рубце крупного рогатого скота. Sulfurisphaera и Methanohalobium , как известно, обитает в морских водных системах или соленых лагунах [72] — [75].

Поскольку РНК менее стабильна, чем ДНК, и ее экспрессия тесно связана с физиологическим статусом бактерий, рибосомная 16S РНК представляет собой подходящий маркер для метаболически активных и целочисленных клеток [76] — [80]. Таким образом, обнаруженные считывания 16S рРНК представляют собой состав метаболически активных бактерий в мазке с поверхности сыра. Следовательно, обилие 16S рРНК, считываемых из актинобактерий , указывает на то, что этот тип представляет собой самую большую популяцию активных бактерий на поверхности сыра после созревания.Кроме того, Agrococcus обеспечил значительное количество считываний 16S рРНК в проанализированных функциональных сообществах. Хотя Agrococcus обычно не входит в число типичных микроорганизмов мазка, он был ранее обнаружен в мазке сыра и идентифицирован как член «домашней микробиоты» на молочных заводах. Более того, первая изоляция Agrococcus casei была описана на поверхности сыров Губбин, Ливарот и Тильзит [11], [81] — [83].

Помимо Corynebacterium , Brevibacterium , Brachybacterium и Agrococcus , которые преобладали в метаболически активном сообществе на поверхности сыра, множество других родов из Actinobacteria внесли значительный вклад в чтение 16S rNA. Microbacterium spp. считаются типичными бактериями мазка, которые часто колонизируют поверхность сыра в больших количествах — 10 8 КОЕ на см −2 и обычно являются частью «домашней микробиоты» на сыроварнях. Представители Curtobacterium , Klugiella , Pseudoclavibacter , Leucobacter и Mycetocola иногда описывались в мазке с поверхности сыра или в сырных молочных продуктах и ​​в условиях фермы [11], [15], [56], [58] , [59], [61], [63], [84] — [88].Хотя Clavibacter , Plantibacter , Actinobaculum , Frigoribacterium , Zimmermannella , Arcanobacterium и Subtercola до сих пор не были описаны для обитания представителей этих родов, которые могли бы заселять мазки поверхности сыра. роль в контексте молока, ферм и экосистем молочных животных [58], [61], [63], [87], [89] — [93]. Дальнейшие исследования показывают, что сырое молоко может служить вектором для родов Georgenia , Millisia и Quadrisphaera , которые обычно населяют наземные природные экосистемы, такие как почва или ил [82], [94], [95].Применение соли в процессе производства сыра предлагается в качестве внутреннего источника таких микроорганизмов, как Salirhabdus , Nesterenkonia , Serinibacter , Salinibacterium и Zhihengliuella 96, которые обычно выделяются из морских или соленых водоемов [ ] — [99]. Фактическая роль и вклад различных неожиданных микроорганизмов, возникающих на поверхности сыра, остается неизвестным, но ранее цитированная литература показала производство липаз, протеаз, пигментов и химических ароматических соединений или коагуляцию молока различными из этих Actinobacteria .

Сравнение результатов 16S рДНК для образцов, показывающих различное качество мазка сыра, выявило уменьшение считывания стафилококков в образцах из дефектного мазка, в частности, по сравнению с образцом из неупакованного сыра. Стафилококки представляют собой типичные микроорганизмы мазка сыра, которые, как известно, преобладают в мазке на поверхности сыра, особенно в начале процесса созревания, обеспечивая условия для лучшего роста коринебактерий [12], [100]. Таким образом, их снижение говорит о неблагоприятных условиях в дефектном мазке.Еще одно поразительное наблюдение — более высокая численность представителей Proteobacteria и Bacteroidetes в мазке расфасованного сыра, которая наиболее выражена в образцах из дефектного мазка. Тип Bacteroidetes в основном представлен чтениями из Sphingobacterium и Hydrotalea , которые, как известно, в изобилии присутствуют в почве и воде [101], [102], но до сих пор не были связаны с окружающей средой производства сыра. Proteobacteria были в основном представлены чтениями из родов Psychrobacter и Halomonas , которые часто обнаруживались в большом количестве в поверхностном мазке сортов сыра с красным мазком в предыдущих исследованиях [54], [103], [54], [103], [ 104]. Обычно большое количество клеток Proteobacteria на ранних стадиях периода созревания со временем уменьшается из-за комбинированного воздействия различных физических и химических параметров [105]. Для Psychrobacter celer было показано, что бактерии способны успешно имплантироваться в сыр, независимо от уровня его инокуляции.Они внесли свой вклад в производство летучих ароматических соединений, таких как альдегиды, кетоны и соединения серы, и оказали влияние на ароматические свойства сыра [106]. Это наблюдение подтверждается полногеномным секвенированием штамма Psychrobacter , выделенного из сырной корки, которое показало, что геном содержит ферменты, которые важны для созревания сыра у других бактерий, такие как цистатионин / метионин бета или гамма-лиазы, многие протеазы и пептидазы, аминотрансферазы и липазы [107].Благодаря этим свойствам повышенный уровень бактерий может способствовать появлению неприятного привкуса, который накапливается под фольгой предварительно упакованного сыра. Для Halomonas venusta было показано, что бактерии продуцируют кадаверин в модели сыра для производства летучих соединений, а также биогенных аминов [108]. Однако Halomonas spp. более известны как сильные продуценты экзополисахаридов [109], [110]. Это свойство может потенциально способствовать образованию липкой и слизистой сырной поверхности предварительно упакованного из фольги мазанного сыра.Таким образом, сочетание уменьшения количества типичных микроорганизмов, образующихся в мазке, таких как стафилококки, вместе с увеличением количества представителей Proteobacteria в дефектном мазке может внести существенный вклад в наблюдаемые отрицательные органолептические свойства мазка на поверхности сыра после фасовки в пластиковую фольгу.

Созревший сыр — обзор

Развитие аромата

Типичный летучий сернистый сырный сырный запах мягких, полумягких и кислых творожных сыров отчетливо обнаруживается примерно через 2 недели созревания, когда развивается зрелая поверхностная микрофлора.В модели с жидким молоком чистые культуры D. hansenii , S. equorum , B. linens , M. gubbeenense и C. casei (полная поверхностная закваска Tilsit) не дали типичного мазка. сырный запах, то есть сложный ароматический профиль с преобладанием соединений серы и аммиака. Было показано, что взаимодействия между M. gubbeenense и B. linens высвобождают типичный аромат мазка в модельной системе; аналогичный эффект наблюдался при добавлении метионина к чистым культурам B.Постельное белье . Это демонстрирует важность B. linens для развития аромата даже при низких пропорциях (иногда <1% от общего количества клеток), обнаруживаемых в поверхностной микрофлоре. Geotrichum Candidum , присутствующий в размазанных мягких сырах, обладает профилем аромата, аналогичным B. linens . Оба вида сильно различаются по вкусовым характеристикам между штаммами.

В рамках проекта по тестированию определенных поверхностных культур для сыра типа Лимбург было возможно получить типичный аромат без B.белье но не без G. Candidum . Geotrichum Candidum часто преднамеренно не добавляют в качестве культуры для производства сыра Лимбург. Естественные уровни дрожжей в сырном молоке (~ 100 КОЕ мл -1 ) достаточны для быстрого роста во время теплого созревания перед намазыванием ( Рисунок 2 ) и определяют летучий вкус зрелого продукта, характерный для конкретной компании.

Летучие ароматические соединения серы, происходящие из метионина и цистеина, вероятно, являются ключевыми компонентами вкуса сыра и вносят свой вклад в нотку чеснока.Тиоэфиры ( S, -метилтиоацетат, тиопропионат, тиобутират и т. Д.) Важны для общего аромата. Brevibacterium linens отвечает за превращение метионина в метантиол, α-кетобутират и аммиак. Эти бактерии активно продуцируют очень ароматный летучий H 2 S, метантиол, диметилдисульфид, S -метилтиоацетат, 4-тритиапентан и этион — это может быть полезно для потребительского восприятия сырных мазков B.linens встречается в небольших количествах только в поверхностной микрофлоре.

Роль видов Corynebacterium в развитии аромата неясна. Вклад отобранного быстрорастущего штамма C. casei в развитие аромата не был обнаружен в модельных системах жидкого молока. Из-за преобладания коринебактерий на поверхности многих сортов сыра с мазком вероятно влияние на развитие аромата.

Типичный аромат размазанного кислого творога в основном создается дрожжами K.marxianus и C. krusei . Когда в кислый творог добавляются чистые культуры, K. marxianus высвобождает алкогольные, фруктовые и эфирные ноты, тогда как C. krusei выделяет больше сырных, серных нот. В сочетании с тем и другим уменьшаются алкогольные, фруктовые и сложноэфирные нотки, что дает полный сырный вкус, который явно отличается от всех сыров сычужного типа.

Неожиданные результаты были получены в демонстрационном проекте ЕС, где определенные поверхностные культуры были протестированы на трех полутвердых сортах намазанного сыра двух европейских производителей (Bel Leerdammer, Arla Foods).Даже у штаммов, выделенных из исследуемых товарных сыров, типичное развитие аромата было невозможно, когда зеленые сыры производились на объектах партнера по научному проекту Института Макса Рубнера, Киль, Германия. Для успешных исследований на определенных поверхностных культурах зеленые сыры должны были производиться на предприятиях промышленных партнеров. Для испытаний мазка на культуру сыр транспортировали погруженным в контейнеры с рассолом для сыра (определенная микрофлора), затем смазывали определенными заквасками и созревали на объектах в Киле, Германия.

В ходе проекта было обнаружено, что отбор штамма B. linens оказал наибольшее влияние на развитие аромата. Закваска с заданной поверхностью, состоящая из D. hansenii , S. equorum , B. linens , C. casei и M. gubbeenense , способна развить различные типичные ароматы трех выбранных сортов сыра. . Еще один неожиданный результат заключался в том, что большие различия в поверхностной флоре экспериментальных сыров после 15 недель созревания (90% S.equorum против 5% S. equorum ) не приводило к другому профилю аромата, оцененному с помощью сенсорного анализа. Можно сделать вывод, что состав поверхностной флоры сыров с мазками должен быть проанализирован несколько раз, прежде чем можно будет описать типичный состав; высокая степень вариации состава, вероятно, обнаруживается для всех сортов сыра с мазком.

Результаты показывают, что ароматические профили зрелых сыров в значительной степени зависят от производства зеленых сыров конкретной компанией и что конкуренты не могут скопировать уникальные сорта сыра, просто изолировав и используя штаммы из поверхностной флоры других продукты.Таким образом, знатоку может не понадобиться опасаться, что определенные поверхностные культуры приведут к однородному аромату сыров с мазками. Что касается всех других сортов сыра, основным фактором, приводящим к приглушенному аромату и «неинтересным» сырам, по-прежнему является сокращение дорогостоящего времени созревания. Взаимодействие видов с полумягким сыром, приводящее к полному мазку, высокому pH, типичному аромату и цвету, показано на Рис. 7 .

Рис. 7. Поверхностное созревание полумягких сыров, созревших по мазку.Показаны предполагаемые взаимодействия основных видов микрофлоры мазков, приводящие к быстрому росту, типичному аромату, цвету и защите поверхности от микробного загрязнения. Изображение основано на результатах, полученных с использованием заквасок с определенной поверхностью, описанных в тексте, и на анализе коммерческих сыров-мазков.

Временные изменения микробиоты влагалища в самостоятельных образцах и их связь с персистирующей инфекцией HPV16 и CIN2 + | Virology Journal

Исследуемая популяция и выборки

Женщины, участвовавшие в этом исследовании, были отобраны из предыдущего рандомизированного интервенционного исследования, проведенного между 2013 и 2015 годами и включавшего небеременных женщин в возрасте от 30 до 49 лет из округа Упсала, Швеция [22].Чтобы иметь право на участие в рандомизированном исследовании, женщина должна была быть в возрасте от 30 до 49 лет на момент включения (дата приглашения), у нее не было гистерэктомии в прошлом, не было текущей беременности и не было результатов клинических тестов (цитология мазка Папаниколау, тест на ВПЧ или гистология). на рак шейки матки, зарегистрированный в течение 1 года до даты приглашения.

Вкратце, рандомизированное интервенционное исследование включало в общей сложности 36 390 женщин, из которых 17 997 были рандомизированы для повторного тестирования на ВПЧ с самостоятельной выборкой.7997 женщин выполнили 1-й тест с 7443 отрицательными и 554 положительными тестами. Целью предыдущего исследования было сравнить скорость обнаружения CIN2 + в гистологии у женщин, выполняющих повторный самостоятельный забор вагинальной жидкости для тестирования на ВПЧ, с частотой обнаружения CIN2 + у женщин после регулярной программы скрининга, основанной на цитологии мазка Папаниколау. Женщин, которые оказались положительными на ВПЧ (N = 554) в первом тесте, попросили повторить самовыбор через 4–6 месяцев. 501 из 554 женщин следовали протоколу исследования и выполнили второй тест на ВПЧ, который дал 355 положительных результатов.Женщины, у которых был отрицательный результат на ВПЧ в первом (N = 7443) или втором тесте на ВПЧ (N = 146), были направлены на регулярную программу скрининга. Для настоящего исследования мы выбрали 26 женщин, которые были однократно инфицированы ВПЧ16 в исходном тесте и впоследствии оказались отрицательными в последующем тесте, и 38 женщин, которые были один раз инфицированы ВПЧ16 как в исходном, так и в последующем тестах, и позже был поставлен диагноз CIN2 + на основании гистологического исследования в течение периода наблюдения 18 месяцев с даты приглашения. Наконец, были включены 32 женщины того же возраста, у которых была проведена единственная самостоятельная выборка с отрицательным результатом теста на ВПЧ.Считалось, что женщины, инфицированные ВПЧ16 в исходном тесте и отрицательные на ВПЧ в последующем тесте, имели преходящие инфекции, в то время как женщины с двумя одиночными положительными образцами ВПЧ16 вместе с гистологией CIN2 + считались хронической инфекцией. Исследование было одобрено Региональным этическим комитетом в Упсале (Dnr 2012/099).

Сбор и обработка проб

Процедура вагинального самостоятельного отбора проб была описана ранее [23]. Вкратце, женщины выполнили сбор образцов с помощью щетки Rovers®Viba-brush (Rover Medical Devices B.V., Oss, Нидерланды) и нанесли образец на индикаторную карту FTA elute micro card ™ (арт. № WB129308, GE Healthcare, Longwood Dr, Cardiff CF14 7YT, UK). Инструкция заключалась в том, чтобы (1) вставить вибрационную щетку Rovers примерно на 5–10 см во влагалище и осторожно повернуть ее на один полный круг, (2) удалить щетку и нанести вагинальный образец на карту FTA elute micro card ™, поместив ее кистью посередине области нанесения и оберните ею один полный круг по этой области и (3) просушите карту FTA на воздухе в течение нескольких минут, сложите крышку, поместите ее в прилагаемый конверт и отправьте в лабораторию по изучению ВПЧ. обычной почтой.Все образцы были проанализированы на кафедре иммунологии, генетики и патологии Упсальского университета, Швеция. Карточки FTA обрабатывались с использованием автоматизированной лабораторной системы (easyPunch STARlet, Hamilton Robotics, Via Crusch 8 CH ‐ 7402 Bonaduz, GR, Швейцария), где рука робота берет каждую карточку, фотографирует область отбора проб и затем определяет, какая части карты, содержащие наибольшую концентрацию клеточного материала, с использованием программного обеспечения машинного обучения. Затем робот помещает карту в перфорационное устройство и собирает четыре круглых кусочка диаметром 3 мм в одной лунке 96-луночного микротитровального планшета.ДНК выделяли из перфорации карт, как описано ранее [24, 25].

Типирование ДНК ВПЧ

Для тестирования ДНК ВПЧ использовался клинически подтвержденный анализ на основе КПЦР, HPVIR [26]. Тест обнаруживает и количественно определяет следующие типы HPV: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58 и 59. Предел обнаружения (LOD) для HPV составляет 10 копий HPV на PCR. Этот тест также определяет и количественно определяет человеческий однокопийный ген (ген домашнего хозяйства), HMBS ( Homo sapiens, гидроксиметилбилансинтаза; номер доступа в GenBank.M95623.1) в качестве контроля количества клеточного материала человека. LOD для геномной ДНК человека составляет 10 копий HMBS на ПЦР.

Кольпоскопия и гистология

Кольпоскопическая оценка включала идентификацию плоскоклеточного соединения и зоны трансформации (TZ) с применением 5% раствора уксусной кислоты и йода. Биопсии были взяты из всех выявленных аномальных областей, а у женщин с нормальной кольпоскопией была взята слепая биопсия. Все гинекологические осмотры проводились в Клинике акушерства и гинекологии Университетской больницы Упсалы.Клинические классификации были в соответствии с SNOMED (Систематизированная, Номенклатура медицины; Колледж американских патологов, Скоки, Иллинойс, США), и для интерпретации результатов использовался самый высокий гистологический класс, обнаруженный у каждого пациента.

Подготовка образцов и ген 16S рРНК Секвенирование ампликона Ion Torrent

Гипервариабельные области 16S были амплифицированы с использованием набора для метагеномики Ion 16S ™ (Thermo Fisher Scientific) в соответствии с рекомендациями Руководства пользователя набора для метагеномики Ion 16S ™, версия C.0. Согласно инструкциям производителя, 3,0 мкл элюата FTA-карты использовали в качестве исходного материала для амплификации. После очистки с помощью гранул Agencourt® AMPure® XP ампликоны были количественно определены с помощью прибора Bioanalyzer (Agilent), и концентрации ДНК в продуктах находились в диапазоне от 1,6 до 77,3 нг / мкл. За исключением одного образца, в котором было использовано 50 нг, 100 нг исходного материала было использовано для системы AB Library Builder ™ (Thermo Fisher Scientific) в соответствии с руководством Ion Xpress ™ Plus и Ion Plus Library Preparation для AB Library. Builder ™ System , редакция 5.0. Подготовленные библиотеки амплифицировали для 5 циклов добавления, как описано в Руководстве пользователя Ion 16S ™ Metagenomics Kit , редакция C.0. Конечные библиотеки были количественно определены с использованием анализатора фрагментов (Agilent) и подготовлены в системе Ion Chef (Thermo Fisher Scientific) перед секвенированием в системе Ion S5 ™ XL (Thermo Fisher Scientific) на пяти чипах Ion 530 ™ (Thermo Fisher Scientific).

Первичный анализ данных проводился с помощью программы The Ion reporter версии 5.6. Вкратце, был проведен качественный анализ, требующий обнаружения праймера на обоих концах, минимальный охват выравнивания 90%.Анализ проводился с помощью встроенного конвейера QIIME с протоколом Metagenomics 16S w1.1. Использовалась справочная библиотека Curated Greengenes v13.5, и минимальное выравнивание требовалось 97% для идентификации рода и 99% для идентификации видов. Если идентификация на 99% не могла быть произведена на уровне вида, но была достигнута на уровне рода, использовались аннотации на уровне рода. Разница между двумя лучшими попаданиями должна составлять максимум 0,2% для подтверждения идентификации видов.

