Пролиферация клеток железистого эпителия что это: Цитологическое исследование соскобов шейки матки и цервикального канала с описанием по терминологической системе Бетесда (The Bethesda System – TBS)

Содержание

Цитологическое исследование соскобов шейки матки и цервикального канала с описанием по терминологической системе Бетесда (The Bethesda System – TBS)

Метод определения Цитологическое исследование осуществляется согласно «Номенклатуре клинических лабораторных исследований, применяемых в целях диагностики и слежения за состоянием пациентов в учреждениях Российской Федерации», утвержденной приказом Минздрава России от 21.02.2000 г. №64 и «Примерному перечню лабораторных исследований для клинико-диагностической лаборатории лечебно-профилактических учреждений» от 25.12.1997 г. №380.

Исследуемый материал Смотрите в описании

Доступен выезд на дом

Международный метод своевременного распознавания вероятной онкологической патологии матки.

Онкологические заболевания шейки матки являются серьезной проблемой здравоохранения, широко распространены, имеют надежно распознаваемую преклиническую фазу и длительный период развития. Для достоверной верификации диагноза и выбора методов эффективного лечения применяется надежный скрининг-тест – цитологическое исследование мазков, взятых из шейки матки и цервикального канала. 

Цитологический метод исследования является весьма чувствительным в диагностике предрака (дисплазий) и начального преклинического рака шейки матки (карциномы in situ, микроинвазивного и скрытого инвазивного рака). Цитологический скрининг позволяет выявить пациенток в преклинической фазе заболевания, использовать щадящие методы лечения, сокращать его сроки, снижать частоту инвалидизации и смертности. Скрининговое цитологическое исследование шейки матки рекомендуется проводить ежегодно всем женщинам от 21 года (или через год от начала половой жизни), независимо от клинических показаний. При наличии клинических изменений частота цитологического исследования определяется врачом-гинекологом. 

Для возникновения и развития многих патологических процессов существенное значение имеет особенность анатомического строения шейки матки и, в частности, состояние и взаимоотношение эпителиальных слоев влагалищной части шейки цервикального канала. Как правило, предраковые изменения, а затем и малигнизация, возникают в месте перехода многослойного плоского эпителия влагалищной порции шейки матки в цилиндрический эпителий цервикального канала (зоне трансформации), расположенного (в фертильном возрасте) в области наружного зева. Под влиянием гормональных факторов, травм, воспалительных процессов, диатермокоагуляции зона трансформации (зона стыка) может значительно варьировать. В период увядания овариально-менструальной функции в связи с процессами атрофии уровень стыка поднимается высоко в цервикальный канал. 

В 95-97% случаев злокачественная трансформация происходит в клетках плоского эпителия, в остальных – в клетках цилиндрического эпителия цервикального канала. 

Основоположником диагностической цитопатологии является Г. Папаниколау (G.N. Papanicolaou), который в 1928 г. описал раковые клетки в мазках из влагалища. Им была разработана широко используемая классификация изменения клеток влагалища и цервикального канала шейки матки. Но в этой классификации не учитываются цитологические изменения, обусловленные вирусом папилломы человека (ВПЧ). Поэтому в настоящее время Всемирная организация здравоохранения рекомендует систему, разработанную в клинике Бетесда (США).

Терминологическая система Бетесда (ТБС, 2001 г.)

разработана для унификации описаний результатов цитологического исследования эпителия шейки матки (с целью представления их в удобной клиницистам форме), с выделением в отдельные группы находок разной клинической значимости и оценкой адекватности исследуемого материала. 

Система Бетесда включает 3 категории мазков: норма, мазки неопределенного значения (ASCUS) и внутриэпителиальные (предраковые) поражения низкой (LSIL) и высокой (HSIL) степеней. 

Согласно ТБС, начальным компонентом интерпретации цервикальных мазков является оценка адекватности образца, так как его качество влияет на чувствительность цитологического метода. ТБС 2001 г. предполагает две категории образцов: «удовлетворительный» и «неудовлетворительный».

Терминология системы Бетесда (пересмотр 2004 г.).

NILM – интраэпителиальные изменения и злокачественные процессы отсутствуют. В эту группу включены цитологические заключения о нормальном состоянии эпителия, а также о наличии различных не неопластических состояний (заболеваний). Уточняют их характер и, по возможности, причину: 

  • атрофические изменения; 
  • наличие клеток железистого эпителия после гистерэктомии; 
  • реактивные изменения, ассоциированные с воспалением, включая типичную регенерацию, лучевую терапию, применение внутриматочных контрацептивов; 
  • кроме того, указывают наличие микроорганизмов:
    • Trichomonas vaginalis;
    • грибов, по морфологическому строению соответствующих Candida spp.;
    • бактерий, по морфологическому строению соответствующих Actinomyces spp.;
    • коккобациллярную микрофлору, характерную для бактериального вагиноза;
    • клеточные изменения, соответствующие поражению Herpes simplex virus.

У женщин 40 лет и старше при отсутствии плоскоклеточных интраэпителиальных изменений указывается также наличие эндометриальных клеток.

ASCUS – клетки плоского эпителия с атипией неясного значения.

ASC-Н – клетки плоского эпителия с атипией неясного значения, не исключающие наличия высокой степени интраэпителиальных изменений.

LSIL – интраэпителиальные изменения плоского эпителия низкой степени, включают поражения, ассоциированные с HPV и CIN I.

НSIL – интраэпителиальные изменения плоского эпителия высокой степени, включают CIN II, CIN III, карциному in situ и случаи, подозрительные на наличие инвазии.

Плоскоклеточная карцинома.

AGC – клетки цервикального (железистого) эпителия с атипией неясного значения.

AGC, favor neoplastic – клетки цервикального (железистого) эпителия, возможно неоплазия. 

Эндоцервикальная аденокарцинома in situ. 

Эндоцервикальная аденокарцинома. 

Эндометриальная аденокарцинома. 

Вторичная аденокарцинома. 

Неклассифицируемая карцинома. 

Другие злокачественные опухоли.

Материал для исследования:

мазок эпителия шейки матки (см. инструкцию по взятию биоматериала). 

Инструкция по взятию материала:

Мазки берутся до бимануального исследования и кольпоскопии. Используемые инструменты должны быть стерильными и сухими, поскольку вода и дезинфицирующие растворы разрушают клеточные элементы. 

При профилактическом осмотре женщин (цитологический скрининг) клеточный материал целесообразно получать с поверхности влагалищной части шейки матки (эктоцервикса) и стенок цервикального канала (эндоцервикса), при наличии патологических изменений шейки матки – прицельно. 

В качестве инструмента для взятия материала из шейки матки при профилактическом осмотре используются модифицированные шпатели типа Эйра или щетки Cervix-Brash, Papette. С диагностической целью материал получают раздельно: шпателями из эктоцервикса, щетками типа Cytobrash из эндоцервикса. 

Полученный биологический материал наносится тонким слоем на предметное стекло и подсушивается на воздухе. Стекло обязательно маркируется с указанием фамилии/кода и места взятия клеточного материала (шейка матки, цервикальный канал). Маркировка на предметном стекле и в направлении на цитологическое исследование должны соответствовать друг другу. 

Обращаем внимание, что у девочек до 16 лет гинекологические анализы берутся только в присутствии родителей. В медицинских офисах не делают соскоб и мазок из цервикального канала беременным женщинам со сроком 22 недели и более, так как эта процедура может вызвать осложнения. В случае необходимости для взятия материала вы можете обратиться к своему лечащему врачу. 

В направлении на цитологическое исследование биологического материала обязательно указывают клинические данные, диагноз, особенности и место получения материала, данные о менструальном цикле. 

Мазок должен быть нанесен тонким слоем на стекло и полностью высушен.

Пролиферация железистого эпителия — Вопрос гинекологу

Если вы не нашли нужной информации среди ответов на этот вопрос, или же ваша проблема немного отличается от представленной, попробуйте задать дополнительный вопрос врачу на этой же странице, если он будет по теме основного вопроса. Вы также можете задать новый вопрос, и через некоторое время наши врачи на него ответят. Это бесплатно. Также можете поискать нужную информацию в похожих вопросах на этой странице или через страницу поиска по сайту. Мы будем очень благодарны, если Вы порекомендуете нас своим друзьям в социальных сетях.

Медпортал 03online.com осуществляет медконсультации в режиме переписки с врачами на сайте. Здесь вы получаете ответы от реальных практикующих специалистов в своей области. В настоящий момент на сайте можно получить консультацию по 71 направлению: специалиста COVID-19, аллерголога, анестезиолога-реаниматолога, венеролога, гастроэнтеролога, гематолога, генетика, гепатолога, гериатра, гинеколога, гинеколога-эндокринолога, гомеопата, дерматолога, детского гастроэнтеролога, детского гинеколога, детского дерматолога, детского инфекциониста, детского кардиолога, детского лора, детского невролога, детского нефролога, детского офтальмолога, детского психолога, детского пульмонолога, детского ревматолога, детского уролога, детского хирурга, детского эндокринолога, дефектолога, диетолога, иммунолога, инфекциониста, кардиолога, клинического психолога, косметолога, логопеда, лора, маммолога, медицинского юриста, нарколога, невропатолога, нейрохирурга, неонатолога, нефролога, нутрициолога, онколога, онкоуролога, ортопеда-травматолога, офтальмолога, паразитолога, педиатра, пластического хирурга, проктолога, психиатра, психолога, пульмонолога, ревматолога, рентгенолога, репродуктолога, сексолога-андролога, стоматолога, трихолога, уролога, фармацевта, физиотерапевта, фитотерапевта, флеболога, фтизиатра, хирурга, эндокринолога.

Мы отвечаем на 97.54% вопросов.

Оставайтесь с нами и будьте здоровы!

пролиферация эпителия — 25 рекомендаций на Babyblog.ru

Девочки, привет! Помогите разобраться пожалуйста кто сталкивался…

Все у меня было хорошо, пошла к гинекологу из за того что на Джесе месячные стали скудные слишком. Она взяла стандартные анализы, мазок и цитологию. Пришла за результатами, и они оказались плохие как врач сказала. Надо говорит биопсию делать. Но детально ничего не объяснила( Только напугала и расстроила…

Исследование соскоба с шейки матки цервикального канала

Микроскопическое описание:

Эндоцервикс и Эктоцервикс-скопление клеток цилиндрического эпителия с признаками пролиферации, явления плоскоклеточной метаплазии эпителия, скопление клеток плоского эпителия поверхностного и промежуточного слоев с реактивными изменениями, часть клеток с явлением дискариоза и паракератоза.

Заключение: Возможно, эктопия шейки матки. Рекомендуется исключить HPV.

Уроuенитальные мазки:

Эпителиальные клетки

влагалище: умерено

шейка матки: единичные в поле зрения

эритроциты: не обнаружено

лейкоциты:

влагалище: 20-30

шейка матки: 40-50

флора

влагалище: палочки обильно

шейка матки: палочки умерено

грибы не обнаружено

простейшие (трихоионады) не обнаружено

neisseria gonorroeae не обнаружено

Девченки, кто понимает подскажите по анализам, все настолько плохо?((( Не понимаю я типичнее клетки есть или нет, обычно четко было написано всегда что нет атипичных клеток!

а результат этого анализа я вообще не понимаю…Дисплазия что ли? Колпоскопию кстати не делали мне и даже не предлагали, сразу сказала что надо биопсию. ВПЧ есть у меня давно, но проявлений не было никогда. До родов появилась эрозия очень маленькая, в этот раз врач тоже сказала что она есть но очень очень маленькая. Пока назначила просто свечи противовоспалительные. К слову, врачу и клинике я не доверю…просто пошла по ДМС от работы к ним. Они мне в прошлый раз уже ставили внематочную беременность, хотя по сроком просто плодное яйцо еще не опустилось…после этого я очень сомневаюсь в их компетентности. Думаю куда со всем этим теперь идти, может сразу в онко центр? в Герцена…или может в Кулаково?

Gravita Family Clinic | Неопухолевые изменения клеток эпителия

Плоскоклеточная метаплазия

Процесс, который характеризуется нераковыми изменениями в эпителиальных клетках шейки матки. Плоскоклеточная метаплазия возникает в результате совокупности общих и местных факторов, которые негативно влияют на организм, вызывая обратимый процесс, в ходе которого дифференцированные эпителиальные клетки преобразуются в более выносливые клетки многослойного плоского эпителия, с ороговением или без. Плоскоклеточная метаплазия цервикального канала также возникает как результат слияния с находящимся рядом эндоцервиксом. Изменение типа клеток может приводить к снижению функции эпителия. Когда патологические раздражители устраняются, метапластические клетки приобретают свою первоначальную форму и функцию. Сохранение физиологических стрессоров в областях, подверженных метаплазии, может приводить к дисплазии или предраковым клеточным изменениям. Развитие метаплазированных клеток происходит под влиянием герпеса или бактериальных инфекций (хламидиоз, токсоплазмоз, уреаплазмоз), протекающих на фоне ослабленного иммунитета и имеющих хроническую форму.

Кератоз

Представляет собой патологический процесс, который характеризуется пролиферацией и ороговением клеток плоского эпителия, выстилающего влагалищную часть шейки матки. При этом  образуются утолщения или бляшки белого цвета с четкими границами, выступающие над поверхностью слизистых оболочек и могут быть  видимы невооруженным глазом до любой обработки растворами.

Гиперкератоз

Это усиленное ороговение верхнего слоя многослойного плоского эпителия шейки матки. Считается, что причиной может быть недостаток эстрогена в организме женщины. В процессе ороговения слизистая покрывается плотными белесоватыми структурами, слегка выступающими над поверхностью здоровой ткани.

Паракератоз

Нарушения Ороговения эпителиального слоя эпидермиса (неполное ороговение). Характеризуется ороговением слизистых оболочек, потерей эпидермисом способности синтезировать кератогиалин (предшественник кератина) и нарушением морфологии слизистой оболочки. При данном процессе пораженный участок цервикального канала выглядит сморщенным из-за нарушения эластичности ткани. Такие островки более грубые.

Опасность представляет лейкоплакия, возникшая в результате активизации вируса папилломы человека высокого канцерогенного риска.