Статистический анализ

Статистические расчеты и данные получены с использованием R версии 3.4.3 [27]. Число считываний для каждой операционной таксономической единицы (OTU) было нормализовано по общему количеству считываний для каждого образца, например указывается в долях от общего числа прочтений. Бактерии, отличные от Lactobacillus , были сгруппированы по родам таксономического уровня, если информация была доступна, в противном случае они были сгруппированы по семействам таксономического уровня. Бактериальный род или семейство, которые составляли менее 1% от общего числа, были сгруппированы как «Прочие» для бактерий, отличных от Lactobacillus , и как «Lactobacillus sp.2 ”для бактерий Lactobacillus . Кластеризация K-средних была выполнена с четырьмя кластерами с использованием функции «kmeans», а результаты были визуализированы в виде тепловой карты с использованием пакета «pheatmap» [28]. Индекс Шеннона для альфа-разнообразия рассчитывался с использованием «веганского» пакета [29]. Графики Санки визуализировались с помощью пакета «rCharts» [30]. Биномиальное тестирование использовалось для сравнения распределения кластеров между группами выборок. Значения p были скорректированы для множественного тестирования с использованием поправки Бонферрони, а значения q считались значимыми, если значение q <0.05. Биномиальное тестирование использовалось для сравнения пропорций кластерного перехода.

Микробиом и рак шейки матки — FullText — Pathobiology 2021, Vol. 88, № 2

Аннотация

Хроническая инфекция, вызванная некоторыми типами вируса папилломы человека (ВПЧ) слизистых оболочек, является этиологическим фактором развития рака шейки матки и предшествующих ему поражений. Кроме того, известно, что несколько кофакторов играют роль в возникновении и прогрессировании заболевания шейки матки, способствуя или предотвращая инфекцию и персистентность ВПЧ.Микробиом здоровых женских половых путей характеризуется наличием 1 или нескольких разновидностей лактобацилл. Однако высокопроизводительные исследования, посвященные разнообразию и распространению бактерий в женских половых путях, показали, что несколько факторов, включая гормональный фон, гигиенические привычки и заболевания, передаваемые половым путем, могут нарушить естественный баланс, способствуя росту некоторых групп бактерий, которые в свою очередь может способствовать некоторым патологическим состояниям. Недавно вагинальный микробиом стал новой переменной, которая может сильно повлиять на естественное течение инфекций ВПЧ и их клиническое воздействие.В этом контексте изменения в микробиоме влагалища были обнаружены у женщин, инфицированных ВПЧ, и у женщин с поражениями, связанными с ВПЧ, и раком. Однако роль конкретных групп бактерий в развитии / прогрессировании или предотвращении / регрессе патологий, связанных с ВПЧ, не совсем понятна. В этом обзоре мы обобщаем текущие знания об изменениях в микробиоме влагалища и заболеваниях шейки матки. Мы обсуждаем потенциальное функциональное взаимодействие между конкретными бактериальными группами и исходами инфекции ВПЧ.

© 2020 S. Karger AG, Базель


Введение

Рак шейки матки (РШМ) является четвертым по частоте злокачественным новообразованием среди женщин во всем мире и представляет собой серьезную проблему для общественного здравоохранения. В 2018 г. произошло около 570 000 новых случаев заболевания и 311 000 случаев смерти, большинство из которых произошло в развивающихся странах [1–4]. Персистирующая инфекция вирусом папилломы человека (ВПЧ) типов ВПЧ с высоким онкогенным риском (ВПЧ) является основным фактором развития КХ, и она была обнаружена у 99.7% образцов CC [5]. Инфекция ВЧПЧ широко распространена у сексуально активных женщин. Однако частота поражений предшественников КК относительно невысока [6, 7]. Фактически, примерно 90% инфекций, вызываемых ВЧПЧ, являются временными и регрессируют спонтанно [8]. Риск заражения женщины любым типом ВПЧ в течение жизни составляет примерно 80%, тогда как риск развития ССЗ составляет 0,6% [9].

Инфекция hrHPV необходима, но недостаточна для развития CC, и дополнительные факторы участвуют в возникновении, прогрессировании или регрессе заболевания.Некоторые из этих факторов, такие как тип вируса, связаны с вирусом, а другие, такие как индивидуальный иммунитет, курение, половая принадлежность, использование гормональных контрацептивов и сексуальное поведение, связаны с хозяином [8].

Недавние исследования оценили потенциальную связь между микробиомом влагалища (VMB) и гинекологическим раком [10]. Состав VMB может влиять на местный иммунный ответ и может участвовать в онкогенезе шейки матки и клиренсе ВПЧ. VMB с преобладанием определенных видов лактобацилл может играть защитную роль против условно-патогенных инфекций и может представлять собой новую терапевтическую мишень [11].В этом обзоре будет рассмотрена вероятная взаимосвязь между составом VMB и развитием CC.

Микробиом влагалища

В человеческом организме существуют триллионы микроорганизмов, которые сосуществуют друг с другом и взаимодействуют с хозяином [12, 13]. Концепция микробиома была впервые использована Ледербергом и МакКреем [14] для обозначения набора комменсальных, симбиотических или патогенных микроорганизмов, которые живут в одном жизненном пространстве и развивают сложное взаимодействие с определенными тканями человека.

Первым крупным исследованием, направленным на изучение разнообразия микроорганизмов, присутствующих в различных органах человеческого тела, стал проект «Микробиом человека» (HMP), начатый в 2008 году.В этом исследовании был проанализирован состав микробиома различных частей тела, в том числе нижних отделов половых путей, у 242 здоровых людей [15].

В кишечнике большое разнообразие микроорганизмов связано со здоровой окружающей средой. Однако в здоровых женских половых путях обычно всего 1 или несколько разновидностей лактобацилл [16, 17]. После изучения микрофлоры влагалища 396 женщин разных национальностей было идентифицировано 5 типов состояния сообщества (CST) VMB [18].CST I, II, III и V представляют собой низкое микробное разнообразие, в котором преобладают Lactobacillus ( L ) crispatus , L. gasseri , L. iners и L. jensenii соответственно. . Напротив, CST IV образуется за счет уменьшения количества лактобацилл и большого разнообразия бактерий, связанных с бактериальным вагинозом (BV), которые в основном являются анаэробными бактериями. Наиболее часто обнаруживаются бактерии видов Gardnerella vaginalis , Megasphaera , Sneathia и Prevotella .Состав VMB динамичен, и у одной и той же женщины на протяжении всей жизни происходит частый переход от одного микробиома к другому, в основном от CST III к IV [19, 20].

На состав VMB влияют различные факторы, такие как этническая принадлежность, гормональные изменения, сексуальная активность и гигиенические привычки, а также лактация, сахарный диабет, стресс и диетические факторы [20-22]. Некоторые исследования показали, что VMB различается у женщин разных национальностей. Эти данные важны с учетом того, что среда, в которой преобладают бактерии, связанные с BV, больше связаны с инфекциями, передаваемыми половым путем [23, 24].Другие исследования показали, что у афроамериканских и латиноамериканских женщин наблюдается VMB, в котором бактерии, отличные от Lactobacillus spp. преобладают [23, 25, 26]. БВ может поражать более 50% женщин в Африке к югу от Сахары [27–29]. Это стало наиболее распространенным изменением у женщин репродуктивного возраста. Такие исследования предполагают, что различия в VMB у женщин разных рас могут частично объяснить разные уровни заболеваемости BV и инфекциями, передаваемыми половым путем, среди различных этнических групп.Такое разнообразие может быть связано с генетическими различиями между расами, включая несколько гаплотипов митохондриальной ДНК. Это показывает важность генетических факторов в определении микробиома людей, делая их более или менее склонными к заболеваниям [26].

Половые гормоны влияют на состав VMB, регулируя высвобождение провоспалительных цитокинов, хемокинов и AMP, способствуя отбору видов вагинальных микробов. Эстроген, в частности, участвует в переходе к богатому лактобациллами микробиому во время полового созревания и обратно бедному во время менопаузы [30].

Эстроген в эпителии влагалища приводит к его созреванию и разрастанию, а также к накоплению гликогена, который необходим для среды, богатой лактобактериями. После менопаузы снижение выработки эстрогенов сопровождается уменьшением количества лактобацилл и преобладанием анаэробов [21, 30]. Считается, что лактобациллы непосредственно метаболизируют гликоген с образованием молочной кислоты, ответственной за подкисление окружающей среды и поддержание лактобацилл. От этой концепции отказались после идентификации фермента α-амилазы в зрелом вагинальном эпителии, который находится под действием эстрогена.Было продемонстрировано, что этот фермент катаболизирует гликоген, вырабатывающий простые сахара, такие как мальтоза, мальтотриоза, мальтотетраоза и α-декстрины, которые способствуют образованию колоний лактобацилл [31].

В репродуктивном возрасте было замечено, что здоровая микробиота влагалища усиливает колебания местных иммунных ответов синхронно с гормональными изменениями менструального цикла [32]. Были продемонстрированы вариации в составе вагинальной флоры во время менструального цикла как следствие колебаний уровней эстрогена и прогестерона [20].В фазах, когда эстроген снижается, как в менопаузе, наблюдается снижение количества лактобацилл, которое можно исправить с помощью заместительной терапии эстрогенами [21].

Было также показано, что использование гормональных контрацептивов влияет на состав вагинальной флоры, снижая частоту, распространенность и рецидивы эпизодов БВ [33]. Кроме того, сексуальная активность является фактором, который, по-видимому, способствует сокращению популяции лактобацилл, способствуя бактериальному разнообразию [34]. Интересно, что спринцевание увеличивает риск БВ, тем самым демонстрируя влияние спринцевания на экосистему влагалища [35].

Никотин и его основной метаболит, то есть котинин, обнаруживаются в цервикальной слизи у женщин и в сперме курящих мужчин [36]. Было показано, что в клетках, инфицированных hrHPV, табачный дым вызывает увеличение транскрипции онкогена E6, что приводит к снижению активности и уровней p53 [37], что может способствовать развитию плоскоклеточного рака [38, 39]. Стоит отметить, что CST IV был повышен у курящих женщин [40].

BV (CST IV) характеризуется изменениями во влагалищной флоре, включая уменьшение количества лактобактерий и высокое бактериальное разнообразие [41].БВ ассоциируется с воспалительными заболеваниями органов малого таза, повышенным риском выкидыша, преждевременных родов и повышенным риском заражения венерическими заболеваниями, включая ВИЧ [9]. Диагноз может быть поставлен на основании клинических критериев в соответствии с классификацией Амселя. В соответствии с этим диагноз BV требует выполнения 3 из следующих 4 критериев: жидкие или буллезные белые выделения, наличие ключевых клеток, выявленных непосредственно под микроскопом или путем микроскопического исследования мазка, окрашенного по Граму, из выделений из гениталий, pH влагалища выше 4.5, и положительный аминный тест (рыбный запах, возникающий при добавлении 2 капель 10% гидроксида калия к выделениям из влагалища) [26, 42]. Другим распространенным методом диагностики является микроскопическая классификация, при которой анализируются различные типы бактериальной морфологии путем окрашивания по Граму Lactobacillus spp., Gardnerella spp. И Mobiluncus spp. Если окрашенные выделения получают оценку от 0 до 3, микрофлора влагалища в норме; если оценка 4–6 — средний балл; а если 7–10 — БВ [26, 43].

Несмотря на то, что мы признаем достоинства таких классификаций, они субъективны и могут привести к гипердиагностике БВ у значительного числа бессимптомных женщин. Исследования с использованием молекулярных методов, таких как ПЦР, для обнаружения позволили идентифицировать другие агенты, связанные с BV, такие как виды Atopobium vaginae , Clostridiales и Megasphaera [26]. Методы секвенирования нового поколения позволили идентифицировать большее количество бактерий, поскольку они амплифицировали фрагменты генов патогенов [44].

Состав микробиома и цервиковагинальное микроокружение

У человека цервиковагинальный микробиом взаимодействует с местным микроокружением, поддерживая гомеостаз тканей [45]. Когда этот баланс нарушается, что приводит к состоянию, известному как дисбиоз, могут запускаться несколько патологических процессов, включая нарушение эпителиального барьера, аномальную клеточную пролиферацию, нестабильность генома, ангиогенез, хроническое воспаление и нарушение метаболизма [17].

Микробиом и защита хозяина

Несколько защитных механизмов действуют для защиты женских половых путей от инфекционных агентов.К ним относятся эпителиальный барьер слизистой оболочки, слизь, секреция молочной кислоты и иммунный ответ. С этой точки зрения слизистая оболочка влагалища является барьером, который обеспечивает защиту от вторжения патогенов в результате взаимодействия между эпителиальными клетками, иммунной системой и колонизирующими микроорганизмами [46, 47].

Основным защитным механизмом, связанным с лактобациллами, является их способность вырабатывать молочную кислоту и поддерживать местный pH ниже 4,5, что вредно для большинства патогенов, а также вырабатывать бактериоцины, которые подавляют или устраняют патогены, передающиеся половым путем [48].Кроме того, лактобациллы могут образовывать микроколонии, которые прикрепляются к эпителиальным клеткам, предотвращая адгезию патогенов и их способность запускать защитные механизмы хозяина [49]. Здоровая микробиота влагалища также связана с повышенной экспрессией дефенсинов, которые представляют собой вагинальные антимикробные пептиды (AMP), которые предотвращают связывание специфических белков патогенов с клетками женских половых путей. Таким образом, было обнаружено снижение уровня АМФ у женщин с БВ [50, 51]. Считается, что экспрессия других типов AMP, таких как ингибитор секреторной лейкоцитарной протеазы (SLPI), коррелирует с бактериями, связанными с BV [52].Сообщалось о повышенных концентрациях SLPI у здоровых женщин [53], в то время как у женщин с BV концентрация была ниже [54].

Более того, возможным механизмом дисбактериоза влагалища является увеличение продукции провоспалительных цитокинов и хемокинов, связанное с увеличением разнообразия патогенных микробов, что способствует дополнительному привлечению иммунных клеток и усилению воспалительного ответа [30].

Микробиом, иммунный ответ и изменения шейки матки

BV связан с индукцией местного воспаления [25, 55].Одним из важных факторов является истощение запасов молочной кислоты и, как следствие, снижение ее противовоспалительного действия. Было показано, что молочная кислота индуцировала противовоспалительное состояние и подавляла воспаление, вызванное агонистами толл-подобных рецепторов (TLR). Кроме того, молочная кислота запускает путь интерлейкина (IL) -1 за счет продукции своего антагониста антагониста рецептора IL-1 (IL-1Ra) [56]. Напротив, лечение смесью метаболитов вагинальной микробиоты, соответствующей BV, увеличивало индуцированную TLR продукцию провоспалительных цитокинов, таких как TNF-α, и снижало продукцию RANTES и интерферон-γ-индуцированного белка 10 (IP-10) [57].

Предполагается, что воспаление, связанное с BV, в основном связано с высокими уровнями провоспалительных цитокинов, а не с привлечением иммунных клеток шейки матки. Исследование, сравнивающее женщин с РХ или дисплазией и женщин без неоплазии, показало, что среда с преобладанием не Lactobacillus характеризовалась провоспалительным (IL-36γ), хемотаксическим (IP10, MIP1β и RANTES), кроветворным (лиганд FLT3) и адаптивные иммунные (IL-2, IL-4 и растворимый лиганд CD40) цитокины, следовательно, коррелируют с дисбактериозом, воспалением и CC [25].

Когортное исследование с участием бессимптомных молодых южноафриканских женщин показало, что модификации цервиковагинальной среды, включая изменения кислотности влагалища и цитокинового профиля, могут быть связаны с местным микробным паттерном, а большое разнообразие бактериальных сообществ без доминирования лактобактерий связано с более высокими уровнями провоспалительных цитокинов. Группа женщин, в которой бактериальное сообщество состояло из большого разнообразия видов ( Sneathia sanguinigens , S.amnii , Mobiluncus mulieris , Prevotella amnii , Aerococcus и Fusobacterium ) показали более высокие уровни провоспалительных генитальных цитокинов. Индукция IL-1α, IL-1β и IL-8 этими бактериями также была продемонстрирована in vitro [58]. Кроме того, in vivo было продемонстрировано значительное увеличение уровней IL-1β и TNF-α в образцах стойкой патологической вагинальной микробиоты [59].

Было высказано предположение, что липополисахарид грамотрицательной бактериальной мембраны может восприниматься цервикальными антигенпрезентирующими клетками (APC), индуцируя передачу сигналов TLR4, активацию NF-kB и продукцию провоспалительных цитокинов и хемоаттрактантов Т-клеток.У женщин с высоким содержанием Prevotella наблюдалась выраженная реакция на липополисахариды, IFN-γ и IL-1β, вероятно, отражая иммунный ответ против грамотрицательных бактерий. CST IV APC также показал более высокую экспрессию CD80, ICAM-1 и MHC II, способствуя праймингу и эффекторной функции Т-клеток [58].

С другой стороны, модификации цервиковагинальной среды могут действовать вместе с инфекцией HPV, внося свой вклад с ранних стадий CC и создавая, например, состояние локальной иммуносупрессии [60].Некоторые исследования показали, что определенные виды цервиковагинальной микробиоты могут модулировать местный воспалительный иммунный ответ, возможно, способствуя экспрессии иммуносупрессивных цитокинов, и что аномальная микробиота влагалища связана с инфекцией и персистенцией ВПЧ [61].

Audirac-Chalifour et al. [60] провели исследование по анализу микробиома шейки матки и цитокиновых профилей на различных стадиях CC. Они предположили, что после инфицирования hrHPV эпителия шейки матки состав микробиома переключается с L.crispatus L. iners . По мере того, как инфекция прогрессирует до плоскоклеточного интраэпителиального поражения (SIL), наблюдается увеличение разнообразия микробиоты, отмеченного Sneathia и Fusobacterium spp . В CC также присутствовал Fusobacterium necrophorum , увеличивая разнообразие микробиома. В этой предложенной модели инфекция ВПЧ отвечает за создание иммуносупрессивного микроокружения (через экспрессию IL-10 и индукцию макрофагов 2 типа), которое усиливается TGFβ-1, полученным из микробиоты, создавая положительную обратную связь между микробиотой и профилем цитокинов.

CST преобладают Fusobacterium spp. связаны с иммуносупрессивным микроокружением, характеризующимся более высокими уровнями IL-4 и TGFβ-1 и переходом от иммунного ответа Th2 к Th3. Кроме того, существует прямое вмешательство в сигнальный путь E-cadherin / β-catenin на шейных клетках, трансформированных HPV [60]. В кишечнике, однако, было показано, что F. nucleatum оказывает провоспалительное и канцерогенное действие [62].

Микробиом, окислительный стресс и изменения шейки матки

Окислительный стресс, который отражает дисбаланс внутриклеточного окислительно-восстановительного состояния из-за избытка продукции активных форм кислорода (АФК) над антиоксидантной системой, также может быть следствием дисбактериоза [63 -65].АФК, включая супероксид-анион-радикал (O 2 • — ), гидроксильный радикал (OH ) и пероксид водорода (H 2 O 2 ), также могут играть полезную роль. вредная роль в биологических системах. Эти виды могут выполнять важные функции в регуляции клеточных сигнальных путей, таких как апоптоз и иммунная защита от инфекционных агентов. Однако накопление АФК может привести к окислительному повреждению клеточных структур и биомолекул, таких как белки, липиды и ДНК [65, 66].

Таким образом, окислительный стресс был связан с развитием и прогрессированием нескольких типов опухолей, включая CC [64, 67]. АФК и активные формы азота играют значительную роль в канцерогенезе шейки матки, опосредованном ВПЧ, поскольку накопление этих видов может увеличивать уровни повреждения ДНК, что может способствовать интеграции генома ВПЧ и последующей трансформации клеток [68]. Интеграция вирусной ДНК в геном хозяина часто способствует разрушению раннего вирусного гена E2, который ингибирует экспрессию онкогенов E6 и E7.Результатом является неконтролируемая экспрессия белков HPV E6 / E7, что приводит к усилению клеточной пролиферации и снижению апоптоза [9, 20, 69].