Трубная метаплазия

Характеризуется наличием в строме шейки матки нормальных по строению желез, выстланных клетками, напоминающими эпителий маточной трубы. Данная патология обычно представлена одиночной железой или группой желез и может быть реснитчатая либо секреторная. Трубная метаплазия часто встречается в неупорядоченном пролиферативном эндометрии

Атрофические изменения

Атрофия матки и шейки в большинстве случаев диагностируется у женщин в климактерическом периоде. Результатом данной патологии становится регресс эпителиальной ткани. Однако женщины детородного возраста также не застрахованы от атрофии шейки матки. Заболевание может развиться при дефиците эстрогенов, после оперативных вмешательств на шейке матки, при системных патологиях соединительной ткани. Атрофия шейки матки – один из факторов, вызывающих женское бесплодие.

В основном атрофические изменения происходят в период менопаузы. Снижение выработки гормонов приводит к исчезновению слизистой секреции, изменению бактериальной флоры. В результате происходит поэтапное сокращение толщины эпителия, что приводит ткани к раздражениям, травмам.

Изменения при беременности

В течение беременности устанавливается типичная для данного процесса картина мазка. Эти изменения связаны с продукцией гормонов плацентой и могут быть неверно трактованы как предопухолевые или опухолевые. Реактивные изменения шейки матки связаны с нарушением клеток ее эпителия. Возникают при: воспалениях, гиперкератозе, паракератозе, дискератозе, плоскоклеточной метаплазии, железистой гиперплазии, полипах, лимфоцитарном (фолликулярном) цервиците.

Внутриэпителияальные изменения клеток и рекомендуемые алгоритмы ведения пациенток

ASC-US (ASC of undetermined significance) – клетки плоского эпителия с атипией неясного значения.                                    *ASCCP, 2013(Цитология жидкостная и традиционная при заболеваниях шейки матки. Цитологический атлас / Под ред. И.П.Шабаловой, К.Т.Касоян. 4-е издание, исправленной и ополненное. М. –Тверь: ООО«Издательство «Триада»», 22016. – 320 с.: 1122 ил.)LSIL (Low-grade squamous intraepithelial lesion) внутриэпителиальное поражение клеток плоского эпителия низкой степени                                   ASCCP, 2013ASC-H (ASC, cannot exclude high-grade squamous intraepithelial lesion) клетки плоского эпителия с атипией, не позволяющие исключить HSIL(Цитология жидкостная и традиционная при заболеваниях шейки матки. Цитологический атлас / Под ред. И.П.Шабаловой, К.Т.Касоян. 4-е издание, исправленной и ополненное. М. –Тверь: ООО«Издательство «Триада»», 22016. – 320 с.: 1122 ил.)HSIL (High-grade squamous intraepithelial lesion) — внутриэпителиальное поражение клеток плоского эпителия высокой степени, включают CIN II и CIN III, рак in situ(Цитология жидкостная и традиционная при заболеваниях шейки матки. Цитологический атлас / Под ред. И.П.Шабаловой, К.Т.Касоян. 4-е издание, исправленной и ополненное. М. –Тверь: ООО«Издательство «Триада»», 22016. – 320 с.: 1122 ил.)

Атипичные железистые клетки (AGC)

Различают:

  • эндоцервикальные
  • эндометриальные
  • неопределенные
Просмотреть(Цитология жидкостная и традиционная при заболеваниях шейки матки. Цитологический атлас / Под ред. И.П.Шабаловой, К.Т.Касоян. 4-е издание, исправленной и ополненное. М. –Тверь: ООО«Издательство «Триада»», 22016. – 320 с.: 1122 ил.)

Эпителия: Руководство по гистологии

Эпителия:

Функции двух основных типов эпителии

Что такое эпителий?

Эпителии представляют собой сплошные листы клеток (толщиной в один или несколько слоев), покрывающие внешнюю поверхность. поверхности корпуса, внутренние закрытые полости и трубки корпуса которые общаются с внешней средой (пищевая, дыхательные и мочеполовые пути), составляют секреторные части желез и их протоков, и находятся в сенсорных рецептивных области определенных органов чувств (например,грамм. ухо и нос).

Чем они занимаются?

Покровные и выстилающие поверхности эпителия (например, кожа) участвуют в абсорбции , (например, кишечник), секреции (например, железы), могут быть сенсорными (например, нейроэпителием) или сократительными (например, миоэпителиальными клетками).

Каковы их характеристики?

Эпителии представляют собой сплошной лист клеток, покрывающий поверхности тела. Они стоят в подвале мембрана, которая обеспечивает место прикрепления эпителия, и действует как селективный фильтрующий барьер.Очень мало межклеточный материал. Epithelia не имеют собственной крови питания (бессосудистая ), они полагаются на диффузию для обмен кислорода и метаболитов. Эпителии содержат специализированные межклеточные соединения. которые связывают соседние клетки друг с другом. Они также содержат коммуникационные соединения (щелевые соединения), которые позволяют общаться. между соседними ячейками. Нажмите здесь, чтобы узнать о Cell-Cell переходы.Клетки в эпителии показывают полярность вдоль оси между внешней и внутренней средой, и их апикальная (свободная) поверхность часто претерпевает модификации.

Существует два основных типа эпителия:

Покровный эпителий и Железистый эпителий

(Примечание: эпителий — это множественная форма эпителия!)

Покровный эпителий важен для:

Селективная диффузия — например, перенос газов, питательных веществ и продукты жизнедеятельности между кровью и окружающими тканями.Эти эпителии обычно простого плоского типа, чтобы обеспечить наименьший барьер для распространения. Щелкните здесь, чтобы увидеть простой плоский эпителий.

Всасывание / секреция — например, всасывание питательных веществ из кишечника и секрецию ферментов для пищеварения. Эти эпителии обычно столбчатые, так как клетки содержат много эндоплазматических ретикулум и Гольджи для секреции, и у них часто есть микроворсинки, для увеличения площади апикальной поверхности для впитывания.Щелкните здесь, чтобы увидеть несколько примеров столбчатый эпителий.

Физическая защита — например, кожа защищает нижележащий ткани от солнечного света, тепла, холода, истирания и т. д. Эти эпителии всегда расслаиваются (многослойны), иногда могут быть ороговевшими на его апикальной поверхности, как на коже. Кератин помогает водонепроницаемому кожа. Нажмите здесь, чтобы найти о стратифицированном эпителии.

Защитная оболочка — i.е. барьер между внутренним и внешним кишечника и т. д.

Железистый эпителий:

Железы представляют собой организованную совокупность секреторных эпителиальных клетки. Большинство желез образуются в процессе развития путем пролиферации эпителиальных клеток так, что они выступают в подлежащую соединительную ткань ткань. Некоторые железы сохраняют неразрывность с поверхностью за счет протока и известны как ЭКЗОКРИНОВЫЕ ЖЕЛЕЗЫ. Другие железы теряют это прямая непрерывность с поверхностью, когда их каналы вырождаются во время разработки.Эти железы известны как эндокринные железы.

Таким образом, называются два типа желез: экзокринных, и эндокринных.

Экзокринные железы

Может быть одноклеточных — бокаловидных или многоклеточных

Все экзокринные железы — это железы с протоками . Секрет попадает в протоки и попадает на поверхность эпителия. Например, потовые железы — это экзокринные железы.

Есть несколько различных основных типов экзокринных желез. Щелкните здесь, чтобы узнать, какие типы экзокринных желез и бывают.

Эндокринные железы

Сальники без каналов . Секреты попадают прямо в кровоток.

Железы более подробно рассматриваются в теме «Железистые ткани».

А теперь проверьте свои знания с этим кроссвордом.

свидетельств от модели мыши

Mol Hum Reprod. 2014 Август; 20 (8): 776–786.

Департамент ветеринарных интегративных биологических наук, Колледж ветеринарной медицины и биомедицинских наук, Техасский университет A&M, Колледж-Стейшн, Техас 77843, США

* Адрес для корреспонденции. Тел: + 1-979-862-2009; Факс: + 1-979-847-8981; E-mail: [email protected]

Поступила в редакцию 15.01.2014; Пересмотрено 30 марта 2014 г .; Принято 17 апреля 2014 г.

Авторские права © Автор, 2014 г. Опубликовано Oxford University Press от имени Европейского общества репродукции человека и эмбриологии.Все права защищены. Для получения разрешений обращайтесь по электронной почте: [email protected] Эту статью цитировали в других статьях PMC.

Abstract

В матке пролиферация эпителиальных клеток изменяется во время эстрального цикла и беременности. Неконтролируемая пролиферация эпителиальных клеток приводит к неудаче имплантации и / или развитию рака. Передача сигналов трансформирующего фактора роста-β (TGF-β) является фундаментальным регулятором разнообразных биологических процессов и незаменима для множества репродуктивных функций.Однако роль in vivo в передаче сигналов TGF-β в эпителиальных клетках матки остается малоизученной. Мы показали, что в матке условная делеция рецептора типа 1 для TGF-β ( Tgfbr1 ) с использованием рецептора антимюллерова гормона типа 2 ( Amhr2 ) Cre приводит к дефектам миометрия. Здесь мы описываем усиленную пролиферацию эпителиальных клеток путем иммуноокрашивания Ki67 в матках этих мышей. Аберрация завершилась гиперплазией эндометрия у пожилых женщин.Чтобы исключить возможное влияние стероидных гормонов яичников, после овариэктомии оценивали пролиферативный статус эпителиальных клеток матки. Повышенная пролиферация эпителиальных клеток матки была также обнаружена у мышей с условным нокаутом Tgfbr1 Amhr2- Cre, подвергнутых овариэктомии. Мы также продемонстрировали, что уровни транскрипта фактора роста 10 фибробластов ( Fgf10 ) были заметно повышены в матке с условным нокаутом Tgfbr1 Amhr2- Cre. Соответственно, обработка первичных стромальных клеток матки TGF-β1 значительно снижала экспрессию мРНК Fgf10 .Таким образом, наши результаты предполагают потенциальное участие TGFBR1-опосредованной передачи сигналов в регуляции пролиферации эпителиальных клеток матки и предоставляют генетические доказательства, подтверждающие роль пролиферации эпителиальных клеток матки в патогенезе гиперплазии эндометрия.

Ключевые слова: трансформирующий фактор роста β, матка, эпителиальные клетки, пролиферация, гиперплазия эндометрия

Введение

Гиперплазия эндометрия — это патологическое состояние, при котором клетки эндометрия подвергаются чрезмерной пролиферации (Mills and Longacre, 2010).Как предраковое поражение карциномы эндометрия (Montgomery et al. , 2004), гиперплазия эндометрия вызывает множество симптомов, включая аномальное маточное кровотечение, нарушения фертильности и, в тяжелых случаях, заболеваемость и смертность. Поэтому понимание патофизиологии и механизмов гиперплазии эндометрия имеет решающее значение. В матке пролиферация эпителиальных клеток изменяется во время эстрального цикла и беременности (Wood et al., 2007; Li et al., 2011b). Как предварительное условие для имплантации эмбриона, люминальные эпителиальные клетки прекращают пролиферацию на ранних сроках беременности (Dey et al. , 2004). Неконтролируемая пролиферация эпителиальных клеток приводит к неудаче имплантации и / или развитию рака.

Передача сигналов суперсемейства трансформирующего фактора роста-β (TGF-β) играет важную роль в пролиферации, дифференцировке и миграции клеток (Massague, 1990, 1998, 2000; Chang et al. , 2002). Каноническая передача сигналов TGF-β инициируется лиганд-индуцированной гетеролигомеризацией рецепторов клеточной поверхности.Передача сигналов TGF-β опосредуется внутриклеточными белками SMAD, которые включают регулируемые рецептором SMAD (SMAD2 / 3 и SMAD1 / 5/8) и обычный SMAD (то есть SMAD4). Обычно считается, что активация SMAD2 / 3 и SMAD1 / 5/8 опосредует соответствующую передачу сигналов TGF-β / activin и передачу сигналов костного морфогенетического белка (BMP) контекстуально зависимым образом (Attisano and Wrana, 2002; Shi and Massague, 2003; Massague, 2012). Лиганды суперсемейства TGF-β также передают сигнал через неканонические пути, которые включают MAP-киназу, фосфатидилинозитол-3-киназу / AKT и пути микроРНК (Davis et al., 2008, 2010).

Накопление доказательств, включая нашу собственную работу, демонстрирует обязательную роль передачи сигналов суперсемейства TGFβ в воспроизводстве самок (Dong et al. , 1996; Galloway et al. , 2000; Tomic et al. , 2004; Hashimoto и др. , 2005; Джуэнджел и МакНатти, 2005; Диаз и др. , 2007; Драгович и др. , 2007; Ли и др. , 2007; Ли и др. , 2008, 2011a; Pangas et al., 2008; Gong and McGee, 2009; Edson et al., 2010 г .; Nagashima et al. , 2013). Лиганды TGF-β (TGF-βs 1-3) передают сигнал через свои рецепторы типа 2 (TGFBR2) и типа 1 (TGFBR1 или ALK5). Косвенные данные свидетельствуют об участии изоформ TGF-β в функции матки. Таким образом, TGF-β продуцируются и регулируются гормонами в матке (Takahashi et al. , 1994). Однако пространственная и временная экспрессия TGFBR1 в матке мыши не была хорошо описана, несмотря на демонстрацию его преимущественной локализации в миометриальном компартменте в постнатальной матке (Li et al., 2011а; Gao et al. , 2014). Функция in vivo передачи сигналов TGFβ в женском репродуктивном тракте была неуловима до разработки Tgfbr1 рецепторов антимюллерова гормона типа 2 ( Amhr2 ) -Cre conditional knockout (cKO) мышей, у которых бесплодие и выраженные гладкие мышцы дефекты возникают в яйцеводе и матке (Li et al. , 2011a). Несмотря на вышеизложенное, мало что известно о роли in vivo в передаче сигналов TGF-β в эпителиальных клетках матки.

В этом исследовании, используя модель Amhr2 -Cre на мышах с условным нокаутом Tgfbr1, , мы предоставляем доказательства, подтверждающие связь усиленной пролиферации эпителиальных клеток матки и развития гиперплазии эндометрия. Эти результаты помогут понять потенциальную функцию передачи сигналов TGFβ при этом заболевании и других состояниях, которые связаны с измененными свойствами эпителиальных клеток матки, такими как рак эндометрия.

Материалы и методы

Животные

Экспериментальные процедуры с использованием лабораторной мыши были одобрены Комитетом по уходу и использованию институциональных животных Техасского университета A&M.Мышей содержали на смешанном генетическом фоне C57BL / 6/129. Аллель Amhr2 cre (Jamin et al. , 2002), аллель Tgfbr1 flox (Larsson et al. , 2001) и нулевой аллель Lgfbr1 (т.е. Tgfbr111 ; The Jackson Laboratory) были использованы для создания условной делеции Tgfbr1 в тканях матки, происходящих от менсенхимы, как описано (Li et al. , 2011a).

Иммунофлуоресцентная микроскопия и иммуногистохимия

Иммунофлуоресценцию проводили, как описано (Li et al. , 2011a). Вкратце, из залитых парафином тканей вырезали серийные парафиновые срезы (5 мкм). Извлечение антигена осуществляли путем кипячения срезов в цитратном буфере (10 мМ; pH 6,0) в течение 20 минут. После блокирования бычьим сывороточным альбумином (BSA) срезы инкубировали с первичными антителами при 4 ° C в течение ночи. Соответствующие вторичные антитела, конъюгированные с Alexa Fluor 488 или 594 (Invitrogen), затем использовали для обнаружения экспрессии / локализации антигенов, которые были связаны с антителами.Срезы монтировали с использованием среды ProLong Gold SlowFade, содержащей DAPI (4 ‘, 6-диамидино-2-фенилиндол, Invitrogen), и исследовали под флуоресцентным микроскопом.

Процедура иммуногистохимии подробно описана в другом месте (Li et al. , 2011a). Сигналы проявляли с использованием набора Diaminobenzidine (DAB) (Vector Labs), и срезы окрашивали гематоксилином. Чтобы контролировать фоновые уровни окрашивания, для обоих типов вышеупомянутых анализов были включены контроли с использованием нормальных IgG.Первичные антитела, использованные в этом исследовании, включали кроличий анти-Ki67 (Abcam; 1: 200), мышиный анти-актин гладких мышц α (ACTA2; Abcam; 1: 2000), кроличий блок против вилки головы A2 (FOXA2; Abcam; 1: 250). ), кроличий антивиментин (VIM; Cell signaling; 1: 200) и крысиный антицитокератин 8 (KRT8; Developmental Studies Hybridoma Bank; 1: 100). Все антитела были проверены, и оптимальные разведения были определены в пилотном эксперименте. Количественное определение Ki67-положительных клеток в матке мышей, подвергнутых овариэктомии, проводили с использованием изображений с высоким увеличением (40 ×) иммуноокрашенных срезов Ki67 и KRT8.Включение окрашивания KRT8 облегчает подсчет эпителиальных клеток. В этом исследовании было использовано шесть независимых выборок ( n = 3 на группу). Среднее значение Ki67-положительных клеток в контроле было установлено равным 100%, и результаты экспериментальной группы представлены как процент от контролей.

Окрашивание X-gal

Окрашивание

X-gal проводили с использованием образцов матки мышей, несущих аллель Tgfbr1 Lacz (Li et al. , 2011a).Вкратце, образцы матки собирали и фиксировали в буфере для фиксации (2% параформальдегид, 0,2% глутаральдегид и 0,1 М фосфат; pH 7,4). Образцы промывали и затем окрашивали буфером, содержащим 1 мг / мл X-gal, 5 мМ феррицианид калия и 5 мМ ферроцианид калия. После окрашивания образцы заливали, делали срезы и контрастно окрашивали быстрым красным для визуализации ядра (Vector Lab). Все образцы для гистологических исследований были обработаны Гистологической лабораторией ветеринарных интегративных биологических наук Техасского университета A&M.

Овариэктомия

Яичники были удалены у взрослых девственных контрольных мышей и мышей Tgfbr1 Amhr2- Cre cKO под анестезией авертином. Через две недели после операции образцы матки собирали у контрольных мышей и мышей Tgfbr1 Amhr2- Cre cKO ( n = 5 на группу). Затем образцы обрабатывали для выделения РНК или иммунофлуоресцентной микроскопии.

Выделение, культивирование и обработка стромальных клеток матки мышей

Выделение стромальных клеток матки мышей проводили на основании предыдущих отчетов с небольшими изменениями (Daikoku et al., 2005; Чен и др. , 2009). Вкратце, рога матки взрослых девственных мышей собирали, разрезали на кусочки размером 3–5 мм и промывали забуференным солевым раствором Хэнка, не содержащим кальция и магния (HBSS; Lonza), содержащим 100 Ед / мл пенициллина и стрептомицина (Gibco). Ткани переваривали 0,5% трипсином (AMRESCO; 100 Ед / мл) в HBSS в течение 1 ч при 4 ° C, 1 ч при комнатной температуре и 10 мин при 37 ° C. После промывки HBSS ткани дополнительно переваривали 0,05% коллагеназой (Sigma) в течение 45 мин при 37 ° C и встряхивали.Затем перевариваемую смесь пропускали через сетчатый фильтр для клеток 70 мкм (Becton, Dickinson and Company). Клетки собирали центрифугированием и ресуспендировали в среде Игла, модифицированной Дульбекко, — ростовой среде F12 с добавлением 10% фетальной бычьей сыворотки (FBS). Клетки инкубировали при 37 ° C с 5% CO 2 в течение 90 минут, промывали HBSS и затем культивировали в питательной среде. Для лечения TGF-β1 стромальные клетки матки подвергали голоданию по сыворотке в течение ночи, а затем обрабатывали TGF-β1 (0,1, 1, 2,5, 5 и 10 нг / мл).Клетки собирали после 20 ч инкубации и общую РНК выделяли, как описано ниже.

Выделение гладкомышечных клеток матки мышей

Выделение гладкомышечных клеток матки мышей было основано на ранее описанных протоколах с модификациями (Shynlova et al. , 2002; Renthal et al. , 2010). Вкратце, собирали матки от 2–3-месячных взрослых девственных мышей. Ткань рассекали для удаления эндометрия и помещали в HBSS (pH 7,4) с добавлением пенициллина-стрептомицина (Gibco; 100 Ед / мл) и амфотерицина B (Sigma; 2.5 мкг / мл). Затем ткани матки промывали, разрезали на кусочки размером 2–3 мм и расщепляли при 37 ° C в буфере, содержащем 1 мг / мл коллагеназы типа II (Sigma), 0,15 мг / мл ДНКазы I (Roche), 1 мг / мл BSA ( Sigma), 0,1 мг / мл ингибитора трипсина сои (Sigma) и 10% FBS (Gibco). После 30-минутного переваривания смесь растирали в течение 3 минут перед пропусканием через сетчатый фильтр для клеток. Первую перевариваемую смесь отбрасывали. Ткани переваривали еще пять раз, суспензию клеток от каждого переваривания объединяли и центрифугировали для сбора клеток.

Выделение РНК

Общую РНК из матки мыши / стромальных клеток / гладкомышечных клеток выделяли с использованием RNeasy Mini Kit (Qiagen) с расщеплением ДНКазой на колонке в соответствии с инструкциями производителя. РНК количественно определяли с помощью спектрофотометра NanoDrop ND 1000 (NanoDrop Technologies) и хранили при -80 ° C до использования.

Обычная RT – PCR

Уровень мРНК фактора роста фибробластов 10 ( Fgf10 ) анализировали с использованием кДНК стромальных / гладкомышечных клеток с помощью полимеразной цепной реакции с обратной транскрипцией (RT – PCR) с использованием полимеразы JumpStart Taq (Sigma) и ген-специфической праймеры (прямой: 5′-GGATACTGACACATTGTGCCTCAG-3 ‘; обратный: 5′-TGTTTTTTGTCCTCTCCTGGGAG-3’) (Mailleux et al., 2005). ПЦР выполняли при следующих условиях: 95 ° C в течение 5 минут, 40 циклов при 95 ° C в течение 30 секунд, 60 ° C в течение 30 секунд и 72 ° C в течение 1 минуты и дополнительное продление на 10 минут при 72 ° C. . Гипоксантингуанинфосфорибозилтрансферазу ( Hprt ) использовали в качестве внутреннего контроля. Полученный ампликон отделяли и визуализировали на 1% агарозном геле, содержащем бромид этидия. Изображение геля было запечатлено в цифровом виде под УФ-светом, а затем перевернуто для презентации.

Количественная полимеразная цепная реакция в реальном времени

Образцы 200 нг общей РНК с обратной транскриптазой с надстрочным индексом III (Invitrogen) использовали для создания кДНК.КПЦР выполняли на системе обнаружения ПЦР в реальном времени CFX384 / CFX Connect (Bio-Rad) с использованием iTaq Universal SYBR Green Supermix (Bio-Rad) и праймеров для различных Fgfs (таблица). Реакцию проводили при 95 ° C в течение 30 с, 40 циклов при 95 ° C в течение 5 секунд и 60 ° C в течение 30 секунд. Рибосомный белок L19 ( Rpl19 ) был включен в качестве внутреннего контроля. Относительную частоту экспрессии генов рассчитывали, как описано ранее (Livak and Schmittgen, 2001).

Таблица I

Праймеры для количественной ПЦР в реальном времени.

Ссылка FGF1 033892.

CAS Статья PubMed Google ученый

  • 49.

    Монаган П., Мосс Д.: Экспрессия коннексина и щелевые соединения в молочной железе. Cell Biol Int.1996, 20: 121-125. 10.1006 / cbir.1996.0016.

    CAS Статья PubMed Google ученый

  • 50.

    Bry C, Maass K, Miyoshi K, Willecke K, Ott T, Robinson GW, Hennighausen L: потеря коннексина 26 в эпителии молочных желез на ранних сроках, но не на поздних сроках беременности, приводит к незапланированному апоптозу и нарушению развития. Dev Biol. 2004, 267: 418-429. 10.1016 / j.ydbio.2003.11.022.

    CAS Статья PubMed Google ученый

  • 51.

    Имберт А., Элкема Р., Джордан С., Фейнер Х., Ковин П.: Бета-катенин дельты N89 вызывает преждевременное развитие, дифференцировку и неоплазию в молочной железе. J Cell Biol. 2001, 153: 555-568. 10.1083 / jcb.153.3.555.

    CAS Статья PubMed PubMed Central Google ученый

  • 52.

    Teuliere J, Faraldo MM, Deugnier MA, Shtutman M, Ben-Ze’ev A, Thiery JP, Glukhova MA: Целенаправленная активация передачи сигналов бета-катенина в базальных эпителиальных клетках молочной железы влияет на развитие молочной железы и приводит к гиперплазии .Разработка. 2005, 132: 267-277. 10.1242 / dev.01583.

    CAS Статья PubMed Google ученый

  • 53.

    Srivastava S, Matsuda M, Hou Z, Bailey JP, Kitazawa R, Herbst MP, Horseman ND: активатор рецептора индукции лиганда NF-kappaB через Jak2 и Stat5a в эпителиальных клетках молочной железы. J Biol Chem. 2003, 278: 46171-46178. 10.1074 / jbc.M308545200.

    CAS Статья PubMed Google ученый

  • 54.

    Fantl V, Edwards PA, Steel JH, Vonderhaar BK, Dickson C: Нарушение развития молочной железы у мышей Cyl-1 (- / -) во время беременности и кормления грудью автономно от эпителиальных клеток. Dev Biol. 1999, 212: 1-11. 10.1006 / dbio.1999.9329.

    CAS Статья PubMed Google ученый

  • 55.

    Brisken C, Ayyannan A, Nguyen C, Heineman A, Reinhardt F, Jian T, Dey SK, Dotto GP, Weinberg RA, Jan T: IGF-2 является медиатором индуцированного пролактином морфогенеза в груди .Dev Cell. 2002, 3: 877-887. 10.1016 / S1534-5807 (02) 00365-9.

    CAS Статья PubMed Google ученый

  • 56.

    Matsuda M, Imaoka T, Vomachka AJ, Gudelsky GA, Hou Z, Mistry M, Bailey JP, Nieport KM, Walther DJ, Bader M и др .: Серотонин регулирует развитие молочной железы через аутокринно-паракринную петлю . Dev Cell. 2004, 6: 193-203. 10.1016 / S1534-5807 (04) 00022-Х.

    CAS Статья PubMed Google ученый

  • 57.

    Horton JD, Goldstein JL, Brown MS: SREBPs: активаторы полной программы синтеза холестерина и жирных кислот в печени. J Clin Invest. 2002, 109: 1125-1131. 10.1172 / JCI200215593.

    CAS Статья PubMed PubMed Central Google ученый

  • 58.

    Колетта Р.Д., Джедлика П., Гутьеррес-Хартманн А., Форд Х.Л .: Транскрипционный контроль клеточного цикла в развитии молочной железы и туморогенезе. J Mammary Gland Biol Neoplasia.2004, 9: 39-53. 10.1023 / B: JOMG.0000023587.40966.f6.

    Артикул PubMed Google ученый

  • 59.

    Hatsell S, Rowlands T, Hiremath M, Cowin P: Бета-катенин и Tcfs в развитии и раке молочной железы. J Mammary Gland Biol Neoplasia. 2003, 8: 145-158. 10.1023 / А: 1025

    3047.

    Артикул PubMed Google ученый

  • 60.

    Foley J, Dann P, Hong J, Cosgrove J, Dreyer B, Rimm D, Dunbar M, Philbrick W, Wysolmerski J: белок, связанный с паратироидным гормоном, поддерживает судьбу эпителия молочной железы и запускает дифференцировку кожи сосков во время эмбриональной груди. разработка.Разработка. 2001, 128: 513-525.

    CAS PubMed Google ученый

  • 61.

    Murtagh J, Martin F, Gronostajski RM: Семейство генов ядерного фактора I (NFI) в развитии и функционировании молочных желез. J Mammary Gland Biol Neoplasia. 2003, 8: 241-254. 10.1023 / А: 1025

  • 9843.