Хотя есть исследования, которые связывают окислительный стресс [64, 67] и VMB [11, 20, 70, 71] с CC, связь между окислительным стрессом и VMB обсуждается в литературе. Chen et al. [72] наблюдали, что уровни H 2 O 2 у женщин с БВ были почти в 10 раз выше, чем у здоровых пациентов, что позволяет предположить, что у этих пациентов сформировался окислительный стресс.Напротив, Piyathilake et al. [73], анализируя женщин с ВПЧ-положительной ЦИН, предположили, что цервиковагинальный микробиом может вызывать окислительное повреждение ДНК. Однако не наблюдалось никакой связи между разнообразием микробиома и окислительным повреждением ДНК, что измерялось по присутствию 8-гидрокси-2′-дезоксигуанозина (8-OHdG), биомаркера вызванного окислительным стрессом повреждения ДНК.

Здоровье влагалища было связано с присутствием Lactobacillus H 2 O 2 видов / штаммов, поскольку некоторые эпидемиологические исследования сообщили о возможном защитном эффекте H 2 O 2 против BV и другие передаваемые инфекции, такие как ВИЧ-1 [74-80].Помимо Lactobacillus spp. (кроме Lactobacillus iners ), лейкоциты, эндотелиальные и трансформированные клетки шейки матки, среди прочего, также могут генерировать перекись водорода. Одним из механизмов образования H 2 O 2 является дисмутация O 2 • — (продуцируемая НАДФН-оксидазой) в H 2 O 2 , которая может происходить спонтанно, оптимально при pH 4,8. , или катализируемые ферментами СОД (супероксиддисмутаза) [80, 81].

Кроме того, миелопероксидаза (МПО), фермент, экспрессируемый полиморфноядерными нейтрофилами и макрофагами, отвечает за реакцию галогенидов (например,g., Cl ) и H 2 O 2 , продуцируя хлорноватистую кислоту (HOCl), тип АФК, участвующих в окислительном взрыве, когда требуется врожденный иммунный ответ. Таким образом, было продемонстрировано, что антимикробная роль лактобацилл, продуцирующих H 2 O 2 , значительно выше в присутствии пероксидазы и галогенидов [77, 81-83]. Следовательно, считается, что HOCl является мощным противомикробным соединением, продуцируемым системой H 2 O 2 / пероксидаза / галогенид, присутствующей в фагоцитах и ​​тканевых жидкостях [83, 84].Интересно, что Klebanoff et al. [77] сообщили о повышенных концентрациях пероксидазы во влагалищных жидкостях почти у всех проанализированных пациенток (и о достаточной продукции HOCl). Кроме того, авторы не только наблюдали противомикробный эффект лактобацилл, продуцирующих H 2 O 2 , но также предположили противоопухолевый эффект этих бактерий.

Крюгер и Бауэр [83] предположили, что H 2 O 2 , продуцируемый Lactobacillus spp., Как таковой, не является благоприятным для вагинальных эпителиальных клеток, поскольку он вызывает неселективный апоптоз в трансформированных и нетрансформированных клетках.С другой стороны, добавление пероксидазы обеспечивает защиту нетрансформированных клеток от апоптоза, опосредованного производными лактобацилл H 2 O 2 . Учитывая, что HOCl реагирует с O 2 • — , полученным из трансформированных клеток, что приводит к продукции OH , которая вызывает апоптоз [82], было высказано предположение, что существует связь между присутствием H 2 O 2 -продуцирующие лактобациллы в VMB и повышенную активность MPO, которая вызывает клиренс HPV-инфицированных клеток и индуцирует апоптоз трансформированных клеток [84, 85].

Однако нет единого мнения о защитной роли H 2 O 2 в цервиковагинальном микробиоме. Некоторые исследователи считают маловероятным, что H 2 O 2 может оказывать противомикробное действие на VMB, поскольку цервиковагинальная среда большую часть времени гипоксична, а лактобактерии требуют больших количеств O 2 для образования перекиси водорода [80, 86]. В соответствии с этим аргументом, H 2 O 2 , продуцируемый лактобациллами, не был обнаружен в условиях гипоксии в цервиковагинальной жидкости [87] и супернатанте штаммов Lactobacillus [88].Более того, H 2 O 2 , генерируемый лактобациллами в физиологических концентрациях, не инактивировал HSV-2 (вирус простого герпеса 2 типа) или любые BV-ассоциированные бактерии, проанализированные in vitro, даже при добавлении MPO [87]. В том же исследовании также было замечено, что цервиковагинальная жидкость и сперма блокируют антимикробную активность H 2 O 2 .

В аэробных условиях, которые используются в большинстве исследований, в которых наблюдаются противомикробные эффекты лактобацилл, продуцирующих H 2 O 2 , предпочтение отдается выработке перекиси водорода, а не выработке молочной кислоты.Однако, когда лактобациллы растут в отсутствие кислорода, ферментация может быть предпочтительнее [80, 86, 89]. Так, было обнаружено, что молочная кислота продуцируется в более высоких концентрациях в условиях гипоксии [86, 90]. Кроме того, молочная кислота может инактивировать BV-ассоциированные бактерии и Chlamydia trachomatis , которые не наблюдались в присутствии H 2 O 2 [91, 92]. Кроме того, H 2 O 2 может представлять благоприятную характеристику лактобацилл или может быть просто маркером штаммов лактобацилл, которые защищают цервиковагинальную среду от других полезных причин [80, 86].

Дальнейшие исследования необходимы для понимания роли оксидативного стресса в VMB и того, как он может способствовать развитию и прогрессированию поражений шейки матки и рака.

Защитные механизмы, связанные с Lactobacillus

Lactobacillus spp. преобладает в средах с низким pH. Кислотность влагалища предотвращает колонизацию анаэробами, поддерживает эпителиальный барьер шейки матки за счет выработки бактериоцинов и действует против деградации муцина, предотвращая оппортунистические инфекции [21].Как упоминалось ранее, производство молочной кислоты подавляет рост нескольких анаэробных агентов, связанных с заболеваниями, передающимися половым путем, которые могут способствовать прогрессированию поражений шейки матки, когда они связаны с персистенцией hrHPV [93]. Инфекция C. trachomatis , по-видимому, увеличивает риск инфицирования ВЧСЧ вируса ССЗ из-за воспалительной реакции, которая увеличивает выработку АФК и свободных радикалов [94].

Di Pietro et al. [95] оценили одновременную цервикальную инфекцию C.trachomatis и HPV и разновидности ассоциированных микробиомов шейки матки. Женщины с обеими инфекциями демонстрировали большее бактериальное разнообразие, в первую очередь связанное с присутствием анаэробов, таких как G. vaginalis , A. vaginae и, в меньшем количестве, Lactobacillus , таким образом связывая дисбактериоз с возникновением инфекций. С другой стороны, у здоровых женщин преобладали Lactobacillus , причем анаэробные бактерии составляли <2% цервикальной флоры.Аналогичным образом, женщины, инфицированные только C. trachomatis , имели разнообразную цервикальную флору, но низкие уровни Lactobacillus . L. iners чаще выявлялся у женщин с коинфекцией по сравнению со здоровыми. Кроме того, было обнаружено, что состав флоры HPV-положительных и Chlamydia -отрицательных женщин существенно не отличался от такового у здоровых женщин. Тем не менее, в этом исследовании L. gasseri не было идентифицировано у ВПЧ-положительных женщин, что подтверждает выводы других авторов, которые связывают присутствие L.gasseri для избавления от ВПЧ-инфекции [96, 97].

Виды лактобацилл могут продуцировать 2 изомера молочной кислоты, то есть L- и D-молочную кислоту. Последний оказывает большее защитное действие против дисбактериоза влагалища [21]. Помимо производства молочной кислоты, виды Lactobacillus производят пептиды с антимикробным действием, такие как бактериоцины и биосурфактанты. L. iners может синтезировать только L-молочную кислоту и не может продуцировать перекись водорода, которая также проявляет ингибирующее действие против роста бактерий [21, 98].Более того, L. iners способен продуцировать инеролизин, порообразующий цитотоксин, подобный белку вагинолизина, секретируемому Gardnerella spp., Который образует поры в эпителии влагалища, способствуя развитию инфекций [98]. Таким образом, VMB с преобладанием L. crispatus связан с поддержанием целостности защитного поверхностного слоя слизистой оболочки и представляет меньший риск условно-патогенных бактериальных и вирусных урогенитальных инфекций, в том числе ВПЧ. С другой стороны, в VMB преобладают L.iners ассоциируется с повышенным риском вирусных инфекций и развития предшественников поражений и СС [21].

Микробиом, генитальная инфекция и рак

В нескольких исследованиях коррелировали различные VMB с инфекцией HPV, различными степенями CIN и CC. Mitra et al. [70] оценили группу из 169 женщин, направленных на кольпоскопию, и обнаружили увеличение бактериального разнообразия в сочетании с уменьшением количества лактобацилл, связанных с серьезностью цитологического поражения. CST IV присутствовал у 40% женщин с CC и только у 10% женщин с нормальной цитологией.С другой стороны, CST I присутствовал в 50% цитологических исследований и только в 20% случаев CC; низкие уровни L. jensenii были связаны с тяжелыми поражениями [70].

Известно, что некоторые сообщества бактерий-дисбиотиков вызывают нарушение иммунной регуляции, способствуя развитию микроокружения, способствующего развитию опухолей [99, 100]. Известно, что ВПЧ необходим, но недостаточен, чтобы вызвать CC. У большинства инфицированных женщин иммунный ответ способен контролировать инфекцию и предотвращать тяжелые поражения и опухоли [101].Среди кофакторов в развитии CC VMB может играть важную роль [44, 102].

BV был связан с более высокой частотой инфицирования HPV, предполагая, что увеличение разнообразия вагинальных бактерий вместе с уменьшением количества лактобацилл может способствовать сохранению инфекции HPV [44]. G. vaginalis способен секретировать фермент сиалидазу, который разлагает влагалищную слизь путем расщепления ее гликопротеинов. Одним из этих белков является муцин, который обеспечивает физический барьер на поверхности влагалищной слизи [21].Кроме того, бактерии, присутствующие в CST IV, также способны продуцировать масляную кислоту, которая может регулировать ацетилирование гистонов. Эпигенетическая регуляция, стимулируемая метаболитом, способствует реактивации латентного вируса ВИЧ-1, что указывает на потенциальное участие VMB в прогрессировании СПИДа [103]. Тем не менее, у женщин с CST IV наблюдается увеличение продукции провоспалительных цитокинов и рекрутирования клеток CD4 + и CCR5 +, активированных во влагалищной слизи, что способствует приобретению ВИЧ [28].

Kwasniewski et al. [44] оценили микрофлору влагалища 250 женщин, в том числе 70 здоровых женщин из контрольной группы, 95 женщин с низким уровнем SIL и положительным результатом на ВПЧ и 85 женщин с высоким уровнем SIL и положительным результатом на ВПЧ. В контрольной группе были обнаружены высокие уровни L. crispatus , L. iners и L. taiwanensis и отсутствие G. vaginalis и L. acidophilus . В группе низкого уровня SIL L. crispatus встречались реже, чем в контрольной группе и L.acidophilus и L. iners преобладали. С другой стороны, в группе с высоким уровнем SIL были увеличены G. vaginalis и L. acidophilus , в то время как частота встречаемости L. iners , L. crispatus и L. taiwanensis были ниже, чем в контрольной группе. Эти результаты показывают возможную связь между VMB, инфекцией HPV и развитием CIN. В микробиоме преобладают G. vaginalis и бедны L.iners , L. crispatus и L. taiwanensis может быть кофактором персистенции HPV, развития CIN и CC [44].

Di Paola et al. [104] оценили VBM у женщин, положительных на ДНК ВПЧ, и после 1 года лечения они повторно оценили их с новым вирусным генотипированием. Интересно, что исследование классифицировало CST IV на 2 категории, то есть CST IV-BV и CST IV-AV. CST IV-BV состоит преимущественно из анаэробных бактерий, таких как Gardnerella , Prevotella , Atopobium , Sneathia и (немногочисленные) виды Lactobacillus .С другой стороны, группа CST IV-AV состояла из аэробных и анаэробных бактерий, таких как Pseudomonas , Brevibacterium , Peptostreptococcus , Enterococcus , Streptococcus , Propion Shigella вида. У женщин с персистирующей инфекцией ВПЧ доминирующий VMB был образован анаэробами (CST IV-BV) и дефицитными лактобациллами, а у женщин с очищенной инфекцией HPV преобладала CST IV-AV.В контроле преобладали лактобациллы [104]. Эти данные коррелируют с дефицитом лактобацилл во флоре с повышенным риском заражения ВПЧ, а наличие БВ — с меньшей вероятностью выведения вирусной инфекции [104, 105]. Следовательно, разные лактобациллы играют разные роли. VMB с преобладанием L. crispatus связан с более низким риском заражения HPV, CIN и CC, тогда как VBM с преобладанием L. iners связан с более высоким риском заражения такими агентами [106] .

Предраковые поражения шейки матки, которые регрессируют по сравнению с поражениями, прогрессирующими до рака, имеют иную иммунную микросреду [107]. Конкретные бактерии, такие как Gardnerella , и рост микробиологического разнообразия могут использоваться в качестве биомаркеров шейных изменений для выявления женщин с высоким риском развития стойкой инфекции ВПЧ, CIN и рака [108].

Являются ли пробиотики вариантом лечения ВПЧ?

По данным Всемирной организации здравоохранения, пробиотики — это «живые микроорганизмы, которые при введении в адекватных количествах приносят пользу здоровью хозяина» [109].Виды Bifidobacterium , Lactobacillus и Streptococcus способны изменять микробиом хозяина, улучшая иммунный ответ и воспалительное состояние [110].

Пробиотики, содержащие виды лактобацилл, использовались при лечении урогенитальных инфекций для улучшения микрофлоры влагалища. Механизм действия включает закисление влагалища, предотвращение бактериальной адгезии и синергетическое действие с иммунной системой хозяина [110].Хотя нет убедительных данных об их эффективности, пробиотики, по-видимому, являются альтернативным дополнительным лечением БВ и заболеваний, передающихся половым путем, поскольку они не вызывают воспаление, не способствуют развитию резистентности и не имеют побочных эффектов [111].

Действие пробиотиков на цитологические изменения шейки матки и на инфекцию ВПЧ оценивали Verhoeven et al. [112] у 51 человека. Двадцать четыре женщины получали пробиотик Yakult®, который содержит штамма L. paracasei Shirota, ежедневно, и 27 женщин составили контрольную группу.Исходно все женщины имели положительный результат ПЦР на ВПЧ. Через 3 месяца ВПЧ исчез у 25% женщин, принимавших пробиотик, против 7,7% в контрольной группе. Через 6 месяцев уровень клиренса составил 29,2 и 19,2% в пробиотической и контрольной группах соответственно. Тем не менее, в том же исследовании клиренс цитологических аномалий, связанных с ВПЧ-инфекцией, был в два раза выше в группе пробиотиков, чем в контрольной группе [112].

Palma et al. [113] обследовали 117 женщин с BV или грибковой инфекцией (с цитологическими изменениями или наличием HPV / PCR).Женщины были разделены на 2 группы и получили вагинальную капсулу с L. rhamnosus BMX 54 после лечения инфекций. Группа 1 ( n = 60) получала пробиотики в течение 3 месяцев, а группа 2 ( n = 57) получала пробиотики в течение 6 месяцев. Через 3 и 6 месяцев были взяты образцы для цитологического исследования, кольпоскопии и бактериоскопии, а также для исследования грибков и вагиноза. Через 9 месяцев были включены анализы HPV / PCR. Результаты показали, что устранение цитологических изменений было в 2 раза больше в группе 2, которая использовала пробиотик в течение более длительного периода.Клиренс ВПЧ-инфекции также был выше во 2-й группе (т.е. 31,2% против 11,6% в 1-й группе), в которой также была более низкая частота рецидивов вагинальной инфекции [113]. Необходимы дополнительные лонгитюдные исследования, чтобы понять, связаны ли исходы CC и поражений с конституцией VMB.

Заключение

Исследования, проведенные в течение последнего десятилетия, подтвердили изменчивый и сложный состав VMB. Стойкая инфекция HPV с типами hrHPV является основным фактором риска развития почти всех CC и значительной части злокачественных новообразований влагалища и вульвы.Последние данные предполагают, что присутствие и обилие некоторых видов бактерий может предотвратить инфекцию ВПЧ и способствовать удалению вируса, снижая риск развития предшественников рака на этих анатомических участках. И наоборот, другие типы бактерий могут способствовать патологическому состоянию. Следовательно, понимание влияния состава VMB и его изменений (дисбактериоза) на инфекцию / персистентность ВПЧ может способствовать лучшему прогнозированию результатов заражения этим вирусом. Более того, четкая идентификация бактериальных компонентов, связанных с патологиями, вызванными ВПЧ, может иметь клиническое значение и предоставлять возможность для альтернативных терапевтических стратегий.Доступные в настоящее время технологии позволяют проводить быстрый высокопроизводительный анализ VMB. Эти инструменты следует применять в продольных исследованиях, чтобы определить участие конкретных видов бактерий в установлении, предотвращении, прогрессировании или регрессе патологий шейки матки, влагалища и вульвы, связанных с ВПЧ.

Заявление о конфликте интересов

Авторы не заявляют о конфликте интересов.

Источники финансирования

Это исследование было поддержано Фондом содействия развитию Сан-Паулу (FAPESP; FAPESP 2015 / 26573-2).

Вклад авторов

L.T. задумал, организовал и отредактировал этот обзор. C.P.C., M.L.S. и R.A.L.N. собрал информацию из литературы и подготовил эту статью. N.P.C.L. помогал в обсуждении этого обзора. Все авторы прочитали и одобрили окончательную версию этой статьи.

Список литературы

  1. Ферлей Дж., Эрвик М., Лам Ф., Коломбет М., Мери Л., Пиньерос М. и др.Глобальная обсерватория рака: «Рак сегодня» [Интернет] Лион, Франция: Международное агентство по изучению рака; 2018.
  2. Всемирная организация здравоохранения (ВОЗ). Вирус папилломы человека (ВПЧ) и рак шейки матки [Интернет]. 2019.
  3. Чжоу С., Туонг З.К., Фрейзер И.Х.Стратегии уклонения от вируса папилломы нацелены на инфицированную клетку и местную иммунную систему. Фасад Онкол. 2019 Август; 9 (Август): 682.
  4. Коэн П.А., Джингран А., Окнин А., Денни Л. Рак шейки матки. Ланцет. 2019 Янв; 393 (10167): 169–82.
  5. Грэм С.В.Цикл репликации вируса папилломы человека и его связь с прогрессированием рака: всесторонний обзор. Clin Sci (Лондон). 2017 август; 131 (17): 2201–21.
  6. Bosch FX, de Sanjosé S. Глава 1: Вирус папилломы человека и рак шейки матки — бремя и оценка причинной связи. J Natl Cancer Inst Monogr.2003; 2003 (31): 3–13.
  7. Giuliano AR, Tortolero-Luna G, Ferrer E, Burchell AN, de Sanjose S, Kjaer SK и др. Эпидемиология инфекции вируса папилломы человека у мужчин, онкологических заболеваний, отличных от шейки матки, и доброкачественных заболеваний. Вакцина. 2008 авг .; 26 (10 приложение 10): K17–28.
  8. Castellsagué X.Естественная история и эпидемиология инфекции ВПЧ и рака шейки матки. Gynecol Oncol. 2008 сентябрь; 110 (3 приложение 2): S4–7.
  9. Киргиу М., Митра А., Москицки А.Б. Играет ли микробиота влагалища роль в развитии рака шейки матки? Перевод Рез. 2017 Январь; 179 (4): 168–82.
  10. Чейз Д., Гоулдер А., Зенхаузерн Ф, Монах Б., Хербст-Краловец М.Микробиомы влагалища и желудочно-кишечного тракта при гинекологическом раке: обзор применения в этиологии, симптомах и лечении. Gynecol Oncol. 2015 июл; 138 (1): 190–200.
  11. Champer M, Wong AM, Champer J, Brito IL, Messer PW, Hou JY, et al. Роль микробиома влагалища при гинекологическом раке.BJOG. 2018 февраль; 125 (3): 309–15.
  12. Фостер KR, Schluter J, Coyte KZ, Rakoff-Nahoum S. Эволюция микробиома хозяина как экосистемы на привязи. Природа. 2017 август; 548 (7665): 43–51.
  13. Backhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI.Хозяин-бактериальный мутуализм в кишечнике человека. Наука. 2005 25 марта; 307 (5717): 1915–20.
  14. Ледерберг Б.Дж., МакКрей А.Т. Ome sweet omics: генеалогическая сокровищница слов. Наука. 2001; 15 (7): 8.
  15. Петерсон Дж., Гарджес С., Джованни М., Макиннес П., Ван Л., Шлосс Дж. А. и др.; Рабочая группа NIH HMP. Проект NIH Human Microbiome Project. Genome Res. 2009 декабрь; 19 (12): 2317–23.
  16. Лю М.Б., Сюй С.Р., Хе И, Дэн Г.Х., Шэн Х.Ф., Хуанг ХМ и др. Разнообразный микробиом влагалища у женщин репродуктивного возраста с кандидозным вульвовагинитом. PLoS One. 2013 Ноябрь; 8 (11): e79812.
  17. Ланевский П., Ильхан З.Е., Хербст-Краловец М.М. Микробиом и развитие гинекологического рака, профилактика и лечение. Нат Рев Урол. 2020 Апрель; 17 (4): 232–50.
  18. Равель Дж., Гайер П., Абдо З., Шнайдер Г.М., Кениг С.С., МакКулл С.Л. и др.Микробиом влагалища женщин репродуктивного возраста. Proc Natl Acad Sci USA. 2011 март; 108 (Дополнение 1): 4680–7.
  19. Ромеро Р., Хассан С.С., Гайер П., Тарка А.Л., Фадрош Д.В., Никита Л. и др. Состав и стабильность микробиоты влагалища здоровых беременных женщин отличаются от таковых у небеременных женщин.Микробиом. 2014 Февраль; 2 (1): 4.
  20. Митра А., Макинтайр Д.А., Марчези Дж. Р., Ли Ю. С., Беннет П. Р., Кирджиу М. Микробиота влагалища, папилломавирусная инфекция человека и интраэпителиальная неоплазия шейки матки: что мы знаем и куда мы идем дальше? Микробиом. 2016 ноя; 4 (1): 58.
  21. Амабебе Э., Анумба Д.О.Микроокружение влагалища: физиологическая роль лактобацилл. Фронт Мед (Лозанна). Июнь 2018; 5: 181.
  22. Rousseau V, Lepargneur JP, Roques C, Remaud-Simeon M, Paul F. Пребиотические эффекты олигосахаридов на выбранные вагинальные лактобациллы и патогенные микроорганизмы.Анаэроб. 2005 июн; 11 (3): 145–53.
  23. Zhou X, Brown CJ, Abdo Z, Davis CC, Hansmann MA, Joyce P и др. Различия в составе микробных сообществ влагалища у здоровых женщин европеоидной расы и темнокожих женщин. ISME J. Июнь 2007; 1 (2): 121–33.
  24. Куманс Э. Х., Штернберг М., Брюс С., МакКиллан Дж., Кендрик Дж., Саттон М. и др.Распространенность бактериального вагиноза в США, 2001–2004 гг .; ассоциации с симптомами, сексуальным поведением и репродуктивным здоровьем. Sex Transm Dis. 2007 ноябрь; 34 (11): 864–9.
  25. Ланевски П., Барнс Д., Гоулдер А., Цуй Х., Роу Д. Д., Чейз Д. М. и др. Связывание цервиковагинальных иммунных сигнатур, ВПЧ и состава микробиоты в канцерогенезе шейки матки у неиспаноязычных и латиноамериканских женщин.Научный отчет 2018; 8 (1): 7593.
  26. Грин К.А., Зарек С.М., Катерино В.Г. Гинекологическое здоровье и заболевание в связи с микробиомом женских половых путей. Fertil Steril. 2015 декабрь; 104 (6): 1351–7.
  27. Чико Р.М., Майо П., Арити К., Мабей Д., Ронсманс К., Чандрамохан Д.Распространенность малярии и инфекций, передаваемых половым путем, и инфекций репродуктивного тракта во время беременности в странах Африки к югу от Сахары: систематический обзор. ДЖАМА. 2012 Май; 307 (19): 2079–86.
  28. Госманн С., Анахтар М.Н., Хэндли С.А., Фаркасану М., Абу-Али Дж., Боуман Б.А. и др. Сообщества цервиковагинальных бактерий с дефицитом лактобацилл связаны с увеличением заражения ВИЧ среди молодых южноафриканских женщин.Иммунитет. 2017 Янв; 46 (1): 29–37.
  29. Джесперс В., Круситти Т., Ментен Дж., Верхелст Р., Мваура М., Мандалия К. и др. Распространенность и корреляты бактериального вагиноза в различных субпопуляциях женщин в Африке к югу от Сахары: перекрестное исследование. PLoS One. 2014 Октябрь; 9 (10): e109670.
  30. Torcia MG. Взаимодействие вагинального микробиома, иммунного ответа и вирусных инфекций, передаваемых половым путем. Int J Mol Sci. 2019 Янв; 20 (2): 266.
  31. Spear GT, French AL, Gilbert D, Zariffard MR, Mirmonsef P, Sullivan TH и др.Человеческая α-амилаза, присутствующая в жидкости слизистой оболочки нижних отделов половых путей, перерабатывает гликоген, поддерживая колонизацию влагалища Lactobacillus. J Infect Dis. 2014 Октябрь; 210 (7): 1019–28.
  32. Брэдли Ф., Бирс К., Хассельрот К., Ноэль-Ромас Л., Введение А, Вефер Х и др. Влагалищный микробиом усиливает циклические изменения, связанные с половыми гормонами, при цервиковагинальном воспалении и разрушении эпителиального барьера.Am J Reprod Immunol. 2018 июл; 80 (1): e12863.
  33. Vodstrcil LA, Hocking JS, Law M, Walker S, Tabrizi SN, Fairley CK и др. Гормональная контрацепция снижает риск бактериального вагиноза: систематический обзор и метаанализ. PLoS One. 2013 сентябрь; 8 (9): e73055.
  34. Джесперс В., ван де Вейгерт Дж., Коулс П., Верхелст Р., Верстрален Н., Делани-Моретлве С. и др .; Группа изучения вагинальных биомаркеров. Значение Lactobacillus crispatus и L. vaginalis для здоровья влагалища и отрицательный эффект недавнего секса: кросс-секционное описательное исследование среди групп африканских женщин.BMC Infect Dis. 2015 Март; 15 (1): 115.
  35. Schwebke JR, Desmond RA, Oh MK. Предикторы бактериального вагиноза у спринцевавшихся женщин подросткового возраста. Sex Transm Dis. Июль 2004 г., 31 (7): 433–6.
  36. Прокопчик Б., Кокс Дж. Э., Хоффманн Д., Вагонер С. Е..Выявление специфических для табака канцерогенов в слизи шейки матки курильщиков и некурящих. J Natl Cancer Inst. 1997 июнь; 89 (12): 868–73.
  37. Вэй Л., Гриего А.М., Чу М., Озбун М.А. Воздействие табака приводит к увеличению экспрессии онкогенов E6 и E7, повреждению ДНК и скорости мутаций в клетках, поддерживающих эписомные геномы вируса папилломы человека 16.Канцерогенез. 2014 Октябрь; 35 (10): 2373–81.
  38. Лун П., Уокер Дж., Шиффман М., Зуна Р.Э., Данн С.Т., Голд М.А. и др. Роль кофакторов в прогрессировании от инфекции вируса папилломы человека до рака шейки матки. Gynecol Oncol. 2013 февраль; 128 (2): 265–70.
  39. Эпплби П., Берал В., Беррингтон де Гонсалес А., Колин Д., Франчески С., Гудилл А. и др.; Международное сотрудничество в области эпидемиологических исследований рака шейки матки. Карцинома шейки матки и курение табака: совместный повторный анализ индивидуальных данных о 13 541 женщине с карциномой шейки матки и 23 017 женщинах без рака шейки матки по результатам 23 эпидемиологических исследований. Int J Cancer. 2006 Март; 118 (6): 1481–95.
  40. Brotman RM, He X, Gajer P, Fadrosh D, Sharma E, Mongodin EF и др.Связь между курением сигарет и микробиотой влагалища: пилотное исследование. BMC Infect Dis. 2014 Август; 14 (1): 471.
  41. Hill GB. Микробиология бактериального вагиноза. Am J Obstet Gynecol. 1993 август; 169 (2 Pt 2): 450–4.
  42. Spiegel CA, Амзель Р., Холмс К.К.Диагностика бактериального вагиноза методом прямого окрашивания по Граму влагалищной жидкости. J Clin Microbiol. Июль 1983 г., 18 (1): 170–7.
  43. Ньюджент Р.П., Крон М.А., Хиллиер С.Л. Надежность диагностики бактериального вагиноза повышается за счет стандартизированного метода интерпретации окраски по Граму. J Clin Microbiol.1991 Февраль; 29 (2): 297–301.
  44. Kwasniewski W, Wolun-Cholewa M, Kotarski J, Warchol W, Kuzma D, Kwasniewska A, et al. Дисбиоз микробиоты связан с канцерогенезом шейки матки, вызванным ВПЧ. Oncol Lett. 2018 декабрь; 16 (6): 7035–47.
  45. Детлефсен Л, Макфолл-Нгай М, Релман Д.А.Экологический и эволюционный взгляд на мутуализм и болезни человека и микробов. Природа. Октябрь 2007 г., 449 (7164): 811–8.
  46. Taddei CR, Cortez RV, Mattar R, Torloni MR, Daher S. Микробиом при нормальной и патологической беременности: обзор литературы. Am J Reprod Immunol. 2018 август; 80 (2): e12993.
  47. Боргдорф Х., Гаутам Р., Армстронг С.Д., Ся Д., Ндайисаба Г.Ф., Ван Тейлинген Н.Х. и др. Дисбиоз цервиковагинального микробиома связан с протеомными изменениями, связанными с изменениями цервиковагинального слизистого барьера. Mucosal Immunol. 2016 Май; 9 (3): 621–33.
  48. Валенти П., Роза Л., Капобианко Д., Лепанто М.С., Скьяви Э., Кутоне А и др.Роль лактобацилл и лактоферрина в цервиковагинальной защите слизистой оболочки. Том 9. Границы иммунологии. Frontiers Media S.A .; 2018.
  49. Петрова М.И., Ливенс Э., Малик С., Имхольц Н., Лебеер С. Виды лактобацилл как биомаркеры и агенты, которые могут способствовать различным аспектам здоровья влагалища.Front Physiol. Март 2015; 6:81.
  50. Аль-Насири С., Амброзино Э., Шлепфер М., Морре С.А., Витен Л., Вонкен Дж. В. и др. Взаимодействие между микробиотой репродуктивного тракта и иммунологической системой в репродукции человека. Фронт Иммунол. 2020 Март; 11 (Март): 378.
  51. Valore EV, Wiley DJ, Ganz T.Обратимый дефицит антимикробных полипептидов при бактериальном вагинозе. Заражение иммунной. 2006 Октябрь; 74 (10): 5693–702.
  52. Смит С.Б., Равель Дж. Микробиота влагалища, защита хозяина и репродуктивная физиология. J Physiol. 2017 Январь; 595 (2): 451–63.
  53. Nasioudis D, Beghini J, Bongiovanni AM, Giraldo PC, Linhares IM, Witkin SS.α-Амилаза во влагалищной жидкости: связь с условиями, благоприятными для доминирования Lactobacillus. Reprod Sci. 2015 ноя; 22 (11): 1393–8.
  54. Балкус Дж, Агнью К., Лоулер Р., Митчелл С., Хитти Дж. Влияние беременности и бактериального вагиноза на концентрации провоспалительных цитокинов и ингибиторов секреторной лейкоцитарной протеазы во влагалищных секретах.J Беременность. 2010; 2010: 385981.
  55. Лин GG, Скотт JG. Бактериальный вагиноз и цервиковагинальный иммунный ответ. Am J Reprod Immunol. 2012. 100 (2): 130–4.
  56. Hearps AC, Tyssen D, Srbinovski D, Bayigga L, Diaz DJ, Aldunate M и др.Влагалищная молочная кислота вызывает противовоспалительный ответ цервиковагинальных эпителиальных клеток человека и подавляет выработку провоспалительных медиаторов, связанных с приобретением ВИЧ. Mucosal Immunol. 2017 ноя; 10 (6): 1480–90.
  57. Дельгадо-Диаз DJ, Тиссен Д., Хейворд Дж.А., Гугасян Р., Херпс А.С., Тачеджян Г.Отчетливые иммунные ответы, вызванные цервиковагинальными эпителиальными клетками молочной кислотой и короткоцепочечными жирными кислотами, связанные с оптимальной и неоптимальной микробиотой влагалища. Front Cell Infect Microbiol. 2020 Янв; 9: 446.
  58. Anahtar MN, Byrne EH, Doherty KE, Bowman BA, Yamamoto HS, Soumillon M, et al.Цервиковагинальные бактерии являются основным модулятором воспалительных реакций хозяина в женских половых путях. Иммунитет. 2015 Май; 42 (5): 965–76.
  59. Турман А.Р., Кимбл Т., Херольд Б., Мескита П.М., Фичорова Р.Н., Давуд Х.Й. и др. Бактериальный вагиноз и субклинические маркеры воспаления половых путей и иммунитета слизистой оболочки.AIDS Res Hum Retroviruses. 2015 ноя; 31 (11): 1139–52.
  60. Audirac-Chalifour A, Torres-Poveda K, Bahena-Román M, Téllez-Sosa J, Martínez-Barnetche J, Cortina-Ceballos B и др. Цервикальный микробиом и профиль цитокинов на различных стадиях рака шейки матки: пилотное исследование. PLoS One.2016 апр; 11 (4): e0153274.
  61. Гао В., Вен Дж., Гао Ю., Чен Х. Сравнение разнообразия вагинальной микробиоты женщин с и без инфекции вируса папилломы человека: перекрестное исследование. BMC Infect Dis. 2013 июн; 13 (1): 271.
  62. Костич А.Д., Чун Э., Робертсон Л., Гликман Дж. Н., Галлини К.А., Мишо М. и др.Fusobacterium nucleatum усиливает онкогенез кишечника и модулирует иммунное к опухоли микроокружение. Клеточный микроб-хозяин. 2013 август; 14 (2): 207–15.
  63. Холмс К.К., Чен К.С., Липински С.М., Эшенбах Д.А. Окислительно-восстановительный потенциал влагалища при бактериальном вагинозе (неспецифическом вагините).J Infect Dis. 1985 август; 152 (2): 379–82.
  64. Klaunig JE. Окислительный стресс и рак. Curr Pharm Des. 2018; 24 (40): 4771–8.
  65. Эбрахими С., Солтани А., Хашеми С.И.Окислительный стресс в патогенезе рака шейки матки и резистентность к терапии. J Cell Biochem. 2018 ноя; 120 (5): 6868–77.
  66. Валко М., Родс С.Дж., Монкол Дж., Изакович М., Мазур М. Свободные радикалы, металлы и антиоксиданты при раке, вызванном окислительным стрессом. Chem Biol Interact. 2006 Март; 160 (1): 1–40.
  67. Прасад С, Гупта СК, Тьяги АК. Активные формы кислорода (АФК) и рак: роль антиоксидантных нутрицевтиков. Cancer Lett. 2017 Февраль; 387: 95–105.
  68. Уильямс В.М., Филиппова М., Филиппов В., Пейн К.Дж., Дюрксен-Хьюз П.Вирус папилломы человека типа 16 E6 * вызывает окислительный стресс и повреждение ДНК. J Virol. 2014 июнь; 88 (12): 6751–61.
  69. Вудман CB, Коллинз SI, Янг LS. Естественное течение цервикальной ВПЧ-инфекции: нерешенные вопросы. Нат Рев Рак. 2007 Янв; 7 (1): 11–22.
  70. Митра А., Макинтайр Д.А., Ли Ю.С., Смит А., Марчези Дж. Р., Лене Б. и др.Прогрессирование интраэпителиальной неоплазии шейки матки связано с увеличением разнообразия микробиома влагалища. Sci Rep.2015 Ноябрь; 5 (Октябрь): 16865.
  71. Curty G, de Carvalho PS, Soares MA. Роль микробиома шейки матки в генезе и как биомаркер предзлокачественной интраэпителиальной неоплазии шейки матки и инвазивного рака шейки матки.Int J Mol Sci. 2019 Декабрь; 21 (1): E222.
  72. Chen Z, Zhang Z, Zhang H, Xie B. Анализ статуса окислительного стресса при неспецифическом вагините и его роль в апоптозе вагинальных эпителиальных клеток. Biomed Res Int. 2015; 2015.
  73. Пиятилаке С.Дж., Ольбердинг, штат Нью-Джерси, Кумар Р., Макалузо М., Альварес Р.Д., Морроу, компакт-диск.Микробиота шейки матки, связанная с интраэпителиальной неоплазией шейки матки более высокой степени у женщин, инфицированных вирусами папилломы человека высокого риска. Рак Prev Res (Phila). 2016 Май; 9 (5): 357–66.
  74. Антонио MA, Hawes SE, Hillier SL. Идентификация видов вагинальных Lactobacillus и демографические и микробиологические характеристики женщин, колонизированных этими видами.J Infect Dis. 1999 декабрь; 180 (6): 1950–6.
  75. Эшенбах Д.А., Дэвик П.Р., Уильямс Б.Л., Клебанофф С.Дж., Янг-Смит К., Кричлоу С.М. и др. Распространенность видов Lactobacillus, продуцирующих перекись водорода, у здоровых женщин и женщин с бактериальным вагинозом. J Clin Microbiol. 1989 Февраль; 27 (2): 251–6.
  76. Хавс С.Е., Хиллиер С.Л., Бенедетти Дж., Стивенс К.Э., Коутски Л.А., Вёльнер-Ханссен П. и др. Лактобациллы, продуцирующие перекись водорода, и приобретение вагинальных инфекций. J Infect Dis. 1996 ноя; 174 (5): 1058–63.
  77. Klebanoff SJ, Hillier SL, Eschenbach DA, Waltersdorph AM.Контроль микробной флоры влагалища с помощью лактобацилл, вырабатывающих h3O2. J Infect Dis. 1991 Июль; 164 (1): 94–100.
  78. Клебанофф С.Дж., Кумбс Р.В. Вирицидный эффект Lactobacillus acidophilus на вирус иммунодефицита человека 1 типа: возможная роль в передаче гетеросексуальным путем.J Exp Med. 1991 июль; 174 (1): 289–92.
  79. Cherpes TL, Hillier SL, Meyn LA, Busch JL, Krohn MA. Хрупкий баланс: факторы риска заражения бактериальным вагинозом включают половую активность, отсутствие продуцирующих перекись водорода лактобацилл, черную расу и положительную серологию вируса простого герпеса 2 типа.Sex Transm Dis. 2008, январь; 35 (1): 78–83.
  80. Ваничутт М. Микробное сообщество влагалища человека. Res Microbiol. 2017 ноябрь — декабрь; 168 (9-10): 811–25.
  81. Klebanoff SJ.Миелопероксидаза: друг и враг. J Leukoc Biol. 2005 Май; 77 (5): 598–625.
  82. Матош А., да Силва А.П., Медейруш Р., Бичо М., Бичо М.С. Микроокружение во влагалище как ключевой игрок в раке шейки матки: взаимодействие полиморфных генетических вариантов и вагинального микробиома как кофакторов.Рак шейки матки — Скрининг. Лечение и профилактика — универсальные протоколы абсолютного контроля. InTech; 2018.
  83. Krüger H, Bauer G. Лактобациллы усиливают зависимую от активных форм кислорода передачу сигналов, индуцирующих апоптоз. Redox Biol. 2017 Апрель; 11: 715–24.
  84. Кастелан С., да Силва А.П., Матош А., Инасио А., Бичо М., Медейрос Р. и др.Связь полиморфизма миелопероксидазы (G463A) с раком шейки матки. Mol Cell Biochem. 2015 июн; 404 (1-2): 1–4.
  85. Бауэр Г. Lactobacilli-опосредованный контроль рака влагалища посредством взаимодействия специфических активных форм кислорода. Мед-гипотезы. 2001 август; 57 (2): 252–7.
  86. Такеджян Дж., О’Ханлон Д.Е., Равель Дж.Невероятная «in vivo» роль перекиси водорода как антимикробного фактора, продуцируемого микробиотой влагалища. Микробиом. 2018 Февраль; 6 (1): 29.
  87. O’Hanlon DE, Lanier BR, Moench TR, Cone RA. Цервиковагинальная жидкость и сперма блокируют микробицидную активность перекиси водорода, продуцируемой вагинальными лактобациллами.BMC Infect Dis. 2010 Май; 10 (1): 120.
  88. Оканья В.С., Пеше де Руис Хольгадо А.А., Надер-Масиас МЭ. Выбор вагинальных видов Lactobacillus, генерирующих h3O2, для использования в качестве пробиотиков. Curr Microbiol. 1999 Май; 38 (5): 279–84.
  89. Тачеджян Г., Алдунате М., Брэдшоу К.С., Конус Р.А.Роль продукции молочной кислоты пробиотическими видами Lactobacillus для здоровья влагалища. Res Microbiol. 2017 ноябрь — декабрь; 168 (9-10): 782–92.
  90. О’Ханлон, Д.Э., Мёнч, Т.Р., Конус, Р.А. PH влагалища и бактерицидная молочная кислота, когда лактобациллы доминируют в микробиоте. PLoS One. 2013 Ноябрь; 8 (11): e80074.
  91. Gong Z, Luna Y, Yu P, Fan H. Лактобациллы инактивируют Chlamydia trachomatis через молочную кислоту, но не через h3O2. PLoS One. 2014 сентябрь; 9 (9): e107758.
  92. О’Ханлон, Д.Э., Мёнч, Т.Р., Конус, Р.А.В вагинальной жидкости бактерии, связанные с бактериальным вагинозом, можно подавить с помощью молочной кислоты, но не перекиси водорода. BMC Infect Dis. 2011 Июль; 11 (1): 200.
  93. Робиал Р., Лонатто-Филхо А., Ротели-Мартинс С.М., Сильвейра М.Ф., Штауфферт Д., Рибейро Г.Г. и др. Частота инфицирования Chlamydia trachomatis в цервикальных интраэпителиальных поражениях и статус цитологического двойного окрашивания p16 / Ki-67.Заражение агентурным раком. 2017 Янв; 12 (1): 3.
  94. Чжу Х., Шен З., Ло Х., Чжан В., Чжу X. Риск рака шейки матки, связанный с инфекцией Chlamydia Trachomatis: метаанализ. Медицина (Балтимор). 2016 Март; 95 (13): e3077.
  95. Ди Пьетро М., Филардо С., Порпора М.Г., Ресине Н., Латино М.А., Сесса Р.Коинфекция HPV / Chlamydia trachomatis: метагеномный анализ микробиоты шейки матки у бессимптомных женщин. New Microbiol. 2018 Янв; 41 (1): 34–41.
  96. Шеннон Б., Йи Т.Дж., Перузини С., Гаджер П., Ма Б., Хамфрис М.С. и др. Связь инфекции ВПЧ и клиренса с цервиковагинальной иммунологией и вагинальной микробиотой.Mucosal Immunol. 2017 Сен; 10 (5): 1310–9.
  97. Brotman RM, Shardell MD, Gajer P, Tracy JK, Zenilman JM, Ravel J, et al. Взаимодействие между временной динамикой вагинальной микробиоты и обнаружением вируса папилломы человека. J Infect Dis. 2014, 1 декабря; 210 (11): 1723–33.
  98. Петрова М.И., Рид Г., Ваничутт М., Лебеер С.Lactobacillus iners: друг или враг? Trends Microbiol. 2017 Март; 25 (3): 182–91.
  99. Гарретт WS. Рак и микробиота. Наука. 2015 г. 3 апреля; 348 (6230): 80–6.
  100. Швабе РФ, Джобин К.Микробиом и рак. Нат Рев Рак. 2013 ноябрь; 13 (11): 800–12.
  101. Insinga RP, Perez G, Wheeler CM, Koutsky LA, Garland SM, Leodolter S и др .; БУДУЩЕЕ I Следователи. Инцидент цервикальных инфекций ВПЧ у молодых женщин: вероятность перехода на CIN и устранение инфекции.Биомаркеры эпидемиологии рака Пред. 2011 Февраль; 20 (2): 287–96.
  102. Guijon F, Paraskevas M, Rand F, Heywood E, Brunham R, McNicol P. Микробная флора влагалища как кофактор в патогенезе цервикальной интраэпителиальной неоплазии матки. Int J Gynaecol Obstet. Март 1992 г., 37 (3): 185–91.
  103. Имаи К., Очиай К. Влияние микробной коинфекции ВИЧ-1 и анаэробных бактерий, продуцирующих масляную кислоту, на прогрессирование СПИДа. J Oral Biosci. 2013 Май; 55 (2): 55–60.
  104. Ди Паола М., Сани С., Клементе А.М., Иосса А., Перисси Е., Кастроново Г. и др.Характеристика цервико-вагинальной микробиоты у женщин, у которых развивается стойкая инфекция папилломавируса человека высокого риска. Научный доклад 2017 августа; 7 (1): 10200.
  105. Брюсселэрс Н., Шреста С., ван де Вейгерт Дж., Верстрален Х. Дисбактериоз влагалища и риск папилломавируса человека и рака шейки матки: систематический обзор и метаанализ.Am J Obstet Gynecol. Июль 2019; 221 (1): 9–18.e8.
  106. Норенхаг Дж., Ду Дж., Оловссон М., Верстрален Х., Энгстранд Л., Брюсселаерс Н. Влагалищная микробиота, вирус папилломы человека и дисплазия шейки матки: систематический обзор и сетевой метаанализ. BJOG. 2020 Янв; 127 (2): 171–80.
  107. Øvestad IT, Gudlaugsson E, Skaland I, Malpica A, Kruse AJ, Janssen EA и др.Местный иммунный ответ в микросреде CIN2-3 со спонтанным регрессом и без него. Мод Pathol. 2010 Сен; 23 (9): 1231–40.
  108. Усик М., Зольник С.П., Касл П.Е., Поррас С., Эрреро Р., Градиссимо А. и др .; Коста-Рика Группа испытаний вакцины против ВПЧ (CVT). Цервиковагинальный микробиом и естественная история ВПЧ в продольном исследовании.PLoS Pathog. 2020 Март; 16 (3): e1008376.
  109. Эбнер С., Самодовольный Л.Н., Кнайфель В., Салминен С.Дж., Сандерс М.Э. Пробиотики в диетических рекомендациях и клинических рекомендациях за пределами Европейского Союза. Мир Дж. Гастроэнтерол. 2014 Ноябрь; 20 (43): 16095–100.
  110. Ли Й, Ю Т, Ян Х, Ли Д, Ю Т, Юань Т и др.Влагалищная микробиота и инфекция ВПЧ: новые механистические взгляды и терапевтические стратегии. Устойчивость к заражению лекарствами. 2020 апр; 13: 1213–20.
  111. Рид Г. Изменило ли знание вагинального микробиома подходы к здоровью и болезням? F1000 Res. 2018 Апрель; 7 (0): 460.
  112. Верховен В., Ренард Н., Макар А., Ван Ройен П., Богерс Дж. П., Лардон Ф. и др.Пробиотики улучшают клиренс шейных поражений шейки матки, связанных с вирусом папилломы человека: проспективное контролируемое пилотное исследование. Eur J Cancer Пред. 2013 Янв; 22 (1): 46–51.
  113. Пальма Е., Ресине Н., Доменичи Л., Джорджини М., Пиеранджели А., Паничи ПБ. Долгосрочное применение Lactobacillus rhamnosus BMX 54 для восстановления сбалансированной экосистемы влагалища: многообещающее решение против ВПЧ-инфекции.BMC Infect Dis. 2018 Янв; 18 (1): 13.