    Артикул PubMed Google ученый

  • 62.

    Johansson EM, Kannius-Janson M, Gritli-Linde A, Bjursell G, Nilsson J: Ядерный фактор 1-C2 регулируется пролактином и демонстрирует отчетливый паттерн экспрессии в эпителиальных клетках молочной железы мышей во время развития.Мол Эндокринол. 2005, 19: 992-1003. 10.1210 / me.2004-0359.

    CAS Статья PubMed Google ученый

  • 63.

    Desprez PY, Sumida T, Coppe JP: Белки спирали-петля-спираль в развитии молочных желез и раке молочной железы. J Mammary Gland Biol Neoplasia. 2003, 8: 225-239. 10.1023 / А: 1025957025773.

    Артикул PubMed Google ученый

  • 64.

    Мори С., Нисикава С.И., Йокота Y: Дефект лактации у мышей, лишенных ингибитора спираль-петля-спираль Id2.Embo J. 2000, 19: 5772-5781. 10.1093 / emboj / 19.21.5772.

    CAS Статья PubMed PubMed Central Google ученый

  • 65.

    Clarkson RW, Watson CJ: NF-kappaB и апоптоз в эпителиальных клетках молочной железы. J Mammary Gland Biol Neoplasia. 1999, 4: 165-175. 10.1023 / А: 1018725207969.

    CAS Статья PubMed Google ученый

  • 66.

    Гримм С.Л., Розен Дж. М.: Роль C / EBPbeta в развитии молочной железы и раке груди.J Mammary Gland Biol Neoplasia. 2003, 8: 191-204. 10.1023 / А: 10258026.

    Артикул PubMed Google ученый

  • 67.

    Seagroves TN, Lydon JP, Hovey RC, Vonderhaar BK, Rosen JM: C / EBPbeta (CCAAT / связывающий белок энхансер) контролирует определение судьбы клеток во время развития молочной железы. Мол Эндокринол. 2000, 14: 359-368. 10.1210 / me.14.3.359.

    CAS PubMed Google ученый

  • 68.

    Barcellos-Hoff MH, Ewan KB: Преобразование фактора роста бета и рак груди: развитие молочной железы. Рак молочной железы Res. 2000, 2: 92-99. 10.1186 / bcr40.

    CAS Статья PubMed PubMed Central Google ученый

  • 69.

    Grimm SL, Contreras A, Barcellos-Hoff MH, Rosen JM: Дефекты клеточного цикла вносят вклад в блокирование индуцированной гормонами пролиферации молочной железы у мышей с нулевым CCAAT / энхансер-связывающим белком (C / EBPbeta).J Biol Chem. 2005, 280: 36301-36309. 10.1074 / jbc.M508167200.

    CAS Статья PubMed Google ученый

  • 70.

    Курпиос Н.А., Саболич Н.А., Шеперд Т.Г., Фидальго Г.М., Хасселл Дж.А.: Функция факторов транскрипции PEA3 Ets в развитии молочной железы и онкогенезе. J Mammary Gland Biol Neoplasia. 2003, 8: 177-190. 10.1023 / А: 1025948823955.

    Артикул PubMed Google ученый

  • 71.

    Jones FE, Stern DF: Экспрессия доминантно-отрицательного ErbB2 в молочной железе трансгенных мышей показывает его роль в лобулоальвеолярном развитии и лактации. Онкоген. 1999, 18: 3481-3490. 10.1038 / sj.onc.1202698.

    CAS Статья PubMed Google ученый

  • 72.

    Long W, Wagner KU, Lloyd KC, Binart N, Shillingford JM, Hen-nighausen L, Jones FE: Нарушение дифференцировки и лактационная недостаточность молочных желез с дефицитом Erbb4 идентифицируют ERBB4 как обязательного медиатора STAT5.Разработка. 2003, 130: 5257-5268. 10.1242 / dev.00715.

    CAS Статья PubMed Google ученый

  • 73.

    Yang Y, Spitzer E, Meyer D, Sachs M, Niemann C, Hartmann G, Weidner KM, Birchmeier C, Birchmeier W. Последовательная потребность фактора роста гепатоцитов и нейрегулина в морфогенезе и дифференцировке молочной железы . J Cell Biol. 1995, 131: 215-226. 10.1083 / jcb.131.1.215.

    CAS Статья PubMed Google ученый

  • 74.

    Li L, Cleary S, Mandarano MA, Long W, Birchmeier C, Jones FE: протоонкоген груди, HRGalpha, регулирует пролиферацию эпителия и лобулоальвеолярное развитие в молочной железе мыши. Онкоген. 2002, 21: 4900-4907. 10.1038 / sj.onc.1205634.

    CAS Статья PubMed Google ученый

  • 75.

    Luetteke NC, Qiu TH, Fenton SE, Troyer KL, Riedel RF, Chang A, Lee DC: Направленная инактивация генов EGF и амфирегулина выявляет различные роли лигандов рецепторов EGF в развитии молочных желез мышей.Разработка. 1999, 126: 2739-2750.

    CAS PubMed Google ученый

  • 76.

    Zutter MM, Sun H, Santoro SA: Измененная экспрессия интегрина и злокачественный фенотип: вклад множества интегрированных рецепторов интегрина. J Mammary Gland Biol Neoplasia. 1998, 3: 191-200. 10.1023 / А: 10187984.

    CAS Статья PubMed Google ученый

  • 77.

    Li N, Zhang Y, Naylor MJ, Schatzmann F, Maurer F, Wintermantel T, Schuetz G, Mueller U, Streuli CH, Hynes NE: интегрины Beta1 регулируют пролиферацию молочных желез и поддерживают целостность альвеол молочных желез.EMBO J. 2005, 24: 1942-1953. 10.1038 / sj.emboj.7600674.

    CAS Статья PubMed PubMed Central Google ученый

  • 78.

    Naylor MJ, Li N, Cheung J, Lowe ET, Lambert E, Marlow R, Wang P, Schatzmann F, Wintermantel T, Schuetz G и др.: Удаление интегрина β1 в эпителии молочных желез показывает ключевую роль для интеграции в морфогенез и дифференцировку желез. J Cell Biol. 2005, 171: 717-728. 10.1083 / jcb.200503144.

    CAS Статья PubMed PubMed Central Google ученый

  • 79.

    Naylor M, Streuli C: Интегринная регуляция развития молочных желез. Интегрины и развитие. Под редакцией: Данин Э. 2006, Джорджтаун, Техас Landes Bioscience, 176–185.

    Google ученый

  • 80.

    Massague J, Chen YG: Контроль передачи сигналов TGF-бета. Genes Dev. 2000, 14: 627-644.

    CAS PubMed Google ученый

  • 81.

    Ewan KB, Shyamala G, Ravani SA, Tang Y, Akhurst R, Wakefield L, Barcellos-Hoff MH: Скрытая трансформирующая активация фактора роста-бета в молочной железе: регуляция гормонами яичников влияет на пролиферацию протоков и альвеол. Am J Pathol. 2002, 160: 2081-2093.

    CAS Статья PubMed PubMed Central Google ученый

  • 82.

    Ewan KB, Oketch-Rabah HA, Ravani SA, Shyamala G, Moses HL, Barcellos-Hoff MH: пролиферация эстрогеновых альфа-позитивных эпителиальных клеток молочной железы ограничивается трансформирующим фактором роста-бета1 у взрослых мышей. .Am J Pathol. 2005, 167: 409-417.

    CAS Статья PubMed PubMed Central Google ученый

  • 83.

    Sharrocks AD, Brown AL, Ling Y, Yates PR: Семейство факторов транскрипции ETS-домена. Int J Biochem Cell Biol. 1997, 29: 1371-1387. 10.1016 / S1357-2725 (97) 00086-1.

    CAS Статья PubMed Google ученый

  • 84.

    Оикава Т., Ямада Т.: Молекулярная биология транскрипционных факторов семейства Ets.Ген. 2003, 303: 11-34. 10.1016 / S0378-1119 (02) 01156-3.

    CAS Статья PubMed Google ученый

  • 85.

    Oettgen P, Kas K, Dube A, Gu X, Grall F, Thamrongsak U, Akbar-ali Y, Finger E, Boltax J, Endress G и др.: Характеристика ESE-2, новый ESE -1-связанный фактор транскрипции Ets, который ограничен железистым эпителием и дифференцированными кератиноцитами. J Biol Chem. 1999, 274: 29439-29452. 10.1074 / jbc.274.41.29439.

    CAS Статья PubMed Google ученый

  • 86.

    Zhou J, Ng AY, Tymms MJ, Jermiin LS, Seth AK, Thomas RS, Kola I. Новый фактор транскрипции, ELF5, принадлежит к подсемейству ELF генов ETS и отображается на хромосоме 11p13-15 человека. , область, подверженная LOH и перестройке в клеточных линиях карциномы человека. Онкоген. 1998, 17: 2719-2732. 10.1038 / sj.onc.1202198.

    CAS Статья PubMed Google ученый

  • 87.

    Thomas RS, Ng AN, Zhou J, Tymms MJ, Doppler W, Kola I: Эльфийская группа факторов транскрипции, связанных с Ets. ELF3 и ELF5. Adv Exp Med Biol. 2000, 480: 123-128.

    CAS Статья PubMed Google ученый

  • 88.

    Donnison M, Beaton A, Davey HW, Broadhurst R, L’Huillier P, Pfeffer PL: Потеря экстраэмбриональной эктодермы у мутантов Elf5 приводит к дефектам формирования эмбрионального паттерна.

    Leave a Reply

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    2021 © Все права защищены.
  • Имя последовательности (5′-3 ‘)
    Форвард CAGCTCAGTGCGGAAAGTG PrimerBank ID 6753850a1
    Обратный TGTCTGCGAGCCGTATAAAAG
    Fgf2
    Вперед TTGTGTCTATCAAGGGAGTGTGT Takase et al. , (2013)
    Обратный TGCCACATACCAACTGGAGTATT
    Fgf7
    Вперед TTTGGAAAGAGAG326 9GACTase, (2013)
    Обратный GGCAGGATCCGTGTCAGTAT
    Fgf9
    Форвард ATGGCTCCCTTAGGTGAAGTT PrimerBank ID 7305057a1
    Обратный TCATTTAGCAACACCGGACTG
    Fgf10
    Форвард GTTGCTCTTTTTGGTGTCTTCGT N / A
    Обратный GGCCTCCTGTGACACCATGT
    Fgf12
    Форвард ACAGCTCAGATGTTTTTACCCC PrimerBank ID 118129945c2
    Обратный CTGGCGATACAGGGTTGAGG
    Fgf18
    Вперед CCTGCACTTGCCTGTGTTTAC Идентификатор PrimerBank 6679781a1
    Обратный TGCTTCC3CTAC TGCTTCC3CTAC 0003 Rpl19
    Forward ATGAGTATGCTCAGGCTACAGA PrimerBank ID 6677773a1
    Reverse GCATTGGCGATTTCAT 903 Версия 21).Для определения влияния обработки TGFβ1 на экспрессию мРНК Fgf10 выполняли односторонний дисперсионный анализ (ANOVA) с последующим апостериорным тестом Даннета . Сравнение двух средних значений проводилось с использованием критерия Стьюдента t . Данные представлены как среднее значение ± стандартная ошибка среднего (SEM). Статистическая значимость была определена при P <0,05.

    Результаты

    Повышенная пролиферация эпителиальных клеток матки у

    мышей с условной абляцией Tgfbr1

    В раннем исследовании мы получили мышей с условным нокаутом Tgfbr1 с использованием Amhr2 -Cre (Li et al., 2011а). Эти мыши бесплодны из-за развития дивертикулов яйцевода. Первичный дефект матки — нарушение миометрия. Однако дефекты маточных желез и увеличенный размер матки наблюдались у мышей в возрасте Tgfbr1 cKO (Li et al. , 2011a). Эти результаты подняли вопрос о том, как потеря TGFBR1 способствует патологии маточных желез. Наш первоначальный анализ с использованием случайных циклических мышей показал, что TGFBR1 преимущественно локализован в слоях гладких мышц матки (Li et al., 2011а). Дальнейшее окрашивание X-gal с использованием тканей матки с разных стадий эстрального цикла подтвердило преобладающую экспрессию TGFBR1 в миометрии. Окрашивание X-gal в эндометрии, по-видимому, изменялось во время эстральной стадии (рис.). Примечательно, что окрашивание эпителия матки на всех стадиях было незначительным (рис.). Эти результаты предполагают, что железистая патология у мышей Tgfbr1 Amhr2- Cre cKO, вероятно, связана с потерей TGFBR1 в эндометрии.

    Локализация TGFBR1 в матке мышей во время эстрального цикла.( A ) Диструс; ( B ) проэструс; ( C ) течка и ( D ) метэструс. Матки 2–3-месячных мышей, содержащих аллель Tgfbr1 lacZ , обрабатывали для окрашивания X-gal. Срезы контрастировали с быстрым красным для визуализации ядер. Обратите внимание на преобладающее окрашивание X-gal в слоях гладких мышц и различное окрашивание в стромальном компартменте. SM — гладкая мышца; LE, люминальный эпителий; ГЭ — железистый эпителий; Ул., Строма.Шкала шкалы = 50 мкм.

    Затем, чтобы определить статус пролиферации эпителиальных клеток матки, мы выполнили иммунофлуоресцентную микроскопию с использованием Ki67. Поскольку на пролиферацию эпителиальных клеток матки у взрослых мышей влияют стадии эстра и гормоны (Wood et al., 2007), мы сначала сравнили экспрессию Ki67 у Tgfbr1 Amhr2- Cre cKO и контрольных мышей на стадии диэстра, когда пролиферативная активность железистого эпителия матки низкий (Wood et al. , 2007).В то время как низкие уровни окрашивания Ki67 были обнаружены в контроле (рис. A – C), обширные сигналы иммунофлуоресценции для Ki67 наблюдались в эпителии матки мышей Tgfbr1 Amhr2- Cre cKO (рис. D – I).