Автор Контакты

Lara Termini

Innovation in Cancer Laboratory, Centro de Investigação Translacional em Oncologia

Instituto do Câncer do Estado de São Paulo Octavio Frias de Oliveira, Faculdade de Medicina da Universidade de São Paulo, Rua Dr.Ovídio Pires de Campos, 872-3 Andar

Cerqueira César, São Paulo, SP CEP 05403-911 (Бразилия)

[email protected]


Подробности статьи / публикации

Предварительный просмотр первой страницы

Получено: 27 июля 2020 г.
Дата принятия: 7 сентября 2020 г.
Опубликована онлайн: 23 ноября 2020 г.
Дата выпуска: март 2021 г.

Количество страниц для печати: 11
Количество рисунков: 0
Количество столов: 0

ISSN: 1015-2008 (печатная версия)
eISSN: 1423-0291 (онлайн)

Для дополнительной информации: https: // www.karger.com/PAT


Авторские права / Дозировка препарата / Заявление об ограничении ответственности

Авторские права: Все права защищены. Никакая часть данной публикации не может быть переведена на другие языки, воспроизведена или использована в любой форме и любыми средствами, электронными или механическими, включая фотокопирование, запись, микрокопирование или с помощью какой-либо системы хранения и поиска информации, без письменного разрешения издателя. .
Дозировка лекарства: авторы и издатель приложили все усилия, чтобы гарантировать, что выбор и дозировка лекарства, указанные в этом тексте, соответствуют текущим рекомендациям и практике на момент публикации.Тем не менее, ввиду продолжающихся исследований, изменений в правительственных постановлениях и постоянного потока информации, касающейся лекарственной терапии и реакций на них, читателю настоятельно рекомендуется проверять листок-вкладыш для каждого препарата на предмет любых изменений показаний и дозировки, а также дополнительных предупреждений. и меры предосторожности. Это особенно важно, когда рекомендованным агентом является новый и / или редко применяемый препарат.
Отказ от ответственности: утверждения, мнения и данные, содержащиеся в этой публикации, принадлежат исключительно отдельным авторам и соавторам, а не издателям и редакторам.Появление в публикации рекламы и / или ссылок на продукты не является гарантией, одобрением или одобрением рекламируемых продуктов или услуг или их эффективности, качества или безопасности. Издатель и редактор (-ы) не несут ответственности за любой ущерб, причиненный людям или имуществу в результате любых идей, методов, инструкций или продуктов, упомянутых в контенте или рекламе.

Валидация упрощенной классификации вагинальных мазков, окрашенных по Граму, для использования в клиниках мочеполовой медицины

Бактериальный вагиноз (БВ) — это клиническое заболевание, которое характеризуется изменением экологии влагалища, при котором нормальная флора морфотипов лактобацилл заменяется смешанной микробной Флора состоит из анаэробов и Gardnerella vaginalis . 1 Первоначальное описание, сделанное Гарднером и Дьюксом в 1955 году. 2 остается точным описанием клинических проявлений жидких однородных выделений из влагалища с неприятным запахом. Тем не менее, различные методы использовались для диагностики до 1984 года, когда был достигнут консенсус в отношении определения диагноза BV с использованием составных критериев, описанных Amsel et al . 3 К ним относятся жидкие однородные выделения, повышенный уровень pH влагалища выше 4,5, высвобождение аминов при добавлении 10% гидроксида калия к влагалищной жидкости и наличие «подсказок» клеток, три из которых должны присутствовать для постановки диагноза. BV.

Альтернативный метод диагностики, который широко используется, особенно в научных исследованиях, — это оценка (или оценка) микробной флоры в мазках вагинальной жидкости, окрашенных по Граму. Этот метод отражает как изменения во влагалищной экологии, так и сильные микробные ассоциации, и был впервые описан Spiegel et al. 4 в 1983 году. В этом первоначальном отчете мазки были разделены на мазки с нормальной флорой морфотипа лактобацилл и мазки со смешанной флорой, согласующиеся с BV.Метод был модифицирован Nugent et al. 5 для включения промежуточной категории, которая продемонстрировала присутствие смешанной микробной флоры, но со значительным количеством морфотипа lactobacillus. Оба этих метода оценивают мазки путем количественной оценки различных морфотипов, что требует значительного времени и навыков, и были описаны более простые версии, в которых категории оцениваются качественно. 6, 7 В клиниках мочеполовой медицины (GUM), по крайней мере, в Соединенном Королевстве, микроскопия широко используется в качестве метода диагностики ИППП, но нет ни времени, ни достаточного опыта для использования количественных систем оценки. .Целью этого исследования было проверить одну из более простых схем классификации мазков, окрашенных по Граму, ранее описанных Hay et al. 7, 8 , в сравнении с составными критериями 3 для использования в клиниках GUM.

МЕТОДЫ

Пациенты и сбор образцов

Пациенты, включенные в это исследование, были частью слепого, рандомизированного, параллельного группового, многоцентрового исследования лечения фазы IV, в котором сравнивали гель метронидазола и крем клиндамицина.Всем пациентам, включенным в исследование, был поставлен клинический диагноз БВ по критериям Амзеля. Пациентов набирали в течение первых 7 дней после менструации (визит 1) и просили вернуться в клинику через 12–16 дней после начала лечения (визит 2) и в соответствующий день их следующего менструального цикла, обычно 26–35 дней. после начала медикаментозного лечения (визит 3). При каждом посещении, во время влагалищного исследования, исследующий клиницист готовил мазок вагинальной жидкости, взятый из бокового свода, и отправлял его в единственный центр (Имперский колледж) для окрашивания и считывания по Граму.Всего было исследовано 162 мазка у 72 женщин, из которых 16 пришли на одно посещение, 22 — на два и 34 — на три.

Оценка слайдов

Из каждого центра по почте было получено

неокрашенных мазков, которым были присвоены номера, скрывающие номер пациента, посещение клиники и направление центра для читателя. Затем мазки окрашивали по Граму, используя следующий протокол; мазки заливали кристаллическим фиолетовым (Pro-lab Diagnostics) в течение 30 секунд, промывали водопроводной водой, заливали йодом Люголя (Pro-lab Diagnostics) в течение 30 секунд, промывали водой, а затем обесцвечивали ацетоном в течение 5-10 секунд и наконец, контрастировали 15% карбол-фуксином (Pro-lab Diagnostics) в нейтральный красный цвет (Pro-lab Diagnostics) в течение 1 минуты.Мазки промокали насухо и исследовали под масляной иммерсией при увеличении × 1000.

Мазки классифицировались следующим образом, как описано ранее 7, 8 : степень I (нормальная флора), только морфотип лактобацилл; степень II (промежуточная флора), редуцированный морфотип лактобацилл со смешанными бактериальными морфотипами; степень III (BV), смешанные бактериальные морфотипы с небольшим количеством или отсутствием морфотипов лактобацилл. Также были использованы две дополнительные оценки; степень 0 — эпителиальные клетки без видимых бактерий и степень IV — эпителиальные клетки, покрытые только грамположительными кокками. 9 Все слайды были прочитаны одним считывателем, систематический контроль качества отсутствовал. Однако после первоначального анализа все несоответствующие слайды были перечитаны (не видны исходные результаты) и дали идентичные результаты.

Анализ данных

Чувствительность, специфичность и прогностические значения для положительного и отрицательного теста были использованы для сравнения оценки мазков, окрашенных по Граму, с составными критериями диагностики BV. Степень согласия определялась индексом каппа, где значение 1.0 означает полное согласие. Мазки, оцененные как степень I (нормальная), считались отрицательными, степень III (согласованная с BV) считалась положительной, а степень II (промежуточная) анализировалась как отрицательной, так и положительной.

РЕЗУЛЬТАТЫ

Женщины, посещавшие 162 пациента, были разделены на женщин без BV (79), которые считались нормальными, и женщин с BV (83) по составным критериям. Окрашенные по Граму мазки вагинальной жидкости, собранные при каждом из этих посещений пациентов, были разделены на одну из пяти степеней.Женщины с БВ и без БВ были разделены по классу их мазков, окрашенных по Граму (таблица 1). У большинства пациентов без БВ мазок был оценен как степень I (48/79, 61%), а у пациентов с БВ мазок был оценен как степень III (80/83, 96%). Промежуточная флора (степень III) была обнаружена у 12/79 (15%) женщин без БВ и только у 1/83 (1%) женщин с БВ. Мазки с оценкой 0 (6/79, 8%) или IV (8/79, 10%) были обнаружены только у нормальных женщин.

Стол 1

Оценка мазков из влагалища, окрашенных по Граму, у женщин с бактериальным вагинозом и без него в соответствии с комплексными критериями Амзеля

Было обнаружено, что чувствительность оценки мазков, окрашенных по Граму, для диагностики BV составляет ≥96%, когда степень II считалась либо отрицательной, либо положительной, либо была исключена (таблица 2).Точно так же прогностическая ценность отрицательного теста была высокой в ​​каждом анализе. Специфичность и прогностическая ценность положительного теста также оказались высокими, 90,5% и 94,1% соответственно, когда степень II считалась отрицательной или исключалась из анализа, но были снижены, если степень II считалась положительной, до 73,8% и 82,6. % соответственно (таблица 2).

Стол 2

Чувствительность, специфичность и прогностические значения для оценки мазков, окрашенных по Граму, для диагностики бактериального вагиноза с использованием критериев Амзеля в качестве золотого стандарта

BV, диагностированный по составным критериям по сравнению с этой упрощенной схемой классификации, дал значение каппа, равное 0.91, если мазки, оцененные как промежуточные (степень II), считались отрицательными, тогда как значение 0,76 было получено, если мазки степени II считались положительными. Из 13 пациентов, мазки которых были классифицированы как промежуточные, у шести пациентов не было ни одного, у четырех пациентов — один, у двух — два и у одного — четыре составных критерия.

ОБСУЖДЕНИЕ

Целью этого исследования было подтверждение упрощенной классификации вагинальных мазков, окрашенных по Граму, для диагностики БВ в клиниках ГУМ.Составные критерии, описанные Амселем и др. 3 , использовались в качестве эталонного метода, поскольку он все еще считается «золотым» стандартом. Пациенты были тщательно отобранной группой, и данные о распространенности не были получены, но посещения пациентов почти поровну подразделялись на нормальные и BV, что давало хорошую основу для этого анализа. Была сильная ассоциация флоры I степени с нормальными женщинами и III степени с BV, что приводило к высокой чувствительности, специфичности и прогностическим значениям, которые были аналогичны или выше, чем у других схем классификации, по сравнению с составными критериями. 6, 10 При международном сравнении различных методов оценки наш упрощенный метод также хорошо приравнивается к оценке, описанной Nugent et al. 5 (каппа: 0,89), которая считается эталонным методом для считывания мазков, окрашенных по Граму. . 11 Эти результаты показывают, что при нехватке времени или опыта эта качественная оценка микробной флоры может использоваться в качестве альтернативного метода диагностики.

Мазки со степенью II или промежуточной флорой чаще всего обнаруживались у здоровых женщин в этом исследовании.Было показано, что промежуточная флора состоит из бактерий, связанных с BV, таких как G vaginalis и анаэробов, но помимо этого имеет значительное количество лактобацилл, обычно связанных с нормальной флорой и, как полагают, является переходной фазой между нормальным и BV. 12, 13 Это исследование предполагает, что, хотя это может быть правдой, оно не дает полных клинических критериев BV.

Мазки, оцененные как 0, не содержали бактерий, что свидетельствует о наличии антибактериального агента во влагалище.Хотя это будет наблюдаться только изредка, это может стать более распространенным явлением по мере того, как все чаще используются вагинальные кремы и гели. Мазки, которые были классифицированы как IV, показали только грамположительные кокки и были обнаружены у здоровых женщин. Нет никаких доказательств того, что эта флора связана с БВ или является ненормальной.

Благодарности

Мы хотели бы поблагодарить следующих консультантов и их сотрудников за набор пациентов и сбор мазков, Стивена Чамурова, Брайтон; Кристин Боуман, Ноттингем; Джойти Дхар, Дерби; Винсент Райли, Лестер; Анджела Робинсон, рынок Мортимер, Лондон; Жан Тобин, Портсмут; Фред Уилмотт, Саутгемптон; Эндрю Наягам, Шорхэм он Си, Западный Суссекс; S Uthayakumar, Stevenage.Работа финансировалась 3M Health Care Ltd.

.

Конфликты интересов: нет.

СОСТАВИТЕЛИ CAI участвовал в разработке исследования и отвечал за чтение мазков, анализ данных и подготовку рукописи; PEH внесла свой вклад в дизайн исследования, набор пациентов и анализ данных.

ССЫЛКИ

  1. Pheifer TA , Forsyth PS, Durfee MA, и др. .Неспецифический вагинит: роль Haemophilus vaginalis и лечение метронидазолом. N Engl J Med1978; 298: 1429–34.

  2. Gardner HL , Dukes CD. Вагинит, вызванный Haemophilus vaginalis. Недавно определенная специфическая инфекция, ранее классифицированная как «неспецифический» вагинит. Ам Дж. Обстет Гинекол, 1955; 69: 962–76.

  3. Amsel R , Totten PA, Spiegel CA, и др. .Неспецифические вагиниты. Диагностические критерии и микробно-эпидемиологическая ассоциация. Am J Med1983; 74: 14–22.

  4. Spiegel CA , Амзель Р., Холмс К.К. Диагностика бактериального вагиноза методом прямого окрашивания по Граму влагалищной жидкости. J. Clin Microbiol. 1983; 18: 170–7.

  5. Nugent RP , Krohn MA, Hillier SL. Надежность диагностики бактериального вагиноза повышается за счет стандартизированного метода интерпретации окраски по Граму.J Clin Microbiol, 1991; 29: 297–301.

  6. Томасон Дж. Л. , Андерсон Р. Дж., Гелбарт С. М., и др. . Упрощенный метод интерпретации окраски по Граму для диагностики бактериального вагиноза. Am J Obstet Gynecol, 1992; 167: 16–19.

  7. Hay PE , Ламонт РФ, Тейлор-Робинсон Д., и др. . Аномальная бактериальная колонизация нижних отделов половых путей и последующие преждевременные роды и поздний выкидыш.BMJ1994; 308: 295–8.

  8. Hay PE , Morgan DJ, Ison CA, и др. . Продольное исследование бактериального вагиноза во время беременности. Br J Obstet Gynaecol1994; 101: 1048–53.

  9. Бактериальная группа особого интереса MSSVD . Флора влагалища. В: Ison CA, Savage M, Taylor-Robinson D, ред. Микроскопия инфекций, передающихся половым путем . Лондон: Harcourt Health Communications, 2001; Глава 5:19.

  10. Schwebke JR , Hillier SL, Sobel JD, и др. . Достоверность вагинального окрашивания по Граму для диагностики бактериального вагиноза. Акушер Гинекол 1996; 88: 573–6.

  11. Forsum U , Ларссон П.Г., Шмидт Х., и др. . Отклонение (вариация между наблюдателями) между интерпретациями критериев окрашивания по Граму BV, сделанными участниками семинара BV00.BV 2000, Международная конференция по бактериальному вагинозу. 2000 (аннотация).

  12. Hillier SL , Krohn MA, Nugent RP, et al , для группы исследования вагинальных инфекций и недоношенных. Характеристики трех паттернов влагалищной флоры, оцененные с помощью окрашивания по Граму среди беременных женщин. Ам Дж. Обстет Гинекол, 1992; 166: 938–44.

  13. Rosenstein IJ , Morgan DJ, Sheehan M, et al .Бактериальный вагиноз у беременных: распределение видов бактерий в различных категориях влагалищной флоры, окрашенных по Граму. J Med Microbiol 1996; 45: 120–6.

Бактерии, обнаруженные в мазке, могут идентифицировать женщин с высоким риском рака яичников, говорится в исследовании | The Independent

Согласно новому исследованию, которое предполагает, что простой мазок мазка может помочь вылечить болезнь раньше, женщины могут подвергаться более высокому риску рака яичников, если у них меньше защитных бактерий во влагалище.

В образцах мазков, взятых у женщин с раком яичников, а также у женщин с генетическим риском заболевания, уровень лактобактерий был значительно ниже, чем у здоровых женщин того же возраста, сообщили исследователи во главе с Университетским колледжем Лондона (UCL).

Если будет подкреплено дальнейшими исследованиями, это может быть использовано для принятия обоснованных решений по лечению женщин с риском рака яичников, что позволит им безопасно отложить операцию по удалению яичников — процедуру, которая помешает им зачать ребенка естественным путем.

Хейли Минн было 23 года, когда она обнаружила, что у нее есть мутация в гене BRCA1, что означает повышенный риск развития рака груди, и ей сделали профилактическую мастэктомию в 27 лет.

Мутация также означает ее шансы на развитие рака яичников. составляют от 40 до 60 процентов по сравнению с 2 процентами от общей численности населения.

Новости здоровья в картинках

Показать все 40

1/40 Новости здоровья в картинках

Новости здравоохранения в картинках

Вспышка коронавируса

Коронавирус Covid-19 поразил Великобританию, что привело к гибели двух человек и вызвало предупреждения от Министерства здравоохранения

AFP через Getty

Новости здравоохранения в картинках

По данным статистики, тысячам пациентов неотложной помощи приказывают сесть на такси до больницы

Тысячам 999 пациентов в Англии приказывают сесть на такси до больницы.Число пациентов за пределами Лондона, которым было отказано в помощи машины скорой помощи, за последний год выросло на 83%, так как спрос на услуги растет. жизни 11 человек в США за последние недели. В Центре США по контролю и профилактике заболеваний более 100 сотрудников расследуют причину загадочной болезни, и он предостерег граждан от курения электронных сигарет, пока не станет известно больше, особенно если они были изменены или куплены «на улице».

Getty

Новости здравоохранения в картинках

Лечение облысения кажется на шаг ближе

Исследователи из США утверждают, что преодолели одно из основных препятствий на пути выращивания человеческих фолликулов из стволовых клеток.Новая система позволяет клеткам расти в виде структурированного пучка и выходить из кожи. доза природы всего два часа в неделю способствует лучшему здоровью и психологическому благополучию

Shutterstock

Новости здоровья в картинках

Загрязнение воздуха связано с проблемами фертильности у женщин

Воздействие воздуха с загруженных автомобильным транспортом улиц может оставить женщин исследование показало, что у них меньше лет, чтобы иметь детей.Итальянские исследователи обнаружили, что женщины, живущие в наиболее загрязненных районах, в три раза чаще демонстрируют признаки того, что у них заканчиваются яйца, чем у тех, кто живет в более чистых условиях, что потенциально может вызвать более раннюю менопаузу

Getty / iStock

Новости здравоохранения в картинках

Рекламы нездоровой пищи могут быть запрещены до водораздела.

Рекламы нездоровой пищи на телевидении и в Интернете могут быть запрещены до 21:00 в рамках планов правительства по борьбе с «эпидемией» детского ожирения.В целях борьбы с растущим кризисом планы нового водораздела были вынесены на обсуждение общественности, заявило Министерство здравоохранения и социальной защиты (DHSC).

PA

Новости здравоохранения в картинках

Разведение неандертальцев помогло людям бороться с болезнями.

Прибыв из Африки около 70 000 лет назад, люди наткнулись на неандертальцев Евразии. В то время как люди были слабы к болезням новых земель, размножение с местными неандертальцами способствовало лучшему оснащению иммунной системы

PA

Новости здравоохранения в картинках

Дыхательный тест на рак

Устройство биопсии дыхания — предназначен для обнаружения признаков рака в молекулах, выдыхаемых пациентами

Getty

Новости здоровья в картинках

Средний 10-летний ребенок потребляет рекомендованное количество сахара для взрослого

К 10-летнему возрасту дети в среднем уже ели больше сахара чем рекомендуемая сумма для 18-летнего.В среднем 10-летний ребенок потребляет 13 кубиков сахара в день, что на 8 больше, чем рекомендуется Королевский колледж педиатрии и здоровья детей рекомендовал детям избегать использования экранов в течение часа перед сном, чтобы не нарушать сон

Getty

Новости здравоохранения в картинках

Daily Исследование показало, что аспирин не нужен пожилым людям с хорошим здоровьем. Исследование, проведенное в США, показало, что вейпинг может привести к раку.

Исследование, проведенное Масонским онкологическим центром Университета Миннесоты, показало, что рак Ногенные химические вещества формальдегид, акролеин и метилглиоксаль присутствуют в слюне пользователей электронных сигарет

Reuters

Новости здравоохранения в картинках

Все больше детей страдают ожирением и диабетом

Число детей с диабетом 2 типа увеличилось на 41% с 2014 года Национальный педиатрический аудит диабета установил.Ожирение — основная причина

Reuters

Новости здоровья в картинках

Большинство детских антидепрессантов неэффективны и могут вызывать суицидальные мысли

Большинство антидепрессантов неэффективны и могут быть небезопасными для детей и подростков с большой депрессией, как отмечают эксперты. предупредил. В ходе наиболее полного сравнения 14 обычно назначаемых антидепрессантов на сегодняшний день исследователи обнаружили, что только один бренд более эффективен в облегчении симптомов депрессии, чем плацебо.Другой популярный препарат, венлафаксин, повышает риск возникновения суицидных мыслей и попыток самоубийства у потребителей

Getty

Новости здравоохранения в картинках

Взрослые геи, лесбиянки и бисексуалы с повышенным риском сердечных заболеваний, утверждает исследование

Исследователи из Клиника Baptist Health South Florida Clinic в Майами сосредоточила свое внимание на семи областях контролируемого здоровья сердца и обнаружила, что эти группы меньшинств особенно часто курят и имеют плохо контролируемый уровень сахара в крови

iStock

Новости здравоохранения в картинках

Сухие завтраки, предназначенные для детей содержат «стабильно высокий» уровень сахара с 1992 года, несмотря на заявления производителя

Основная группа давления выпустила новое предупреждение об опасно высоких количествах сахара в хлопьях для завтрака, особенно в тех, которые предназначены для детей, и заявила, что уровни практически не снизились. за последние два с половиной десятилетия

Getty

Новости здравоохранения на рис. res

Выборы делают нас толстыми, предупреждает наблюдатель NHS.

Новое руководство Национального института здравоохранения и повышения квалификации (NICE), органа, который определяет, какое лечение должно финансировать NHS, заявил, что слабый ремонт дорог и улицы с преобладанием автомобилей были способствует развитию эпидемии ожирения, не давая людям оставаться активными

PA

Новости здравоохранения в картинках

Новые лекарства от менопаузы помогают женщинам избавиться от «изнуряющих» приливов

Новый класс лечения для женщин, находящихся в период менопаузы может уменьшить количество изнурительных приливов на целых три четверти за считанные дни, как показало исследование.По словам профессора Вальджита Дилло, профессора эндокринологии и метаболизма

, препарат, использованный в исследовании, принадлежит к группе, известной как антагонисты (блокаторы) NKB, которые были разработаны для лечения шизофрении, но «лежали на полке неиспользованными».

REX

Новости здравоохранения в картинках

Врачи должны прописывать больше антидепрессантов людям с проблемами психического здоровья, результаты исследования

Исследования Оксфордского университета показали, что более миллиона дополнительных людей, страдающих психическими расстройствами, выиграют от назначения лекарств и критиковал «идеологические» причины, по которым врачи избегают этого.

Getty

Новости здравоохранения в картинках

Студент умер от гриппа после того, как NHS посоветовал ему оставаться дома и избегать A&E

Семья подростка, умершего от гриппа, призвала людей не откладывать посещение A&E, если они беспокоятся о их симптомы. Мелисса Уайтли, 18-летняя студентка инженерного факультета из Хэнфорда в Сток-он-Трент, заболела на Рождество и умерла в больнице через месяц.

Just Giving

Новости здравоохранения в картинках

Правительство рассмотрит тысячи вредных вагинальных сетчатых имплантатов

Правительство обязалось рассмотреть десятки тысяч случаев, когда женщинам были поставлены вредные вагинальные сетчатые имплантаты.

Getty

Новости здравоохранения в картинках

Джереми Хант объявляет об «нулевой самоубийственной амбиции» для NHS

NHS будет предложено пойти дальше, чтобы предотвратить смерть пациентов, находящихся на ее лечении, в рамках «нулевых суицидальных амбиций» запускается сегодня

Getty

Новости здравоохранения в картинках

Испытания на людях начинаются с лечения рака, которое заставляет иммунную систему уничтожать опухоли

Испытания на людях начались с новой терапии рака, которая может стимулировать иммунную систему к уничтожению опухолей.Лечение, которое работает аналогично вакцине, представляет собой комбинацию двух существующих лекарств, крошечные количества которых вводятся в твердую массу опухоли.

Нефрон

Новости здравоохранения в картинках

Основное исследование показало, что здоровье младенцев ухудшается из-за рождения рядом с местами гидроразрыва пласта

У матерей, живущих в пределах километра от места гидроразрыва пласта, на 25 процентов выше вероятность рождения ребенка низкой рождаемостью веса, которые увеличивают их шансы на астму, СДВГ и другие проблемы

Getty

Новости здравоохранения в картинках

Национальная служба здравоохранения рассматривает тысячи тестов мазка на рак шейки матки после того, как женщинам ошибочно дали все результаты

Тысячи результатов скрининга на рак шейки матки находятся на рассмотрении после неудач в лаборатории это означало, что некоторым женщинам было неправильно дано полное разрешение.Некоторым женщинам уже было предложено связаться со своими врачами после выявления «процедурных проблем» в услугах, предоставляемых Первой лабораторией патологии.

Rex

Новости здравоохранения в картинках

Ученые обнаружили потенциальный ключ к остановке распространения рака груди

Большинство пациентов с раком груди умирают не от своей первоначальной опухоли, а от вторичных злокачественных новообразований (метастазов), в которых раковые клетки способны размножаться. попасть в кровь и выжить, чтобы вторгнуться в новые места.Аспарагин, молекула, названная в честь спаржи, где она была впервые обнаружена в больших количествах, теперь является важным ингредиентом для опухолевых клеток, которые приобретают эти мигрирующие свойства.

Getty

Новости здравоохранения в картинках

Рекордное количество вакансий медсестер в NHS, объявлено более 34000 должностей

В настоящее время NHS объявляет рекордное количество медсестринских и акушерских должностей, при этом более 34000 вакансий в настоящее время вакантны. по последним данным.Спрос на медсестер в период с июля по сентябрь 2017 года был на 19 процентов выше, чем за тот же период два года назад.

REX

Новости здоровья в картинках

Экстракт каннабиса может обеспечить «новый класс лечения» психоза

КБД оказывает в целом противоположный эффект дельта-9-тетрагидроканнабинолу (ТГК), главному активному компоненту каннабиса и этого вещества. это вызывает паранойю и беспокойство.

Getty

Новости здравоохранения в картинках

Более 75000 подписали петицию с призывом к Virgin Care Ричарда Брэнсона вернуть деньги на выплату компенсации в NHS

Компания г-на Брэнсона подала в суд на NHS в прошлом году после того, как проиграла контракт на 82 миллиона фунтов стерлингов на предоставление детских услуг. здравоохранения по всему графству Суррей, ссылаясь на обеспокоенность по поводу «серьезных недостатков» в способе заключения контракта.

PA

Новости здравоохранения в фотографиях

Более чем на 700 медсестер в Англии прошли обучение в первый год после отмены стипендии NHS

число людей, принятых на обучение сестринскому делу в Англии, упало на 3% в 2017 году, в то время как число принятых в Уэльсе и Шотландии, где сохранялись стипендии, увеличилось на 8.4 процента и 8 процентов соответственно

Getty

Новости здравоохранения в картинках

Примечательное исследование связывает жесткую экономию тори с 120 000 смертей

В документе установлено, что за первые четыре года эффективности под руководством тори умерло на 45 000 больше, чем могло бы быть. ожидались, если бы финансирование осталось на предвыборном уровне. На этой траектории к концу 2020 года количество дополнительных смертей может вырасти почти до 200 000, даже с учетом дополнительного финансирования, выделенного на услуги государственного сектора в этом году.

Reuters

Новости здоровья в картинках

Длительные поездки на работу несут риск для здоровья

Часы в пути могут быть утомительно скучными, но новое исследование показывает, что это также может отрицательно сказаться как на вашем здоровье, так и на производительности на работе. Более длительные поездки на работу также оказывают значительное влияние на психическое благополучие: те, кто ездит на работу дольше, на 33% чаще страдают от депрессии

Shutterstock

Новости здоровья в картинках

Вы не можете быть в хорошей форме и толстым

Невозможно иметь избыточный вес и быть здоровым, говорится в новом крупном исследовании.Исследование с участием 3,5 миллионов британцев показало, что даже «метаболически здоровые» люди с ожирением по-прежнему подвержены более высокому риску сердечных заболеваний или инсульта, чем люди с нормальным весом

Getty

Новости здоровья в картинках

Депривация сна

Когда вы чувствуете себя особенно истощенным, вам определенно может казаться, что вам не хватает умственных способностей. Новое исследование показало, что это может быть связано с тем, что хроническое недосыпание может фактически заставить мозг съесть сам себя. и фитнес-класс, который, по сути, представляет собой группу людей, вздремнувших по 45 минут.Фитнес-группа была побуждена к запуску уроки «наперсника» после того, как исследования показали, что 86 процентов родителей заявили, что они устали. Таким образом, класс в основном ориентирован на родителей, но на самом деле вам не обязательно иметь детей, чтобы принять в нем участие

Getty

Новости здравоохранения в картинках

«Основное право на здоровье» будет отменено после Брексита, предупреждают юристы

Табак и алкоголь компаниям будет легче выиграть в судебных делах, таких как недавняя битва за простую упаковку сигарет, если будет отменена Хартия основных прав ЕС, сказал адвокат и профессор общественного здравоохранения

Getty

Новости здравоохранения в картинках

«Тысячи умирают» из-за страха перед несуществующими побочными эффектами статинов

Новое крупное исследование побочных эффектов препаратов, снижающих уровень холестерина, предполагает, что общие симптомы, такие как мышечная боль и слабость, не вызваны самими препаратами

Getty

Новости здравоохранения в картинках

Дети, рожденные от отцов в возрасте до 25 лет, имеют более высокий риск аутизма

Новое исследование показало, что новорожденные Отцы в возрасте до 25 лет и старше 51 подвержены более высокому риску развития аутизма и других социальных расстройств.Исследование, проведенное Сиверским центром исследования и лечения аутизма на горе Синай, показало, что эти дети в младенчестве на самом деле более продвинуты, чем их сверстники, но затем отстают к тому времени, когда они достигают подросткового возраста

Getty

Новости здравоохранения в картинках

Езда на велосипеде на работу «может вдвое снизить риск рака и сердечных заболеваний»

Пассажиры, которые меняют свой проездной на машину или автобус на велосипед, могут снизить риск развития сердечных заболеваний и рака почти вдвое, как показывают новые исследования, — но участники кампании предупредили, что по-прежнему существует «острая необходимость» в улучшении дорожных условий для велосипедистов.По данным исследования, проведенного с участием четверти миллиона человек, езда на велосипеде на работу снижает риск развития рака на 45 процентов и сердечно-сосудистых заболеваний на 46 процентов. Исследователи из Университета Глазго обнаружили, что ходьба на работу также приносит пользу здоровью, но не в такой степени, как езда на велосипеде.