    Контрольная пролиферация эпителиальных клеток матки и Tgfbr1 Amhr2- Cre cKO uteri. Иммунофлуоресценция Ki67 ( A ; красный) и Ki67 и ACTA2 (зеленый) ( B и C ) с использованием срезов матки от контрольных мышей дикого типа (Ctrl). Иммуноокрашивание Ki67 ( D и G ; красный) и Ki67 и ACTA2 (зеленый) ( E , F , H и I ) с использованием срезов матки от мышей Tgfbr1 Amhr2 -Cre cKO .Образцы матки были собраны у взрослых мышей (возраст ~ 3 месяца) на стадии диэстра. Обратите внимание на обширное иммуноокрашивание Ki67 в эпителиальных клетках мышей Tgfbr1 Amhr2- Cre cKO по сравнению с контрольными. LE, люминальный эпителий; ГЭ — железистый эпителий; St, строма; SM, гладкая мускулатура. Масштабная линейка (50 мкм) типично показана на (A).

    Чтобы исключить потенциальный эффект стероидных гормонов, дополнительно оценивали пролиферацию эпителиальных клеток матки с использованием мышей, у которых за 2 недели до эксперимента были удалены яичники.Чтобы лучше визуализировать эпителиальный компартмент, была проведена двойная иммунофлуоресценция с использованием Ki67 и KRT8, эпителиального маркера. Мы обнаружили усиленную пролиферацию клеток как железистого, так и просветного эпителия у мышей Tgfbr1 Amhr2- Cre cKO, подвергнутых овариэктомии, по сравнению с соответствующими контролями (рис. A – F и I). Отрицательные контроли, в которых антитело Ki67 заменяли нормальными IgG, вызывали фоновое окрашивание (фиг. G и H).

    Повышенная пролиферация эпителиальных клеток при удалении яичников Tgfbr1 Amhr2- Cre cKO uteri.( A F ) Иммунофлуоресценция Ki67 (красный) с использованием срезов матки от овариэктомированных контрольных мышей и мышей Tgfbr1 Amhr2 -Cre cKO. Эпителий матки метили антителом против KRT8 (зеленый). Овариэктомию выполняли на взрослых самках мышей из контрольной группы и группы Tgfbr1 Amhr2- Cre cKO (возраст ~ 3 месяца). Из каждой группы были исследованы три независимых образца и изображены репрезентативные изображения. LE, люминальный эпителий; ГЭ — железистый эпителий; Ул., Строма.( G и H ) Отрицательные контроли, в которых первичные антитела были заменены кроличьими IgG. Масштабная линейка (50 мкм) типично показана на (A). ( I ) Количественное определение Ki67-положительных клеток в железистом и просветном эпителии контрольной и Tgfbr1 Amhr2 -Cre cKO матки. Результаты представлены в виде процентной доли контролей, установленной на 100% ( n = 3 на группу). Данные представляют собой среднее значение ± стандартная ошибка среднего. * P <0,05 по сравнению с соответствующими контролями.

    Кистозное расширение маточных желез у мышей в возрасте

    Tgfbr1 Amhr2- Cre cKO

    В соответствии с усиленной пролиферацией эпителиальных клеток матки, наблюдаемой у мышей Tgfbr1 Amhr2 -Cre cKO, кистозное расширение маточных желез было заметным в 8-месячном возрасте. -старый Tgfbr1 Amhr2- Самки Cre cKO (рис.). В отличие от контроля (Рис. A), Tgfbr1 Amhr2- Cre cKO uteri содержали обильные кистозные и нерегулярные железы (Рис. B), которые состояли из отдельных слоев уплощенных эпителиальных клеток. По сравнению с маточными железами в контрольной матке (рис. C и D), потеря промежуточной стромы между железами иногда обнаруживалась в матках мышей Tgfbr1 Amhr2- Cre cKO (рис. E и F). В тяжелых случаях пролиферация эпителиальных клеток сопровождалась потерей нормальной клеточной морфологии, ядерной полярности и границы базальной мембраны (рис.А и Б). Внутри некоторых маточных желез могут быть идентифицированы Ki67-положительные клетки, идентичность которых неизвестна (рис. B и D). Другое интересное открытие заключается в том, что виментин был локализован в некоторых эпителиальных клетках внутри субнабора эндометриальных желез (Рис. I – N), чего не наблюдалось в контрольной матке (Рис. O – T). Исследования двойной иммунофлуоресценции с использованием KRT8 и виментина выявили ядерную локализацию виментина внутри некоторых эпителиальных клеток (рис. I – N), но значение этого неизвестно.

    Дефекты желез наблюдаются у мышей в возрасте Tgfbr1 Amhr2 -Cre cKO. ( A и B ) У мышей Tgfbr1 Amhr2- Cre cKO развиваются кистозные железы (B; красные стрелки) по сравнению с контрольной группой того же возраста (A). ( C F ) Потеря промежуточной стромы между маточными железами (красные звездочки) у мышей Tgfbr1 Amhr2- Cre cKO (E и F) в отличие от контроля (C и D). Образцы матки были взяты у 8-месячных мышей с произвольным циклическим циклом и мышей Tgfbr1 Amhr2- Cre cKO ( n = 3 на группу).Антитела против KRT8 (A и B) и против VIM (C – F) были использованы для мечения эпителиальных клеток матки и мезенхимальных клеток соответственно. (D) и (F) — изображения с более высоким увеличением для (C) и (E) соответственно. LE, люминальный эпителий; ГЭ — железистый эпителий; St, строма; Мио, миометрий. Масштабная линейка = 20 мкм (D и F) и 200 мкм (A, B, C и E).

    Поражения эпителиальных клеток у мышей Tgfbr1 Amhr2- Cre cKO. ( A D ) Иммунофлуоресцентное окрашивание срезов матки с использованием антител, направленных против KRT8 (зеленый) и Ki67 (красный) у старых контрольных мышей и мышей Tgfbr1 Amhr2- Cre cKO.( E и F ) Репрезентативная контрольная матка, окрашенная KRT8 и Ki67. Масштабная линейка = 25 мкм (A – F). ( G T ) Иммунофлуоресценция KRT8 (зеленый) и FOXA2 (красный; G и H) или виментина (красный; I – T) в матке мышей в возрасте Tgfbr1 Amhr2- Cre cKO. Шесть мышей Tgfbr1 Amhr2 -Cre cKO в возрасте от 9 до 10,5 месяцев анализировали с помощью иммунофлуоресценции или иммуногистохимии. Дефекты эпителиальных клеток наблюдались у всех мышей, а локализация виментина в эпителиальных клетках наблюдалась у трех мышей.Представлены репрезентативные изображения 10,5-месячной матки Tgfbr1 Amhr2 -Cre cKO. (L – N) и (R – T) — изображения с более высоким увеличением для выбранных областей (I – K) и (O – Q), соответственно. Стрелки (L – N) указывают на локализацию виментина в KRT8-положительных эпителиальных клетках. УГ — маточная железа; St, строма; КГ — кистозная железа эндометрия; ГЭ, железистый эпителий. Масштабная шкала типично показана на (G) и равна 10 мкм (G и H, L – N и R – T) и 20 мкм (I – K и O – Q).

    Кроме того, мы обнаружили, что экспрессия FOXA2, ключевого регулятора развития маточных желез и женской фертильности (Bazer, 2010; Jeong et al., 2010), отсутствовал в подмножестве эндометриальных желез (рис. G, H и рис.), Особенно кистозно-расширенных желез в матке старых мышей (8–10,5 месяцев; рис. D – I), по сравнению с элементы управления (рис. A – C).

    Изменение экспрессии FOXA2 в железах эндометрия у мышей Tgfbr1 Amhr2 -Cre cKO. ( A I ) Иммунофлуоресцентное окрашивание мышей KRT8 (зеленый) и FOXA2 (красный) в контроле (A – C; 8 месяцев) и Tgfbr1 Amhr2- мышей Cre cKO в возрасте 8 лет (D –F) и 10.5 (G – I) месяцев. Желтые стрелки указывают на железистый эпителий. Пунктирными линиями (D – I) обозначены кистозно расширенные железы. Обратите внимание на отсутствие FOXA2 в кистозных железах (D – I) и железах эндометрия, отмеченных звездочками (F и I). ГЭ — железистый эпителий; LE, люминальный эпителий; St, строма; КГ, кистозная железа эндометрия. Масштабная линейка (50 мкм) типично показана на (A).

    Возможное участие TGFBR1-опосредованной паракринной передачи сигналов в пролиферации эпителиальных клеток матки

    Поскольку окрашивание X-gal наблюдалось в эндометрии, а Amhr2, -Cre также экспрессируется в строме матки (Petit et al., 2007), усиленная пролиферация эпителиальных клеток матки у мышей Tgfbr1 Amhr2- Cre cKO, вероятно, вызывается измененными эпителиально-мезенхимальными взаимодействиями в результате потери TGFBR1 в мезенхимальном компартменте матки. В поддержку этой гипотезы мы обнаружили, что экспрессия Fgf10 была значительно увеличена в матке Tgfbr1 Amhr2 -Cre cKO (Fig.). FGFs являются известными митогенами эпителиальных клеток матки (Li et al. , 2011b). ОТ-ПЦР показала, что транскрипт Fgf10 экспрессируется в стромальных клетках матки с незначительной экспрессией в гладкомышечных клетках (рис.А). Отрицательные контроли без обратной транскриптазы не смогли амплифицировать целевую полосу Fgf10 (рис. A). Дальнейший анализ, проведенный с использованием овариэктомированных мышей, подтвердил, что уровни мРНК Fgf10 и были выше у мышей Tgfbr1 Amhr2- Cre cKO по сравнению с контрольными мышами (рис. B). Существенных изменений уровней транскрипции для ряда других Fgfs , в том числе Fgf1 , Fgf2 , Fgf7 , Fgf9 , Fgf12 и Fgf18 , не обнаружено (рис.Б). Чтобы подтвердить этот вывод, мы обработали первичные стромальные клетки матки TGF-β1 (0,1, 1, 2,5, 5 и 10 нг / мл) и определили его влияние на экспрессию мРНК Fgf10 . КПЦР продемонстрировала, что уровни мРНК Fgf10 были значительно снижены после обработки TGF-β1 (фиг. C). Эти результаты в совокупности предполагают потенциальное участие TGFBR1-опосредованной передачи сигналов в регуляции функции эпителиальных клеток матки.

    Повышенные уровни мРНК Fgf10 в матке мышей Tgfbr1 Amhr2 -Cre cKO.( A ) ОТ-ПЦР-амплификация Fgf10 в стромальных клетках матки и гладкомышечных клетках. Обратите внимание, что Fgf10 легко обнаруживается в стромальных клетках матки. В отрицательных контролях не было обнаружено целевой полосы. Hprt был включен в качестве внутреннего контроля. SC — стромальные клетки; SMC, гладкомышечные клетки; Отрицательный, отрицательный контроль без обратной транскриптазы. ( B ) Экспрессия мРНК Fgf10 была увеличена в подвергнутой овариэктомии матке Tgfbr1 Amhr2 -Cre cKO среди исследованных Fgfs по сравнению с соответствующими контролями. n = 5 на группу. OVX, овариэктомия. ( C ) Fgf10 Обилие мРНК было снижено в стромальных клетках матки, обработанных TGF-β1 (0,1–10 нг / мл) в течение 20 часов по сравнению с контролем. Было проведено три независимых эксперимента с клеточными культурами. Данные представляют собой среднее значение ± стандартная ошибка среднего. * P <0,05.

    Обсуждение

    Гиперплазия эндометрия, предраковое поражение рака эндометрия, является случайной причиной репродуктивных нарушений. Патогенез гиперплазии эндометрия до конца не изучен.В матке неконтролируемая пролиферация эпителиальных клеток влияет на функцию матки и беременность, что приводит к патологическим состояниям, таким как гиперплазия эндометрия, которые отрицательно влияют на репродуктивный потенциал. Передача сигналов суперсемейства TGFβ регулирует фундаментальные клеточные функции (Massague, 1990, 1998, 2000; Chang et al. , 2002) и незаменима для репродукции самок (Dong et al. , 1996; Galloway et al. , 2000; Tomic et al., 2004; Hashimoto et al., 2005; Джунгель и МакНатти, 2005; Diaz et al. , 2007; Dragovic et al. , 2007; Ли и др. , 2008, 2011а; Pangas et al. , 2008 г .; Гонг и МакГи, 2009 г .; Эдсон и др. , 2010 г .; Gao et al. , 2013; Nagashima et al. , 2013). Нарушение регуляции передачи сигналов TGFβ приводит к нарушению репродуктивной функции и может вызывать развитие рака (Matzuk et al. , 1992; Pangas et al. , 2008; Middlebrook et al., 2009 г .; Эдсон и др. , 2010). Используя установленную модель на мышах, это исследование предоставляет новые доказательства, подтверждающие потенциальное участие TGFBR1 в регуляции функции эпителиальных клеток матки. Эти результаты помогут понять сложные тканевые / клеточно-специфические функции передачи сигналов TGFβ в одном из наиболее важных женских репродуктивных органов, матке.

    Поскольку начало развития маточных желез (т. Е. Аденогенез), по-видимому, обычно происходит у мышей Tgfbr1 Amhr2- Cre cKO во время раннего постнатального развития матки (Gao et al., 2014), проявление эпителиальной аномалии у самок Tgfbr1 Amhr2- Cre cKO, вероятно, является вторичным эффектом, который не связан с прямым нарушением сигнального аппарата TGFβ в эпителиальном компартменте. Это предположение было основано на следующих доказательствах: (i) окрашивание X-gal показало минимальную экспрессию TGFBR1 в эпителии матки во время эстральных циклов, и (ii) Amhr2 -Cre не ожидается экспрессии в эпителиальном компартменте матки на основании данных. с использованием мышей Amhr2 lacZ (Arango et al., 2008). Таким образом, можно предположить, что условная делеция Tgfbr1 может увеличивать продукцию факторов, происходящих из стромальных клеток, которые способствуют пролиферации эпителиальных клеток матки или ухудшают экспрессию факторов, ингибирующих пролиферацию клеток. В подтверждение первой возможности мы обнаружили, что содержание мРНК Fgf10 было значительно повышено в Tgfbr1 Amhr2- Cre cKO uteri. FGF10 регулирует миграцию клеток (Tao et al. , 2005; Nomura et al., 2008) и пролиферации, и экспрессируется в эндометрии овцы (Satterfield et al. , 2008). Экспрессия транскриптов Fgf10 в стромальных клетках матки мышей была подтверждена в текущем исследовании. Следует отметить, что поскольку первичный фенотип, наблюдаемый у мышей Tgfbr1 Amhr2 -Cre cKO, представляет собой нарушение образования гладких мышц, потенциальный вклад дефекта миометрия, передачи сигналов гормонов, а также других факторов роста в развитие этой патологии матки требует дальнейшего изучения. .