Getty

«Мне сказали, что я должен серьезно задуматься о гистерэктомии, когда мне будет 35, что очень страшно, так как я действительно хочу детей», — сказала г-жа Минн.

«Так что все, что дает мне больше время и успокаивает меня, что рак яичников не развивается, это меняет правила игры.»

От рака яичников в Великобритании ежегодно умирают более 4000 женщин. Но бывает трудно определить на ранней стадии, когда лечение будет наиболее эффективным, потому что симптомы часто являются неспецифическими симптомами, такими как вздутие живота и усталость.

Исследование могло бы «изменить правила игры» для таких женщин, как Хейли Минн, которые являются носителями мутации, увеличивающей риск рака в 40 раз, и которым в противном случае пришлось бы удалять яичники.

(Хейли Минн)

Новое исследование, опубликованное в журнале Lancet Oncology, проанализировали образцы из цервикальных мазков для скрининга 580 женщин в возрасте 18-87 лет из Великобритании, Чехии, Германии, Италии и Норвегии.

Некоторым недавно поставили диагноз, другие несли ген BRCA1, а 295 не относились к группе высокого риска.

У молодых женщин, несущих ген, в среднем было в три раза меньше лактобацилл, чем у женщин без гена, в то время как у тех, у кого был близкий член семьи с раком яичников, также был более низкий уровень.

Среди носителей BRCA1 в возрасте до 30 лет у четверти был «низкий» уровень лактобацилл, чего вообще не наблюдалось у женщин в возрасте от 20 до 20 лет без мутации.

«Это новый подход, который может революционизировать способ вмешательства и изменить последствия высокого риска развития рака яичников», — сказал профессор Мартин Видшвендтер, руководитель отделения женского рака в UCL.

«Это впервые мы смогли продемонстрировать, что у женщин с генными мутациями произошли изменения в микробиоме влагалища ».

В других частях тела, таких как кишечник, лактобациллы помогают предотвратить проникновение« недружелюбных »бактерий и создание проблем.

Выявление дисбаланса микробной экосистемы влагалища может быть признаком того, что есть проблемы в других частях репродуктивного тракта, например, в маточных трубах, где начинается большинство рака яичников.

Изменения в уровне бактерий могут вызвать воспаление, когда иммунная система увеличивает активность против потенциальной угрозы, и, возможно, это фактор, увеличивающий риск рака, и потенциально лечение ti может снизить этот риск.

Однако исследование не может исключить, что аномальные вагинальные бактерии могут быть симптомом чего-то еще, что также повышает риск рака.

Афина Ламнисос, генеральный директор Eve Appeal, благотворительной организации, занимающейся гинекологическими исследованиями рака, сказала, что женщины с риском рака яичников сталкиваются с «суровым выбором», из-за которого они могут «погрузиться в раннюю менопаузу».

«Это исследование является захватывающим шагом вперед как в понимании факторов, которые потенциально влияют на развитие рака, но и, что наиболее важно, в разработке вмешательств, которые могут снизить этот риск», — добавила она.

«Если это можно сделать, такая простая вещь, как регулировка микробиома влагалища — это меняет правила игры.«

Состав кишечной микробиоты модулирует тяжесть малярии

Значимость

Инфекции Plasmodium ежегодно вызывают> 200 миллионов случаев малярии и около 1 миллиона смертей. Хотя эти инфекции приводят к болезненным состояниям, которые варьируются от бессимптомных до жизненно важных. угрожающие, факторы, которые способствуют серьезности заболевания, остаются плохо определенными.Этот отчет демонстрирует, что скопление микробов в кишечнике может влиять на тяжесть малярии.Мыши от разных производителей с различиями в микробиоме кишечника показали значительные различия в патологии после заражения Plasmodium . Среди бактериальных популяций, которые различались между «устойчивыми» и «восприимчивыми» мышами, были Lactobacillus и Bifidobacterium , и обработка мышей Lactobacillus и Bifidobacterium привела к снижению нагрузки на Plasmodium . Эти результаты идентифицируют как ранее не идентифицированный фактор риска тяжелой формы малярии, так и потенциальный новый способ лечения.

Abstract

Инфекция Plasmodium приводит к клиническим проявлениям, которые варьируются от бессимптомной до тяжелой малярии, что приводит к примерно 1 миллиону смертей ежегодно. Несмотря на такой урон человечеству, факторы, определяющие тяжесть заболевания, остаются малоизученными. Здесь мы показываем, что микробиота кишечника мышей влияет на патогенез малярии. Генетически похожие мыши от разных коммерческих производителей, которые демонстрировали различия в бактериальном сообществе кишечника, имели значительные различия в количестве паразитов и смертности после заражения несколькими видами Plasmodium .Бесплодные мыши, которым была проведена трансплантация содержимого слепой кишки от «устойчивых» или «восприимчивых» мышей, имели низкую и высокую нагрузку паразитов, соответственно, демонстрируя, что микробиота кишечника определяла тяжесть малярии. Среди различий во флоре кишечника было увеличение численности Lactobacillus и Bifidobacterium у устойчивых мышей. У восприимчивых мышей, которых лечили антибиотиками с последующим приемом йогурта, приготовленного из этих видов бактерий, наблюдалось снижение количества паразитов. В соответствии с различиями в количестве паразитов устойчивые мыши проявляли повышенный гуморальный иммунный ответ по сравнению с восприимчивыми мышами.В совокупности эти результаты идентифицируют состав микробиоты кишечника как ранее не идентифицированный фактор риска тяжелой малярии и модуляцию микробиоты кишечника (например, пробиотики) как потенциальное лечение для уменьшения нагрузки паразитов.

Заражение Plasmodium видов остаются бременем для глобального здравоохранения, вызывая более 200 миллионов случаев малярии и около 1 миллиона смертей ежегодно, при этом подавляющее большинство смертей приходится на детей в возрасте до 5 лет, проживающих в странах Африки к югу от Сахары (1) .Многие инфекции Plasmodium либо протекают бессимптомно, либо вызывают только легкую малярию. Однако некоторые инфекции прогрессируют до тяжелой формы малярии, которая чаще всего проявляется в виде нарушения сознания (церебральная малярия), респираторной недостаточности и тяжелой анемии (2). Лучшим коррелятом тяжести заболевания после инфицирования человека Plasmodium falciparum является плотность паразитов (3, 4).

Микробиота кишечника влияет на многие аспекты физиологии хозяина (5), включая формирование предрасположенности к многочисленным заболеваниям (6⇓⇓⇓⇓⇓⇓⇓ – 14).Воздействие микробиоты кишечника на хозяина сильно зависит от коллективного состава бактериальных популяций (15), и известно, что комменсальные флоры влияют на местную нагрузку патогенов и иммунитет хозяина (16⇓ – 18). Помимо влияния на местный иммунитет кишечника, микробиом кишечника влияет на иммунитет хозяина к вирусным инфекциям экстрагастроинтестинального тракта (19).

Недавние исследования также подтверждают, что микробиом кишечника модулирует инфекции Plasmodium у людей. Антитела против α-гал, индуцируемые кишечным патобионтом Escherichia coli O86: B7, перекрестно реагируют со спорозоитами людей и грызунов Plasmodium видов, которые ухудшают передачу паразита между переносчиком и позвоночным хозяином; однако этот перекрестно-реактивный иммунитет не повлиял на количество паразитов на стадии крови (20).Кроме того, бактериальный состав кала у малийских детей проспективно коррелировал с риском заражения P. falciparum , но не с развитием лихорадочной малярии (21). Важно отметить, что остается неясным, способствует ли микробиом кишечника также развитию тяжелой малярии. Используя мышиную модель малярии, эти данные демонстрируют, что микробиом кишечника влияет на количество паразитов на стадии крови и последующую тяжесть малярии.

Результаты

Мыши от разных производителей демонстрируют различную восприимчивость к малярии.

Генетически похожие инбредные линии мышей (C57BL / 6), поддерживаемые разными поставщиками [лаборатория Джексона (Jax) и Taconic (Tac)], имеют различия в бактериальных сообществах кишечника (22, 23). Чтобы определить, влияют ли эти различия на инфекций Plasmodium , мышей C57BL / 6 из Jax, Tac, National Cancer Institute / Charles River (NCI) и Harlan (Har) инфицировали Plasmodium yoelii . После инфицирования существенные различия в паразитемии (доля эритроцитов, инфицированных P.yoelii ) наблюдались между четырьмя группами мышей (рис. 1 A и B ). В то время как устойчивые мыши (Jax и Tac) демонстрировали максимум ~ 10% паразитемии, у них не было признаков заболеваемости (потери веса) или смертности, что контрастировало со значительной потерей веса и смертностью, наблюдаемой у восприимчивых мышей (NCI и Har). , где паразитемия была> 60% (рис. 1 C и D ). Более того, у мышей NCI и Har наблюдалась более выраженная и продолжительная анемия (потеря эритроцитов на миллилитр) по сравнению с мышами Jax и Tac ( SI, приложение , рис.1 А ). Кроме того, когда общее количество эритроцитов на миллилитр использовалось для определения общей нагрузки патогенов, было отмечено сходство между количеством паразитов, определяемым паразитемией или паразитизированными эритроцитами (pRBC) на миллилитр крови ( SI Приложение , рис. 1 B). E ). Следует отметить, что мыши, инфицированные разными дозами pRBCs P. yoelii , показали сходную кинетику паразитемии между разными дозами и восприимчивостью к инфекции ( SI, приложение , рис.2), что позволяет предположить, что мыши от разных производителей по-разному восприимчивы к развитию тяжелой малярии, но не к инфекции на стадии крови.

Рис. 1.

Plasmodium Бремя паразитов, заболеваемость и смертность зависят от производителя мышей и диеты. Мышей C57BL / 6 инфицировали паразитированных эритроцитов P. yoelii . ( A ) Фракция эритроцитов, инфицированных P. yoelii (процент паразитемии). ( B ) Анализ AUC. Данные были проанализированы с помощью однофакторного дисперсионного анализа и посттеста множественного сравнения Тьюки.( C ) Процент потери веса после заражения. Данные были проанализированы с помощью однофакторного дисперсионного анализа. ( D ) Выживаемость мышей после заражения. Кривые выживаемости анализировали с помощью логрангового теста (Мантела – Кокса). ( E H ) Мышей кормили диетой NIH-31 или Teklad 22/5 до и после заражения P. yoelii . ( E ) Процент паразитемии после заражения P. yoelii . ( F ) Анализ AUC. Данные были проанализированы с помощью однофакторного дисперсионного анализа и посттеста множественного сравнения Тьюки.( G ) Процент потери веса после заражения. Данные были проанализированы с помощью однофакторного дисперсионного анализа. ( H ) Выживаемость мышей после заражения. Кривые выживаемости анализировали с помощью логрангового теста (Мантела – Кокса). Данные (среднее ± стандартная ошибка) в A F и H представляют собой совокупные результаты ( n = 8–10 мышей на группу) из двух экспериментов. Данные (среднее ± стандартное отклонение) в G относятся к от четырех до пяти мышей на группу из одного эксперимента. * P <0,05; ** P <0.01; *** P <0,001; **** P <0,0001. n.s., не имеет значения; p.i., постинфекция.

Чтобы определить более широкую применимость этих данных, были протестированы еще одна линия мышей и два вида Plasmodium . Мыши BALB / c из Jax, Tac, Charles River (CR) и Har были инфицированы P. yoelii . Мышей покупали у CR вместо NCI. Следует отметить, что мыши C57BL / 6, приобретенные в CR, после заражения P.yoelii ( SI Приложение , рис. 3). В соответствии с инфекциями P. yoelii у мышей C57BL / 6 ( SI Приложение , рис.3), мыши BALB / c из Jax и Tac демонстрируют снижение паразитемии P. yoelii на по сравнению с мышами из CR и Har ( SI Приложение , рис.4 A и B ). Кроме того, у мышей C57BL / 6 из Jax и Tac наблюдалась меньшая паразитемия по сравнению с мышами из CR и Har после заражения Plasmodium chabaudi ( SI, приложение , рис.4 C и D ). Наконец, мы оценили развитие экспериментальной церебральной малярии у мышей C57BL / 6, инфицированных Plasmodium berghei ANKA. Мыши Jax и Tac имели тенденцию к снижению паразитемии по сравнению с мышами NCI и Har в ранние моменты времени; кроме того, была значительная ( P = 0,04) разница в выживаемости между этими группами мышей ( SI, приложение , рис. 4 E и F ). В целом, эти данные показывают, что тяжесть малярии зависела от источника мышей.

Диета является сильным модулятором здоровья организма, а также микробиома кишечника и его функций (24). Чтобы определить, может ли диета влиять на тяжесть малярии, мышей Jax и NCI кормили одним из двух имеющихся в продаже рационов для грызунов, либо NIH-31 (используется на рис. 1 A D ) или Teklad 22/5. Паразитемия у мышей NCI не изменилась; однако мыши Jax имели высокий уровень паразитемии при кормлении Teklad 22/5 (рис. 1 E и F ). В соответствии с данными о паразитемии, мыши Jax, получавшие Teklad 22/5, также демонстрировали значительную потерю веса и повышенную смертность по сравнению с мышами Jax, получавшими NIH-31 (рис.1 G и H ). Поскольку эти диеты не влияли на количество паразитов у мышей NCI, изменение паразитемии у мышей Jax было маловероятным из-за прямого воздействия этих диет на количество паразитов. Более того, высокое содержание паразитов у мышей NCI, получавших NIH-31, предполагает, что эта диета поддерживает пролиферативную экспансию P. yoelii . Когда мышей Jax и NCI поместили на реципрокную диету, зависящую от поставщика, а затем инфицировали P. yoelii , мы отметили умеренное увеличение количества паразитов у мышей Jax, получавших внутреннюю диету NCI, но не оказавшего никакого влияния на инъекцию Jax. домашний рацион на мышах NCI ( SI Приложение , рис.5). В совокупности эти наборы данных привели к гипотезе о том, что микробиота кишечника повлияла на инфекций Plasmodium .

Структура и функции кишечного бактериального сообщества у устойчивых и восприимчивых мышей различаются.

Для непосредственного тестирования различий в микробиоме кишечника были собраны срезы желудочно-кишечного тракта устойчивых (Jax и Tac) и восприимчивых (NCI и Har) мышей, и бактериальные сообщества были охарактеризованы с использованием анализа гена 16S рРНК ( SI Приложение ). , Таблица 1).Наблюдалась высокая степень сходства между сообществами микробов, обнаруженными в слепой и толстой кишке мышей от одного и того же поставщика ( SI Приложение , рис.6 A ), тогда как между микробными сообществами этих регионов наблюдались явные различия. по сравнению с дистальной половиной тонкой кишки у мышей того же производителя. Более того, существенные различия между мышами всех производителей были очевидны в неметрическом многомерном масштабном анализе структуры популяции в слепой кишке, при этом библиотеки чувствительных NCI и Har демонстрируют сравнительное перекрытие друг с другом, но явные различия по сравнению с устойчивыми сообществами Jax и Tac ( SI Приложение , рис.6 В ). Анализ бактериальных сообществ слепой кишки на уровне семейств выявил существенные различия: Clostridiaceae, Erysipelotrichaceae, Lactobacillaceae и Peptostreptococcaceae (представители типа Firmicutes) пропорционально более многочисленны у устойчивых мышей (Jax и Tac), тогда как Bacteroidaceae (представители семейства Prevotellaceae и Prevotellaceae) Bacteroidetes phylum) и Sutterellaceae (член типа Proteobacteria) были пропорционально более многочисленны у восприимчивых (NCI и Har) мышей (рис.2 A и B ). Наконец, диетические изменения способны вызвать значительные изменения в микробиоме кишечника (25), которые у мышей достигают устойчивого состояния в течение 3-4 дней (26). В соответствии с этими сообщениями, мы наблюдали определенные изменения в кишечных бактериальных сообществах у мышей Jax, получавших Teklad 22/5 или NIH-31 ( SI Приложение , рис. 7 и 8). У мышей Jax, получавших диету Teklad, было отмечено снижение уровня Peptostreptococcaceae ниже уровней, наблюдаемых у мышей Jax или Tac, что привело к увеличению сходства с восприимчивыми мышами NCI и Har ( SI, приложение , рис.7 С ). Эти изменения совпадают со сдвигом тяжести малярии между этими двумя группами мышей (рис. 1 E H ).

Рис. 2.

Восприимчивость к малярии коррелирует с различиями в популяциях бактерий слепой кишки. ( A ) Бактериальные семейства, которые были идентифицированы как значительно обогащенные мышами Jax или Tac. ( B ) Бактериальные семейства, идентифицированные как значительно обогащенные мышами NCI или Har. Данные (среднее ± стандартная ошибка) в A и B получены от шести мышей на группу и извлечены из анализа в приложении SI , рис.6 С . Данные были проанализированы с помощью теста Краскела – Уоллиса.

В соответствии с изменениями в кишечном бактериальном сообществе, анализ метаболитов в тонком кишечнике, слепой кишке и плазме мышей Jax и NCI выявил дифференциальную экспрессию между каждой тканью ( SI Приложение , Рис. 9 A ). Тест F дискриминантного анализа частичных наименьших квадратов (27), использованный для исследования вариации между профилями метаболитов у мышей Jax и NCI для каждой ткани, подтвердил, что средние значения вариата-1 (компонент 1), который дифференцировал Jax от NCI мышей во всех тканях значительно различались ( P ≤ 0.0003, P ≤ 0,0001, P ≤ 0,0001) для тонкой кишки, слепой кишки и плазмы соответственно ( SI Приложение , рис.9 B D и таблица 2). Несколько метаболитов продемонстрировали большие (≥1,5 раза) и статистически значимые ( P ≤ 0,1) различия между мышами Jax и NCI, причем верхние 25% метаболитов были связаны с различными метаболическими путями ( SI Приложение , рис.9 E и F и Таблицы 3–5). Таким образом, различия в популяциях кишечных бактерий и метаболитов подтверждают гипотезу о том, что тяжесть малярии зависела от различий в кишечных бактериальных сообществах.

Различия в восприимчивости кишечного микробиома к малярии.

Чтобы напрямую проверить эту гипотезу, генетически идентичные незагрязненные (GF) мыши C57BL / 6 получили трансплантаты содержимого слепой кишки от мышей Jax или NCI. Следует отметить, что мыши GF C57BL / 6J не показали различий в паразитемии по сравнению с обычными мышами C57BL / 6J после заражения P. yoelii nigeriensis (28). Анализ последовательностей показал, что бактериальные сообщества у колонизированных мышей GF отражают бактериальные сообщества донорских сообществ и отличаются от сообществ у мышей GF, подвергшихся воздействию только микробов окружающей среды (рис.3 А ). Более того, наблюдалось лишь небольшое уменьшение разнообразия сообществ между соответствующими донорскими и колонизированными мышами GF ( SI, приложение , рис. 10). После заражения P. yoelii у мышей GF, которым была проведена трансплантация слепой кишки Jax или NCI, наблюдалась нагрузка паразитов, аналогичная контрольным мышам Jax и NCI (фиг. 3 B и C ). И у контрольных мышей NCI, и у мышей GF, которым была проведена трансплантация слепой кишки NCI, также наблюдалось снижение выживаемости по сравнению с контрольными мышами Jax и мышами GF, которым была проведена трансплантация слепой кишки Jax (рис.3 D ). В совокупности эти данные явились прямой демонстрацией того, что тяжесть малярии зависит от кишечной микробиоты.