    Tgfbr1 Amhr2- Cre cKO у мышей развиваются дивертикулы яйцевода, которые препятствуют транспортировке эмбриона в матку для имплантации, что приводит к бесплодию самок (Li et al. , 2011a). Однако неясно, может ли матка мышей Tgfbr1 Amhr2- Cre cKO поддерживать беременность. Эндометрий играет ключевую роль в приеме и вынашивании эмбрионов и имеет первостепенное значение для женской фертильности. Нормальная функция просветного эпителия имеет решающее значение для прикрепления и имплантации эмбриона (Li et al., 2011b). Выделения из эпителия матки, такие как фактор ингибирования лейкемии (Stewart et al. , 1992) и муцин 1 (Thathiah and Carson, 2002), играют важную роль во время беременности. Между тем, железы эндометрия являются важным источником питательных веществ и факторов роста для успешного наступления беременности (Spencer et al. , 2012). Действительно, эпителий матки — это места для продукции TGF-β, которые потенциально могут воздействовать на эмбрион и эндометрий во время беременности (Shooner et al., 2005; Джонс и др. , 2006). В качестве дополнительного доказательства изменения развития / функции эндометриальных желез у мышей в возрасте Tgfbr1 Amhr2- Cre cKO мы обнаружили, что FOXA2 отсутствовал в подмножестве маточных желез, включая кистозные железы эндометрия. Было хорошо установлено, что FOXA2 является важным регулятором развития эндометриальных желез, а потеря FOXA2 во время развития матки резко снижает образование эндометриальных желез, делая самок мышей бесплодными (Bazer, 2010; Jeong et al., 2010 г .; Filant et al. , 2012). Кажется нелогичным, что FOXA2 отсутствовал в некоторых железах эндометрия у мышей в возрасте Tgfbr1 Amhr2 -Cre cKO, поскольку экспрессия FOXA2 была положительно связана с гиперплазией эндометрия в недавнем исследовании (Villacorte et al. , 2013). Одно правдоподобное объяснение состоит в том, что некоторые из расширенных желез состоят из просветного эпителия. С другой стороны, отсутствие FOXA2 в некоторых железистых эпителиях может быть необратимым следствием развития определенных кистозных / гиперпластических желез.Однако необходимы дальнейшие исследования для рассмотрения этих возможностей.

    Основываясь на измененных свойствах эпителиальных клеток матки, мы предсказали, что условная делеция Tgfbr1 в мезенхимальном компартменте матки будет пагубной для беременности, потенциально влияя на имплантацию и / или развитие эмбриона. Наш предварительный эксперимент по переносу эмбрионов показал, что мышей Tgfbr1 Amhr2- Cre cKO были неспособны к установлению беременности с успешным исходом, когда эмбрионы дикого типа были перенесены в матки этих мышей (Гао и Ли, неопубликованные наблюдения).Это открытие предполагает, что, хотя бесплодие у мышей Tgfbr1 Amhr2- Cre cKO предрасположено к развитию дивертикулов яйцевода, дефекты матки также могут приводить к репродуктивной недостаточности, даже если дефицит яйцевода обходится.

    Клинически гиперплазия эндометрия является причиной аномального маточного кровотечения и нарушений фертильности (Курман и др. , 1985; Шаттер и Райт, 2005; Лейси и Чиа, 2009; Хан и др. , 2010). Генетические изменения, включая мутации опухолевого супрессора фосфатазы и гомолога тензина ( Pten ), связаны с гиперплазией эндометрия (Stambolic et al., 2000; Милам и др. , 2008). Гиперплазия эндометрия — это предраковое поражение карциномы эндометрия (Montgomery et al. , 2004), распространенной злокачественной опухоли, от которой пострадали более 49 000 женщин и в 2013 г. умерло более 8000 человек (Siegel et al. , 2013). Этиология рака эндометрия четко не определена. Элегантные исследования продемонстрировали, что передача сигналов TGFβ инактивирована при раке эндометрия (Parekh et al. , 2002; Lecanda et al. , 2007).Хотя предполагаемая роль передачи сигналов TGFβ в патогенезе рака эндометрия была предложена более десяти лет назад (Gold and Parekh, 1999), функция передачи сигналов TGFβ при раке эндометрия остается неясной во многих аспектах; надежные генетические доказательства, подтверждающие передачу сигналов TGFβ в этиологии рака эндометрия, отсутствуют. В этом исследовании мы наблюдали патологию матки, напоминающую гиперплазию эндометрия, у мышей Tgfbr1 Amhr2- Cre cKO в возрасте лет. Эти результаты предполагают, что TGFBR1 является потенциальным компонентом патогенной сети гиперплазии эндометрия, фактора риска карциномы эндометрия.Таким образом, эта модель может быть дополнительно использована для понимания механизмов широкого спектра состояний матки, которые несут аналогичные клеточные и молекулярные изменения в эпителиальных клетках, выявленные в текущем исследовании.

    Заключение

    TGFBR1-опосредованная передача сигналов потенциально участвует в регуляции пролиферации эпителиальных клеток матки. Это исследование предоставляет генетические доказательства, подтверждающие роль пролиферации эпителиальных клеток матки в патогенезе гиперплазии эндометрия.

    Авторские роли

    Ю.Г. и С. проводил эксперименты. Ю.Г. и Q.L. разработал исследование и проанализировал данные. Все авторы внесли свой вклад в подготовку рукописи.

    Финансирование

    Это исследование поддержано грантом Национальных институтов здравоохранения (R21HD073756 для QL) Национального института здоровья детей и развития человека Юнис Кеннеди Шрайвер, наградой Ralph E. Powe Junior Faculty Enhancement Awards (для QL) от Oak Университеты, связанные с Риджем, и фонды для открытия новых факультетов (до К.L.) и награду за исследования аспиранта Колледжа ветеринарной медицины (Y.G.) Техасского университета A&M. S.L. частично поддерживается стипендией Китайского совета по стипендиям.

    Благодарности

    Мы благодарим доктора Мартина Мацука за щедрую поддержку и помощь с импортом мышей Tgfbr1 и доктора Ричарда Берингера за предложение мышей Amhr2 -Cre. Мы благодарны докторам Роберту Бургхардту и Кайле Бэйлесс за полезные обсуждения.

    Ссылки

    • Аранго Н.А., Кобаяши А., Ван И, Джамин С.П., Ли Х.Х., Орвис Г.Д., Берингер Р.Р.Мезенхимальная перспектива дифференцировки и регрессии мюллерова протока у мышей Amhr2-lacZ. Mol Reprod Dev. 2008. 75: 1154–1162. [PubMed] [Google Scholar]
    • Attisano L, Wrana JL. Передача сигнала суперсемейством TGF-бета. Наука. 2002; 296: 1646–1647. [PubMed] [Google Scholar]
    • Bazer FW. Аденогенез матки и беременность: множественные роли foxa2 у мышей. Биол Репрод. 2010; 83: 319–321. [PubMed] [Google Scholar]
    • Чанг Х., Браун С.В., Мацук М.М. Генетический анализ суперсемейства трансформирующего фактора роста-β млекопитающих.Endocr Rev.2002; 23: 787–823. [PubMed] [Google Scholar]
    • Чен Л., Белтон Р.Дж., Новак Р.А. Базигино-опосредованные изменения экспрессии генов в стромальных клетках матки мышей во время имплантации. Эндокринология. 2009; 150: 966–976. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Daikoku T, Tranguch S, Friedman DB, Das SK, Smith DF, Dey SK. Протеомный анализ идентифицирует иммунофилин FK506-связывающий белок 4 (FKBP52) в качестве нижестоящей мишени Hoxa10 в периимплантационной матке мыши. Мол Эндокринол.2005. 19: 683–697. [PubMed] [Google Scholar]
    • Дэвис Б.Н., Хильярд А.С., Лагна Г., Хата А. Белки SMAD контролируют созревание микроРНК, опосредованное DROSHA. Природа. 2008. 454: 56–61. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Davis BN, Hilyard AC, Nguyen PH, Lagna G, Hata A. Белки SMAD связывают консервативную последовательность РНК, способствуя созреванию микроРНК под действием Дроша. Mol Cell. 2010. 39: 373–384. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Дей С.К., Лим Х., Дас С.К., Риз Дж., Париа BC, Дайкоку Т., Ван Х.Молекулярные сигналы к имплантации. Endocr Rev.2004; 25: 341–373. [PubMed] [Google Scholar]
    • Диас Ф. Дж., Вигглсворт К., Эппиг Дж. Дж. Ооциты определяют происхождение кумулюсных клеток в фолликулах яичников мыши. J Cell Sci. 2007; 120: 1330–1340. [PubMed] [Google Scholar]
    • Донг Дж., Альбертини Д.Ф., Нисимори К., Кумар Т.Р., Лу Н., Мацук М.М. Фактор дифференцировки роста-9 необходим на раннем этапе фолликулогенеза яичников. Природа. 1996; 383: 531–535. [PubMed] [Google Scholar]
    • Драгович Р.А., Риттер Л.Дж., Шульц С.Дж., Амато Ф., Томпсон Дж.Г., Армстронг Д.Т., Гилкрист РБ.Активация секретируемого ооцитами фактора передачи сигналов SMAD 2/3 позволяет инициировать экспансию кумулюсных клеток мыши. Биол Репрод. 2007. 76: 848–857. [PubMed] [Google Scholar]
    • Эдсон М.А., Налам Р.Л., Клементи С., Франко Х.Л., Демайо Ф.Дж., Лион К.М., Пангас С.А., Мацук М.М. BMPR1A и BMPR1B, экспрессируемые клетками гранулезы, обладают уникальными функциями в регулировании фертильности, но действуют избыточно, подавляя развитие опухоли яичников. Мол Эндокринол. 2010; 24: 1251–1266. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Filant J, Zhou HJ, Spencer TE.Прогестерон подавляет развитие маточных желез в матке новорожденных мышей. Биол Репрод. 2012; 86: 1–9. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Галлоуэй С.М., МакНатти К.П., Кэмбридж Л.М., Лайтинен М.П., ​​Джунгель Дж. Л., Джокиранта Т.С., Макларен Р.Дж., Луиро К., Доддс К.Г., Монтгомери Г.В. и др. Мутации в гене фактора роста, полученного из ооцитов (BMP15), вызывают повышенную скорость овуляции и бесплодие в зависимости от дозировки. Нат Жене. 2000. 25: 279–283. [PubMed] [Google Scholar]
    • Гао Й, Вэнь Х, Ван Ц., Ли К.SMAD7 противодействует ключевой передаче сигналов суперсемейства TGFβ в клетках гранулезы мыши in vitro. Репродукция. 2013; 146: 1–11. [PubMed] [Google Scholar]
    • Gao Y, Bayless KJ, Li Q. TGFBR1 необходим для развития миометрия мыши. Мол Эндокринол. 2014. 28: 380–394. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Gold LI, Parekh TV. Потеря регуляции роста путем трансформации фактора роста-бета (TGF-бета) при раке человека: исследования карциномы эндометрия. Semin Reprod Endocr. 1999; 17: 73–92.[PubMed] [Google Scholar]
    • Гонг Х, МакГи Э.А. Smad3 необходим для нормальной чувствительности фолликулярного фолликулостимулирующего гормона у мышей. Биол Репрод. 2009. 81: 730–738. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Hahn HS, Chun YK, Kwon YI, Kim TJ, Lee KH, Shim JU, Mok JE, Lim KT. Сопутствующий рак эндометрия после гистерэктомии по поводу атипичной гиперплазии эндометрия. Eur J Obstet Gyn R B. 2010; 150: 80–83. [PubMed] [Google Scholar]
    • Хашимото О., Мур Р.К., Шимасаки С.Посттрансляционный процессинг BMP-15 мыши и человека: потенциальное влияние на определение квоты овуляции. Proc Natl Acad Sci USA. 2005. 102: 5426–5431. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Джамин С.П., Аранго Н.А., Мишина Ю., Хэнкс М.С., Берингер Р.Р. Необходимость Bmpr1a для регрессии мюллерова протока во время полового развития самцов. Нат Жене. 2002; 32: 408–410. [PubMed] [Google Scholar]
    • Jeong JW, Kwak I, Lee KY, Kim TH, Large MJ, Stewart CL, Kaestner KH, Lydon JP, DeMayo FJ.Foxa2 необходим для развития эндометриальных желез и фертильности мышей. Биол Репрод. 2010; 83: 396–403. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Джонс Р.Л., Стойкос С., Финдли Дж. К., Саламонсен Л.А. Экспрессия суперсемейства TGF-бета и действия в эндометрии и плаценте. Репродукция. 2006. 132: 217–232. [PubMed] [Google Scholar]
    • Джунгель Дж. Л., МакНатти К.П. Роль белков суперсемейства трансформирующих факторов роста-бета во внутриовариальной регуляции развития фолликулов.Обновление Hum Reprod. 2005. 11: 144–161. [PubMed] [Google Scholar]
    • Курман Р.Дж., Камински П.Ф., Норрис Х.Дж. Поведение при гиперплазии эндометрия. Долгосрочное исследование «нелеченой» гиперплазии у 170 пациентов. Рак. 1985; 56: 403–412. [PubMed] [Google Scholar]
    • Лэйси Дж. В., Чиа В. М.. Гиперплазия эндометрия и риск развития рака. Maturitas. 2009; 63: 39–44. [PubMed] [Google Scholar]
    • Ларссон Дж., Гуманс М.Дж., Шостранд Л.Дж., ван Ройен М.А., Уорд Д., Левин П., Сюй Х, тен Дейк П., Муммери К.Л., Карлссон С.Аномальный ангиогенез, но сохраненный гематопоэтический потенциал у мышей с дефицитом рецептора TGF-бета типа I. EMBO J. 2001; 20: 1663–1673. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Lecanda J, Parekh TV, Gama P, Lin K, Liarski V, Uretsky S, Mittal K, Gold LI. Трансформирующий бета-фактор роста, эстроген и прогестерон сходятся в регуляции p27Kip1 в нормальном и злокачественном эндометрии. Cancer Res. 2007. 67: 1007–1018. [PubMed] [Google Scholar]
    • Ли К.Ю., Чжон Дж. У., Ван Дж., Ма Л., Мартин Дж. Ф., Цай С. Ю., Лайдон Дж. П., ДеМайо Ф. Дж.Bmp2 имеет решающее значение для децидуальной реакции матки мышей. Mol Cell Biol. 2007. 27: 5468–5478. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Li Q, Pangas SA, Jorgez CJ, Graff JM, Weinstein M, Matzuk MM. Избыточная роль SMAD2 и SMAD3 в клетках гранулезы яичников in vivo. Mol Cell Biol. 2008. 28: 7001–7011. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Li Q, Agno JE, Edson MA, Nagaraja AK, Nagashima T., Matzuk MM. Бета-рецептор трансформирующего фактора роста 1 типа важен для целостности и функции женских репродуктивных путей.PLoS Genet. 2011a; 7: e1002320. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Li Q, Kannan A, DeMayo FJ, Lydon JP, Cooke PS, Yamagishi H, Srivastava D, Bagchi MK, Bagchi IC. Антипролиферативное действие прогестерона на эпителий матки опосредуется Hand2. Наука. 2011b; 331: 912–916. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Ливак К.Дж., Шмитген Т.Д. Анализ данных относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метода 2 (-Delta Delta C (T)). Методы.2001; 25: 402–408. [PubMed] [Google Scholar]
    • Mailleux AA, Kelly R, Veltmaat JM, De Langhe SP, Zalfran S, Thiery JP, Bellusci S. Экспрессия Fgf10 определяет парабронхиальных предшественников гладкомышечных клеток и необходима для их проникновения в гладкомышечные клетки происхождение. Разработка. 2005. 132: 2157–2166. [PubMed] [Google Scholar]
    • Massague J. Семейство трансформирующих факторов роста бета. Annu Rev Cell Biol. 1990; 6: 597–641. [PubMed] [Google Scholar]
    • Massague J. Передача сигнала TGF-бета.Анну Рев Биохим. 1998. 67: 753–791. [PubMed] [Google Scholar]
    • Massague J. Как клетки читают сигналы TGF-бета. Nat Rev Mol Cell Biol. 2000; 1: 169–178. [PubMed] [Google Scholar]
    • Massague J. Передача сигналов TGFβ в контексте. Nat Rev Mol Cell Biol. 2012; 13: 616–630. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Matzuk MM, Finegold MJ, Su JG, Hsueh AJ, Bradley A. Альфа-ингибин — это ген-супрессор опухолей со специфичностью для гонад у мышей. Природа. 1992; 360: 313–319. [PubMed] [Google Scholar]
    • Миддлбрук Б.С., Элдин К., Ли Х, Шивасанкаран С., Пангас С.А.У мышей с условным нокаутом яичников Smad1-Smad5 развивается профиль заболевания, подобный ювенильной форме опухолей гранулезных клеток человека. Эндокринология. 2009; 150: 5208–5217. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Milam MR, Soliman PT, Chung LH, Schmeler KM, Bassett RL, Broaddus RR, Lu KH. Потеря фосфатазы и гомолога тензина, удаленного на хромосоме 10, и фосфорилирование рапамицина-мишени млекопитающих связаны с резистентной к прогестерону гиперплазией эндометрия. Int J Gynecol Cancer.2008. 18: 146–151. [PubMed] [Google Scholar]
    • Mills AM, Longacre TA. Гиперплазия эндометрия. Semin Diagn Pathol. 2010; 27: 199–214. [PubMed] [Google Scholar]
    • Montgomery BE, Daum GS, Dunton CJ. Гиперплазия эндометрия: обзор. Obstet Gynecol Surv. 2004. 59: 368–378. [PubMed] [Google Scholar]
    • Нагашима Т., Ли К., Клементи К., Лайдон Дж. П., Демайо Ф. Дж., Мацук М. М.. BMPR2 необходим для постимплантационной функции матки и поддержания беременности. J Clin Invest. 2013; 123: 2539–2550.[Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Номура С., Ёситоми Х., Такано С., Шида Т., Кобаяси С., Оцука М., Кимура Ф., Симидзу Х., Йошидоме Х, Като А. и др. Сигнал FGF10 / FGFR2 индуцирует миграцию клеток и инвазию при раке поджелудочной железы. Br J Рак. 2008. 99: 305–313. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Pangas SA, Li X, Umans L, Zwijsen A, Huylebroeck D, Gutierrez C, Wang D, Martin JF, Jamin SP, Behringer RR и др. Условная делеция Smad1 и Smad5 в соматических клетках гонад самцов и самок приводит к развитию метастатических опухолей у мышей.Mol Cell Biol. 2008. 28: 248–257. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Parekh TV, Gama P, Wen X, Demopoulos R, Munger JS, Carcangiu ML, Reiss M, Gold LI. Передача сигналов трансформирующего фактора роста бета отключается на ранних стадиях канцерогенеза эндометрия человека, что сопровождается потерей ингибирования роста. Cancer Res. 2002; 62: 2778–2790. [PubMed] [Google Scholar]
    • Пети Ф.Г., Джамин С.П., Курихара И., Берингер Р.Р., ДеМайо Ф.Дж., Цай М.-Дж., Цай С.Ю. Делеция орфанного ядерного рецептора COUP-TFII в матке приводит к плацентарной недостаточности.Proc Natl Acad Sci USA. 2007. 104: 6293–6298. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Renthal NE, Chen CC, Williams KC, Gerard RD, Prange-Kiel J, Mendelson CR. Семейство miR-200 и мишени, ZEB1 и ZEB2, модулируют покой и сократимость матки во время беременности и родов. Proc Natl Acad Sci USA. 2010; 107: 20828–20833. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Саттерфилд М.С., Хаяши К., Сонг Джи, Блэк С.Г., Базер Ф.В., Спенсер Т.Э. Прогестерон регулирует FGF10, MET, IGFBP1 и IGFBP3 в эндометрии матки овцы.Биол Репрод. 2008. 79: 1226–1236. [PubMed] [Google Scholar]
    • Shi Y, Massague J. Механизмы передачи сигналов TGF-бета от клеточной мембраны к ядру. Клетка. 2003. 113: 685–700. [PubMed] [Google Scholar]
    • Шунер С., Карон П.Л., Фрешетт-Фригон Г., Леблан В., Дери М.С., Асселин Е. Экспрессия TGF-бета во время беременности крыс и активность в отношении выживаемости децидуальных клеток. Репрод Биол Эндокринол. 2005; 3:20. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Shutter J, Wright TC. Распространенность основной аденокарциномы у женщин с атипичной гиперплазией эндометрия.Int J Gynecol Pathol. 2005; 24: 313–318. [PubMed] [Google Scholar]
    • Шинлова О.П., Ольденхоф А.Д., Лю М.Ю., Лангиль Л., Лай С.Дж. Регулирование экспрессии c-fos статическим растяжением в гладкомышечных клетках миометрия крысы. Am J Obstet Gynecol. 2002; 186: 1358–1365. [PubMed] [Google Scholar]
    • Сигел Р., Найшадхам Д., Джемаль А. Статистика рака, 2013. CA Cancer J Clin. 2013; 63: 11–30. [PubMed] [Google Scholar]
    • Спенсер Т.Э., Данлэп К.А., Филант Дж. Сравнительная биология развития матки: понимание механизмов и нарушений развития.Mol Cell Endocrinol. 2012; 354: 34–53. [PubMed] [Google Scholar]
    • Стамболик В., Цао М. С., Макферсон Д., Сузуки А., Чепмен В. Р., Мак Т. В.. Высокая частота неоплазии груди и эндометрия, напоминающей синдром Каудена человека, у мышей pten +/-. Cancer Res. 2000. 60: 3605–3611. [PubMed] [Google Scholar]
    • Стюарт К.Л., Каспар П., Брюнет Л.Дж., Бхатт Х., Гади И., Контген Ф., Аббонданцо С.Дж. Имплантация бластоцисты зависит от материнской экспрессии фактора ингибирования лейкемии. Природа. 1992; 359: 76–79. [PubMed] [Google Scholar]
    • Такахаши Т., Эйцман Б., Боссерт Н.Л., Уолмер Д., Воробей К., Фландерс К.С., Маклахлан Дж., Нельсон К.Г.Трансформирующие факторы роста бета-1, бета-2 и бета-3 матричная РНК и экспрессия белка в матке и влагалище мышей во время индуцированного эстрогеном роста — сравнение с другими регулируемыми эстрогеном генами. Рост клеток различается. 1994; 5: 919–935. [PubMed] [Google Scholar]
    • Takase HM, Itoh T, Ino S, Wang T, Koji T, Akira S, Takikawa Y, Miyajima A. FGF7 — это сигнал функциональной ниши, необходимый для стимуляции клеток-предшественников печени взрослых, которые поддерживают печень регенерация. Genes Dev. 2013; 27: 169–181. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Тао Х, Симидзу М., Кусумото Р., Оно К., Нодзи С., Охучи Х.Двойная роль FGF10 в пролиферации и координированной миграции эпителиальных клеток ведущего края во время развития века у мышей. Разработка. 2005. 132: 3217–3230. [PubMed] [Google Scholar]
    • Thathiah A, Carson DD. Прикрепление муцинов и бластоцисты. Rev Endocr Metab Disord. 2002; 3: 87–96. [PubMed] [Google Scholar]
    • Томич Д., Миллер К.П., Кенни Х.А., Вудрафф Т.К., Хойер П., Флауз Дж. Для развития фолликула яичника требуется Smad3. Мол Эндокринол. 2004. 18: 2224–2240. [PubMed] [Google Scholar]
    • Виллакорте М., Сузуки К., Хирасава А., Окава Ю., Суяма М., Маруяма Т., Аоки Д., Огино Ю., Миягава С., Терабаяси Т. и др.Передача сигналов β-катенина регулирует экспрессию Foxa2 во время формирования гиперплазии эндометрия. Онкоген. 2013; 32: 3477–3482. [PubMed] [Google Scholar]
    • Wood GA, Fata JE, Watson KLM, Khokha R. Циркулирующие гормоны и стадия течки предсказывают клеточное и стромальное ремоделирование в матке мыши. Репродукция. 2007; 133: 1035–1044. [PubMed] [Google Scholar]

    Роль андрогенов в пролиферации эпителия и формировании желез в матке мышей | Эндокринология

    «> Материалы и методы

    » data-legacy-id=»s02″> Извлечение РНК и обратная транскрипция

    Суммарную РНК экстрагировали из гомогенизированной ткани матки мыши (20 мг на образец) с использованием TriReagent и хлороформа с последующим выделением на колонке и элюированием на колонке RNeasy Mini Kit (QIAGEN) в соответствии с инструкциями производителя. Концентрацию и качество РНК измеряли с помощью спектрофотометра Nanodrop ND-1000 (Nanodrop Technologies), и образцы стандартизировали до 100 нг / мкл в воде, свободной от РНКазы. Обратную транскрипцию выполняли с использованием набора SuperScript VILO cDNA Synthesis Kit и Master Mix (Invitrogen) в соответствии с инструкциями производителя с использованием термоциклера, запрограммированного на: 25 ° C в течение 10 минут, 42 ° C в течение 60 минут и 52 ° C в течение 5 минут.Два отрицательных контроля (без ферментного контроля и без контроля РНК) и один положительный контроль (мышиный РНК-положительный контроль) были включены для каждого набора образцов РНК.

    » data-legacy-id=»s04″> Иммуногистохимия и иммунофлуоресценция

    Образцы фиксировали в 4% нейтральном забуференном формалине в течение ночи при комнатной температуре, переносили в 70% этанол и ткани обрабатывали для заливки парафином.Поперечные срезы толщиной 5 мкм вырезали с помощью микротома (Leica RM2135), и слайды инкубировали в течение ночи при 55 ° C. Для гистологии ткани депарафинизировали, регидратировали и извлечение антигена выполняли с использованием цитрата (0,01 М цитрат, pH 6,0) в камере для снятия швов с последующим несколькими этапами блокирования сывороткой из тех видов, в которых было индуцировано вторичное антитело, во избежание неспецифического связывания. , а перекись водорода использовалась для блокирования активности эндогенной пероксидазы. Срезы инкубировали с первичным антителом, разведенным в растворе, блокирующем сыворотку, в течение ночи при 4 ° C.Включены отрицательные контроли, в которых первичное антитело было опущено, чтобы идентифицировать какое-либо неспецифическое связывание вторичным антителом. На следующий день обнаружение проводили с использованием либо конъюгированного вторичного антитела, специфичного для первичного антитела, либо системы обнаружения на основе полимера (ImmPress, Vector Labs). Для хромогенной иммуногистохимии в качестве хромогена использовали 3,3′-диаминобензидин (DAB) (Vector), тогда как для иммунофлуоресценции использовали систему усиления тирамидного сигнала (PerkinElmer) в соответствии с инструкциями производителя.Между инкубациями проводили промывание TBS-Tween. Гематоксилин использовали в качестве контрастного красителя для иммуногистохимии, а DAPI — в качестве контрастного красителя для иммунофлуоресценции. Информация об антителах представлена ​​в таблице 1.