Рис. 3.

Микробиом кишечника формирует восприимчивость к тяжелой малярии. Мышей GF колонизировали содержимым слепой кишки мышей Jax или NCI. ( A ) Анализ популяции бактерий выполняли с использованием неметрической многомерной шкалы, как описано в SI Приложение , рис. 6. ( B D ) Колонизированные мыши GF и контрольные мыши Jax и NCI были инфицированы P. .yoelii . ( B ) Процент паразитемии после заражения P. yoelii . ( C ) Анализ AUC. Данные (среднее ± стандартная ошибка) для B и C от четырех до пяти мышей в группе являются репрезентативными для двух экспериментов. Данные были проанализированы с помощью однофакторного дисперсионного анализа и посттеста множественного сравнения Тьюки. ( D ) Выживаемость мышей после заражения. Данные представляют собой совокупные результаты ( n = 8–10 мышей на группу) из двух экспериментов. Кривые выживаемости анализировали с помощью логрангового теста (Мантела – Кокса).**** P <0,0001. Env, окружающая среда.

Снижение количества паразитов у мышей, получавших

Lactobacillus и Bifidobacterium .

Чтобы идентифицировать отдельные микробные филотипы, которые могут определять тяжесть малярии, был проведен более глубокий анализ бактериальных сообществ в слепой кишке. При объединении по устойчивости (Jax / Tac) или восприимчивости (NCI / Har) к P. yoelii, несколько филотипов (называемых здесь оперативными таксономическими единицами) возникли в результате анализа, основанного на линейном дискриминантном анализе, основанном на величине эффекта (LEfSe) (29 ) как биомаркеры устойчивого или чувствительного фенотипа.Среди этих различий Lactobacillus и Bifidobacterium были чрезмерно многочисленны у устойчивых мышей по сравнению с восприимчивыми мышами ( SI, приложение , рис.11), причем различия в Lactobacillus были главным фактором дифференцированной структуры сообщества между устойчивыми мышами. и восприимчивые мыши ( SI Приложение , рис. 11 B ).

Чтобы оценить связь между Lactobacillus и Bifidobacterium с устойчивостью к тяжелой малярии, мышей Jax и NCI лечили йогуртом, выращенным в лабораторных условиях, с добавлением пробиотиков, которые содержали Lactobacillus и Bifidobacterium, до заражения видами и после заражения видами. П.yoelii . Секвенирование ДНК Lactobacillus , выделенных из фекальных гранул мышей Jax и NCI или выращенного в лаборатории йогурта, продемонстрировало филогенетическое соответствие ( SI, приложение , рис. 12). Потребление Lactobacillus и Bifidobacterium может модулировать структуру микробного сообщества кишечника (30) или функцию (31). После заражения P. yoelii у мышей Jax и NCI, получавших йогурт, было умеренное, но значительное (Jax: P <0.0001, NCI: P = 0,0418), снижение количества паразитов по сравнению с контрольными необработанными мышами ( SI Приложение , рис. 13). Мыши Jax и NCI, получавшие молоко, используемое для приготовления йогурта, показали такое же количество паразитов, что и контрольные мыши Jax и NCI [средняя площадь под кривой паразитемии (AUC) на 5–34 дни (AUC , день 5–34 ): Контроль Jax ( n = 4): 107,2 ± 11,39 (SD) по сравнению с молоком Jax ( n = 4) 83,55 ± 24,83 (SD), P = 0,13; Управление NCI ( n = 4): 447.1 ± 85,65 (стандартное отклонение) по сравнению с молоком NCI ( n = 3) 384,8 ± 73,08 (стандартное отклонение), P = 0,36]. Однако, когда мышей лечили антибиотиками перед обработкой йогуртом, мы наблюдали значительное снижение (в 14 раз) количества паразитов у восприимчивых мышей NCI (рис. 4 A и B ) и отсутствие потери веса у этих мышей. был отмечен по сравнению с другими группами NCI (рис. 4 C ). Эти данные подтверждают способность Lactobacillus и Bifidobacterium вносить свой вклад в модуляцию бремени паразитов Plasmodium , однако другие составляющие кишечной микробиоты также могут способствовать регулированию тяжести малярии.

Рис. 4.

У восприимчивых мышей, получавших йогурт, снизилась паразитемия и заболеваемость. Мышей Jax и NCI не лечили (контроль), лечили антибиотиками в течение 3 недель, а затем оставляли без лечения еще 3 недели (Abx), оставляли без лечения в течение 3 недель с последующим лечением йогуртом пять раз в неделю в течение 3 недель (йогурт). или лечение антибиотиками в течение 3 недель с последующим лечением йогуртом пять раз в неделю в течение 3 недель (Abx + йогурт). Затем мышей инфицировали P. yoelii .Мыши, получавшие йогурт, продолжали получать йогурт пять раз в неделю после заражения. ( A ) Процент паразитемии после заражения P. yoelii . ( B ) Анализ AUC. Данные были проанализированы с помощью однофакторного дисперсионного анализа и посттеста множественного сравнения Тьюки. ( C ) Процент потери веса после заражения. Данные были проанализированы с помощью однофакторного дисперсионного анализа. Данные (среднее ± стандартная ошибка) в A C представляют собой совокупные результаты ( n = 3–10 мышей на группу) из двух экспериментов.* P <0,05; ** P <0,01; *** P <0,001; **** P <0,0001.

Тяжесть малярии коррелирует с величиной иммунного ответа хозяина.

Микробиота кишечника может формировать иммунитет хозяина к системным вирусным инфекциям (19), и продуцируемый T-фолликулярным помощником (Tfh) IL-21 необходим для помощи В-клеткам зародышевого центра (GC) и избавления от инфекций, вызванных мышиным Plasmodium ( 32). В соответствии с этими наблюдениями, у устойчивых мышей Jax было повышенное значение P.yoelii -специфические CD4 + Т-клетки [CD49d hi CD11a hi (33)], ответы Tfh-клеток и GC B-клеток по сравнению с чувствительными мышами NCI (рис. 5 A C и SI Приложение , рис. 14). Мыши Jax и NCI имели одинаковые титры IgM, специфичных для 19-кДа фрагмента поверхностного белка мерозоитов 1 (MSP1 19 ) из P. yoelii (рис. 5 D ), что предполагает одинаковую активацию В-клеток в обоих группы. Напротив, мыши Jax продемонстрировали ускоренное переключение класса Ab с MSP1 19 -специфических IgM на изотипы IgG, титры в 4-10 раз выше на 14-й день постинфекции по сравнению с мышами NCI (рис.5 D ). Таким образом, одним из механизмов, с помощью которого микробиом кишечника формирует тяжесть малярии после инфицирования P. yoelii , может быть модуляция иммунного ответа хозяина.

Рис. 5.

-резистентные мыши Jax имеют повышенный клеточный и гуморальный иммунный ответ на Plasmodium . Мышей Jax и NCI инфицировали P. yoelii . Общее количество клеток CD4 + CD11a hi CD49d hi ( A ), клеток Tfh ( B ) и В-клеток зародышевого центра (GC) ( C ) на селезенку в указанный день.Данные (среднее ± стандартная ошибка) представляют собой совокупные результаты ( n = 5–10 мышей на точку данных) трех экспериментов. ( D ) Сыворотка MSP1 19 титров конечных точек антител, специфичных к . Данные (среднее ± стандартная ошибка) представляют собой совокупные результаты ( n = 3–7 мышей на точку данных) из двух экспериментов. Числа на панелях представляют кратную разницу между средними значениями мышей Jax и NCI. Данные были проанализированы с помощью непарного двустороннего теста t . * P <0,05; ** P <0.01; *** P <0,001; **** P <0,0001.

Обсуждение

Это исследование демонстрирует, что микробиом кишечника мышей влияет на количество паразитов у грызунов Plasmodium и модулирует тяжесть малярии у мышей. Важно отметить, что бремя паразитов в настоящее время является наиболее известным коррелятом тяжести заболевания после инфицирования человека P. falciparum (3, 4). Связь между кишечным микробным сообществом и паразитами Plasmodium была ранее обнаружена у комаров-переносчиков (34–38).Интересно, что уникальное скопление кожных бактерий на коже человека также влияет на привлекательность комаров Anopheles для конкретных людей (39, 40).

Две недавние публикации дополнительно подтверждают, что микробиота кишечника влияет на стадии жизненного цикла Plasmodium у млекопитающих. Первое исследование продемонстрировало, что определенные кишечные бактерии могут влиять на передачу спорозоитов P. berghei от комаров мышам (20).Авторы показали, что кишечный патобионт E. coli O86: B7 индуцировал продукцию антител против α-гал. Когда комары, инфицированные Plasmodium , вводили спорозоиты в ткань дермы во время приема пищи с кровью, антитела против α-галлона связывались со спорозоитами Plasmodium , что предотвращало их миграцию в печень (20). Эти результаты также распространились на людей, где присутствие анти-α-гал IgM Abs коррелировало с защитой от инфекции P. falciparum .Эффект E. coli O86: B7 на инфекцию Plasmodium был ограничен передачей спорозоитов, поскольку не было эффекта анти-α-галовых АТ на симптоматической стадии инфекции в крови. В соответствии с этими результатами, второй отчет продемонстрировал, что уникальный состав бактерий стула у малийских детей коррелирует с предполагаемым риском заражения P. falciparum , но не прогрессированием до лихорадочной малярии (21). Хотя механизм, ответственный за это наблюдение, неизвестен, сходство между этими двумя исследованиями (т.(восприимчивость к инфекции, но не тяжесть инфекции на стадии крови) предполагают, что предполагаемый риск заражения P. falciparum , дифференцированный по составу бактерий стула, может быть отнесен на счет различий в анти-α-гал IgM-антителах. В отличие от этих двух публикаций, мы показываем, что микробиота кишечника модулирует тяжесть инфекций на стадии P. yoelii у мышей, подразумевая другой механизм. Более того, наши результаты показывают, что влияние микробиома кишечника на инфекции Plasmodium является широким и не ограничивается передачей паразита.Взятые вместе, наши наблюдения и выводы Yilmaz et al. (20) приводят к интригующим предположениям о том, что кишечная микробиота человека может оказывать влияние на различные стадии жизненного цикла Plasmodium у людей. Ясно, что эта область созрела для будущих исследований.

Одним из возможных механизмов, с помощью которого микробиота кишечника регулирует тяжесть малярии, является прямое воздействие на самого паразита, при этом продукты, полученные из микробиоты кишечника, либо способствуют, либо подавляют его рост.Хотя эта возможность формально не исключена, мы наблюдаем аналогичную кинетику распространения паразитемии, когда она построена в логарифмической шкале, между 5 и 11 днями постинфекции как у устойчивых, так и у восприимчивых мышей. Это наблюдение предполагает, что микробиота кишечника не оказывает прямого воздействия на паразита. Следовательно, более вероятно, что микробиота кишечника влияет на тяжесть малярии, модулируя иммунный ответ хозяина на Plasmodium . В соответствии с этой возможностью, устойчивые мыши Jax проявляли повышенный иммунный ответ против Plasmodium по сравнению с восприимчивыми мышами NCI.Хотя эти данные коррелируют с бременем паразитов у этих мышей, необходимы дальнейшие эксперименты, чтобы продемонстрировать, является ли дифференциальный иммунный ответ ответственным за разницу в степени тяжести, и если да, то как микробиота кишечника модулирует иммунный ответ хозяина на эту внегастроинтестинальную инфекцию. Ранее было показано, что микробиом кишечника передает сигналы моноцитам / макрофагам, которые заставляют эти клетки реагировать на системные инфекции вируса лимфоцитарного хориоменингита и помогают контролировать их (19).Еще предстоит определить, модулирует ли микробиом кишечника иммунитет хозяина к Plasmodium посредством аналогичных или различных воздействий на иммунную систему хозяина.

Как упоминалось выше, диета играет важную роль в формировании состава и активности кишечной микробиоты (25, 41, 42). Следовательно, манипулирование структурой и функцией этих сложных сообществ с помощью диеты дает возможность манипулировать иммунной системой хозяина (41). В нашем исследовании мы определили, что виды Lactobacillus и Bifidobacterium в содержимом слепой кишки могут играть защитную роль, регулируя количество паразитов и уменьшая тяжесть заболевания.Также возможно, что эти бактериальные роды коррелируют со снижением паразитемии за счет конкуренции ниш, что снижает численность бактериальных родов, вызывающих повышенную паразитемию. Поскольку лечение антибиотиками с последующим лечением йогуртом вызвало 14-кратное снижение количества паразитов у восприимчивых мышей, результаты показывают, что за счет оптимизации (например, выявления и лечения наиболее эффективными «защитными» видами бактерий или устранения бактерий, которые способствуют высокой паразитемии) Модуляция микробиома кишечника может стать новым средством профилактики тяжелой малярии.В соответствии с этой возможностью предыдущая работа показала, что дети в сельской африканской деревне в Буркина-Фасо имеют обогащение типа Bacteroidetes и истощение типа Firmicutes, которое содержит Lactobacillus , по сравнению с европейскими детьми (43). Этот бактериальный комплекс напоминает структуру сообщества у восприимчивых мышей, у которых было больше Bacteroidetes и меньше Firmicutes по сравнению с устойчивыми мышами ( SI Приложение , Рис. 11). Таким образом, сходство между структурой бактериального сообщества африканских детей и Plasmodium -чувствительных мышей предполагает возможность того, что пробиотическая модуляция кишечной микробиоты мышей для борьбы с тяжелой малярией может работать у людей.

Этот отчет демонстрирует, что на тяжесть малярии у мышей в значительной степени влияет состав микробиоты кишечника. Эти данные приводят к гипотезе о том, что различия в микробиоте кишечника могут объяснить, почему некоторые люди, инфицированные Plasmodium , прогрессируют до тяжелой болезни, а другие — нет. Результаты также подтверждают возможность того, что манипулирование кишечной микробиотой может контролировать тяжесть малярии у людей. В то время как изменение микробиоты кишечника не может предотвратить инфекцию Plasmodium , изменение микробиома кишечника может облегчить тяжелое заболевание и спасти тысячи жизней ежегодно.

Материалы и методы

Мыши и инфекции.

Мышей, которых обычно содержали, покупали у Jax, NCI, CR, Har и Tac. Мышей GF приобретали в Национальном центре ресурсов по грызунам-гнотобиотикам при Университете Северной Каролины в Чапел-Хилл. Комитеты по институциональному уходу и использованию животных Университета Теннесси и Университета Луисвилля рассмотрели и одобрили эксперименты на животных. Мышей кормили рационом, облученным мышами / крысами по модифицированной открытой формуле NIH-31 (Harlan 7913), если не указано иное, в этом случае мышей кормили диетой Teklad 22/5 для грызунов (Harlan 8640), домашней диетой Jax (5K67; Cincinnati Lab. & Pet Supply, Inc.) или домашнюю диету NCI (5L79 Cincinnati Lab & Pet Supply, Inc.). Мышам GF вводили разбавленный материал слепой кишки через желудочный зонд. После трансплантации мышей содержали в обычных условиях. Мышей инфицировали P. yoelii 17XNL, P. chabaudi AS и P. berghei ANKA. Образцы крови брали из хвоста через равные промежутки времени от 3 до 35 дней после заражения. Паразитемия, процент эритроцитов, инфицированных Plasmodium , оценивалась с помощью тонких мазков крови или проточной цитометрии.Йогурт был приготовлен с использованием закваски (закваска для йогурта № 2; специальные пробиотики), обогащенной пробиотической порошковой добавкой, содержащей многочисленные виды Lactobacillus и Bifidobacterium (11 штаммов пробиотического порошка; специальные пробиотики). Мышей лечили пероральной смесью антибиотиков, состоящей из ампициллина, ванкомицина, метронидазола, неомицина сульфата и гентамицина сульфата. Клеточный иммунный ответ измеряли с помощью проточной цитометрии, а MSP1 , 19 -специфичных Ab, измеряли с помощью ELISA.

Анализ кишечной микробиоты.

Дистальную половину тонкой кишки, слепую кишку и толстую кишку вырезали у мышей и быстро замораживали в жидком азоте. ДНК выделяли из образцов с помощью набора для выделения ДНК MoBio PowerSoil. Бактериальные гены 16S рРНК амплифицировали с использованием специфичных для бактерий праймеров ПЦР, нацеленных на область V4. Секвенирование ДНК было выполнено с использованием платформы MiSeq (Illumina) в Институте биотехнологии Hudson Alpha, Хантсвилл, Алабама. Последовательности депонированы в архиве чтения последовательностей NCBI в Bioproject PRJNA289122.Программный пакет Mothur использовался для обработки последовательностей, кластеризации последовательностей для филогенетической классификации и сортировки последовательностей в группы на основе областей пищеварительного тракта. Программный пакет PRIMER-E использовался для исследования взаимосвязей между филотипами в образцах и для получения корреляций между присутствием / численностью филотипов и другими параметрами. Выявление «биомаркерных» последовательностей проводили с помощью программного пакета LEfSe (huttenhower.sph.harvard.edu/galaxy/).

Статистический анализ.

Описательный и сравнительный статистический анализ данных, за исключением данных о кишечной микробиоте и метаболомике, был проведен с использованием программного обеспечения GraphPad (Prism, версия 6). AUC оценивалась для каждой группы в соответствии с правилом трапеций с помощью следующего уравнения: AUCt1-t-last = 0,5∑ (Yi + Yi + 1) * (ti + 1-ti),

, где «t» — время выборки, а «Y» — наблюдаемый результат (например, процент паразитемии).

Дополнительные сведения см. В Приложении SI , Материалы и методы .

Благодарности

Мы благодарим Брюса Эпплгейта и Уитни Пауэлла за техническую помощь. Мы благодарим доктора Сару Лебейс и доктора Юсефа Абу Квайка за рецензирование рукописи. Эта работа была поддержана грантом NIH 1R21AI113386 (для N.W.S.) и грантом научного сотрудника Американского онкологического общества RSG-14-057-01-MPC (для N.W.S.), а также профессором Kenneth & Blair Mossman (для S.W.W.). Национальный центр ресурсов по грызунам-гнотобиотам при Университете Северной Каролины в Чапел-Хилл получил поддержку грантов 5-P39-DK034987 и 5-P40-OD010995.

Сноски

  • Вклад авторов: N.F.V., S.R.C., S.W.W. и N.W.S. спланированное исследование; N.F.V., G.R.L., J.E.D., S.P.D., C.L.H., S.S.S., J.L.G. и N.W.S. проведенное исследование; N.F.V., G.R.L., J.E.D., S.P.D., S.R.C., S.W.W. и N.W.S. проанализированные данные; G.R.L., J.L.G. и S.W.W. проанализировали секвенирование ДНК; S.P.D. и S.R.C. проанализировали данные метаболомики; и N.F.V., G.R.L., S.R.C., S.W.W. и N.W.S. написал газету.

  • Авторы заявляют об отсутствии конфликта интересов.

  • Эта статья представляет собой прямое представление PNAS. М-М-М. Приглашенный редактор по приглашению редакционной коллегии.

  • Размещение данных: Последовательности, описанные в этой статье, были депонированы в Национальном центре биотехнологической информации в архиве чтения последовательностей в рамках Bioproject PRJNA289122.

Leave a Reply

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2021 © Все права защищены.