    BS BS 9106 Шегееп 9109 3000
    Пептид / белок-мишень . Название антитела . Производитель, номер по каталогу и / или имя лица, предоставляющего антитело . Виды, выращенные в; Моноклональные или поликлональные . Используемое разбавление .
    Рецептор андрогенов AR Spring Bioscience, M4070 Кролик моноклональный 1: 300
    Бромодезоксиуридин Бромодезоксиуридин 9101
    Маркер пролиферации Ki67 MKi67 Abcam, Ab15580 Кролик поликлональный 1: 2000
    Forkhead box protein 2 FOXA2
    BS BS 9106 Шегееп 9109 3000
    Пептид / белок-мишень . Название антитела . Производитель, номер по каталогу и / или имя лица, предоставляющего антитело . Виды, выращенные в; Моноклональные или поликлональные . Используемое разбавление .
    Рецептор андрогенов AR Spring Bioscience, M4070 Кролик моноклональный 1: 300
    Бромодезоксиуридин Бромодезоксиуридин 9101
    Маркер пролиферации Ki67 MKi67 Abcam, Ab15580 Кролик поликлональный 1: 2000
    Forkhead box protein 2 FOXA2
    BS BS 9106 Шегееп 9109 3000
    Пептид / белок-мишень . Название антитела . Производитель, номер по каталогу и / или имя лица, предоставляющего антитело . Виды, выращенные в; Моноклональные или поликлональные . Используемое разбавление .
    Рецептор андрогенов AR Spring Bioscience, M4070 Кролик моноклональный 1: 300
    Бромодезоксиуридин Бромодезоксиуридин 9101
    Маркер пролиферации Ki67 MKi67 Abcam, Ab15580 Кролик поликлональный 1: 2000
    Forkhead box protein 2 FOXA2
    BS BS 9106 9109 3000
    Пептид / белок-мишень . Название антитела . Производитель, номер по каталогу и / или имя лица, предоставляющего антитело . Виды, выращенные в; Моноклональные или поликлональные . Используемое разбавление .
    Рецептор андрогенов AR Spring Bioscience, M4070 Кролик моноклональный 1: 300
    Бромодезоксиуридин Бромодезоксиуридин BrdU
    Маркер пролиферации Ki67 MKi67 Abcam, Ab15580 Кролик поликлональный 1: 2000
    Forkhead box protein 2 FOXA2

    «> Результаты

    » data-legacy-id=»s07″> Обработка DHT индуцирует экспрессию эпителиального AR в матке мыши

    Положительная иммуноэкспрессия AR была обнаружена в стромальном компартменте как через 24 часа, так и через 7 дней у мышей, обработанных носителем и DHT. Обработка DHT индуцировала экспрессию AR в просветном и железистом эпителии через 24 часа (фиг. 2B), которая отсутствовала в группах носителя в обе временные точки (фиг. 2, A и C). У мышей, получавших DHT в течение 7 дней, AR был обнаружен в строме и железистом эпителии, но не в просветном эпителии (рис. 2D).ПЦР в реальном времени показала значительное уменьшение мРНК Ar после 7 дней лечения DHT по сравнению с носителем (рис. 2E). Исследование характера экспрессии рецептора эстрогена альфа (ERα) не выявило разницы между группами, получавшими наполнитель и DHT, в оба момента времени (дополнительная фигура 2).

    Рисунок 2

    Обработка DHT приводит к заметному увеличению иммунореактивности AR в эпителиальных клетках матки, сопровождающемуся подавлением мРНК Ar .A и C, экспрессия AR была ограничена стромальным компартментом и клетками гладкой мускулатуры миометрия групп носителя как через 24 часа (A), так и через 7 дней (C), при этом уровни железистого (черные стрелки) и просветного эпителиального эпителия AR были низкими до необнаруживаемый. B и D. Обработка DHT приводила к интенсивному иммуноокрашиванию AR в строме, сопровождаемому экспрессией AR в просветном и железистом эпителии через 24 часа (B, красные стрелки), причем железистый эпителий сохранял экспрессию AR через 7 дней лечения DHT ( D).E. Обработка DHT в течение 7 дней приводила к значительному подавлению мРНК Ar в матке мыши. Все планки погрешностей представляют стандартную ошибку среднего (n = 8 на группу лечения). **, P <.01. Масштабные линейки: 100 мкм. Отрицательный: отрицательный контроль.

    Рисунок 2

    Обработка DHT приводит к заметному увеличению иммунореактивности AR в эпителиальных клетках матки, сопровождающемуся подавлением мРНК Ar . A и C, экспрессия AR была ограничена стромальным компартментом и клетками гладкой мускулатуры миометрия групп носителя как через 24 часа (A), так и через 7 дней (C), при этом уровни железистого (черные стрелки) и просветного эпителиального эпителия AR были низкими до необнаруживаемый.B и D. Обработка DHT приводила к интенсивному иммуноокрашиванию AR в строме, сопровождаемому экспрессией AR в просветном и железистом эпителии через 24 часа (B, красные стрелки), причем железистый эпителий сохранял экспрессию AR через 7 дней лечения DHT ( D). E. Обработка DHT в течение 7 дней приводила к значительному подавлению мРНК Ar в матке мыши. Все планки погрешностей представляют стандартную ошибку среднего (n = 8 на группу лечения). **, P <.01. Масштабные линейки: 100 мкм. Отрицательный: отрицательный контроль.

    » data-legacy-id=»s09″> DHT регулирует гены, необходимые для пролиферации, регуляции клеточного цикла и взаимодействия стромы и эпителия в матке мыши

    ПЦР-анализ в реальном времени выявил динамические изменения в экспрессии нескольких генов, связанных с регуляцией клеточного цикла и стромально-эпителиальным перекрестным взаимодействием после лечения DHT.

    Экспрессия Wee1 была значительно повышена с помощью DHT через 24 часа, после чего последовало значительное подавление через 7 дней (фиг. 5A). Ccnd1 Экспрессия значительно увеличивалась под действием DHT через 24 часа с последующим значительным снижением через 7 дней (фиг. 5B). Rb1 Экспрессия значительно подавлялась DHT в оба момента времени (фиг. 5C).

    Рисунок 5

    Обработка DHT оказывает зависящее от времени действие на концентрации мРНК, кодируемых генами, участвующими в регуляции клеточного цикла и перекрестных взаимодействий между стромой и эпителием.Анализ ПЦР в режиме реального времени гомогенатов цельной ткани матки выявил измененную экспрессию регуляторов клеточного цикла и маркеров пролиферации ( Wee1 [A], Ccnd1 [B], Rb1 [C]) и генов, участвующих в стромальных- эпителиальные взаимодействия и факторы роста эпителия ( Wnt4 [D], Wnt5 α [E], Wnt7 α [F], Cdh2 [G], Vcl [H], Igf1 [I] , Prl8 [J], Prlr [K], Foxa2 [L], Fgf8 [M], Hgf [N]).Для всех анализов RT-PCR использовалось n = 8 на группу лечения на момент времени, и все данные были нормализованы по гену домашнего хозяйства 18s. Все планки погрешностей представляют SEM, *, P <0,05; **, P <0,01; ***, P <0,001; ****, П <.0001.

    Рисунок 5

    Обработка DHT оказывает зависящее от времени действие на концентрации мРНК, кодируемых генами, участвующими в регуляции клеточного цикла и перекрестном взаимодействии стромы и эпителия. Анализ ПЦР в режиме реального времени гомогенатов цельной ткани матки выявил измененную экспрессию регуляторов клеточного цикла и маркеров пролиферации ( Wee1 [A], Ccnd1 [B], Rb1 [C]) и генов, участвующих в стромальных- эпителиальные взаимодействия и факторы роста эпителия ( Wnt4 [D], Wnt5 α [E], Wnt7 α [F], Cdh2 [G], Vcl [H], Igf1 [I] , Prl8 [J], Prlr [K], Foxa2 [L], Fgf8 [M], Hgf [N]).Для всех анализов RT-PCR использовалось n = 8 на группу лечения на момент времени, и все данные были нормализованы по гену домашнего хозяйства 18s. Все планки погрешностей представляют SEM, *, P <0,05; **, P <0,01; ***, P <0,001; ****, П <.0001.

    На передачу сигналов Wnt, участвующую в стромально-эпителиальном перекрестном взаимодействии в матке, значительно влияет лечение DHT. Экспрессия Wnt4 значительно подавлялась после обработки DHT в течение 24 часов и 7 дней (фиг. 5D). Wnt5a Концентрация мРНК была значительно увеличена с помощью DHT в оба момента времени (фиг. 5E), тогда как экспрессия Wnt7a подавлялась с помощью DHT только через 7 дней (фиг. 5F).

    Cdh2 , который экспрессируется в эпителии матки, значительно повышается под действием DHT как через 24 часа, так и через 7 дней (рис. 5G), тогда как экспрессия компонента соединения адгезивов винкулина ( Vcl ) участвует в межклеточной адгезии и сигнализация показала значительное повышение регуляции DHT через 24 часа, при этом значительных изменений между носителем и DHT через 7 дней не наблюдалось (фиг. 5H).Экспрессия предположительно регулируемого андрогеном фактора роста эпителия Igf1 была значительно повышена под действием DHT в оба момента времени по сравнению с обработкой носителем, достигая в среднем 10-кратного увеличения через 7 дней (фиг. 5I). Prl8, , роль которого, как сообщалось, в образовании желез в матке мышей, был значительно активирован более чем в 20 раз в обе временные точки (рис. 5J), с аналогичным паттерном, наблюдаемым для его рецептора ( Prlr ; рис. 5J). Фактор транскрипции Foxa2 , который экспрессируется исключительно в железах матки, показал тенденцию к увеличению после лечения DHT через 24 часа ( P =.14), но изменения в обоих временных точках не достигли статистической значимости (Рисунок 5K). Кроме того, экспрессия факторов роста эпителия Fgf7 (фиг. 5L) и Hgf (фиг. 5M) значительно изменилась после лечения DHT.

    «> Обсуждение

    В этом исследовании мы продемонстрировали, что андрогены вызывают пролиферацию эпителия, что приводит к увеличению количества эндометриальных желез в матке взрослой мыши. Маточные железы необходимы для восприимчивости и имплантации матки, а также выделяют факторы, необходимые для выживания и развития концептуса.Наши результаты предполагают, что гомеостатический баланс андрогенов и местная стероидогенная среда могут быть важными физиологическими факторами образования желез во время ремоделирования эндометрия на ранних сроках беременности. Модели на животных, в которых нарушено развитие маточных желез, демонстрируют сниженную фертильность и измененную экспрессию факторов децидуализации (30, 31), что подчеркивает потенциал перспективного терапевтического воздействия на передачу сигналов андрогенов в матке при нарушениях, связанных с фертильностью (32).Хотя ранее сообщалось о трофическом эффекте андрогенов в матке грызунов, мы впервые идентифицируем задействованные молекулярные механизмы и избирательные эффекты андрогенов на отдельные тканевые компартменты в матке. Примечательно, что мы впервые описываем, что DHT способствует образованию желез в матке взрослых мышей посредством прямой стимуляции пролиферации железистого эпителия и путем управления экспрессией регуляторов клеточного цикла и стромально-эпителиальных взаимодействий. Новые данные, полученные в текущем исследовании, позволяют по-новому взглянуть на роль андрогенов в регуляции функции эндометрия.

    В матке действие половых стероидов происходит через прямую передачу сигналов рецептора стероидного гормона в клетках-мишенях и косвенное паракринное воздействие на соседние клеточные компартменты. Такие примеры межклеточной паракринной передачи сигналов включают происходящую из стромы секрецию IGF-1 и связывание WNT5a с эпителиальными рецепторами, контролирующими пролиферацию и образование желез, соответственно. Таким образом, регуляция сложных стромально-эпителиальных взаимодействий, возникающих в результате действия андрогенов, может быть исследована с использованием модельных систем in vivo, что делает грызунов бесценными моделями.Чтобы исследовать влияние лечения андрогенами на истощенную стероидами матку мышей, мы лечили мышей ovx ДГТ в супрафизиологической дозе (0,2 мг / мышь), которая, как было ранее показано, вызвала ответ матки (29, 33). Хотя концентрации ДГТ, полученные в наших экспериментальных условиях, превышают физиологические уровни, обнаруженные у самок мышей, ездящих на велосипеде (6), эта доза согласуется с теми, которые использовались в нескольких предыдущих исследованиях, изучающих прямое действие ДГТ на матку грызунов (22, 34) и жировая ткань (29, 35).

    В этом исследовании DHT вызывал зависящее от времени увеличение веса матки в соответствии с предыдущими сообщениями у крыс, получавших DHT или синтетический андрогенный миболерон, где дозозависимое и зависящее от времени увеличение веса матки после лечения андрогенами было обнаружено в этот вид (34). В настоящем исследовании было обнаружено увеличение общей площади матки, площади эндометрия и площади миометрия, сопровождающееся значительным снижением плотности клеток, возможно, из-за впитывания воды, что демонстрирует трофические эффекты DHT в обоих отделах матки у мышей.Хотя трофические эффекты также индуцируются эстрогенами в матке грызунов, в текущем исследовании морфология матки после лечения DHT не имела характерного фенотипа растяжения, отека и тонкости слоя эндометрия, вызванных E 2 (36, 37), что соответствовало уникальный эффект андрогенов в регуляции физиологии матки, отличный от эстрогенов. Ранние исследования с использованием бесклеточных систем in vitro и моделей грызунов in vivo продемонстрировали взаимодействие между T и DHT с ER, приводящее к ядерной транслокации ER, тогда как совместное лечение антиэстрогенами, но не антиандрогенами, блокировало этот эффект (38, 39).Однако более позднее исследование продемонстрировало, что дозы DHT in vivo, необходимые для того, чтобы вызвать истощение цитоплазмы ER и ядерную транслокацию в матке крысы, очень высоки (5-10 мг), что позволяет предположить, что трофические эффекты DHT на матку, наблюдаемые в нашем исследовании, маловероятны. опосредовано ER (40). Кроме того, самки крыс ovx, обработанные DHT и антагонистом AR бикалутамидом, продемонстрировали полное подавление DHT-индуцированной экспрессии Igf1 , фактора роста, повышающая регуляция которого контролируется как ERα, так и AR (34).Это открытие, вместе с тем фактом, что предполагаемые гены-мишени ERα не индуцируются после лечения DHT в матке мыши (34), предполагают большее функциональное взаимодействие между AR и ERα, чем физическое. Примечательно, что в исследовании, описывающем разработку модели мышей с AR-нокаутом, специфичным для железистого эпителия матки (ugeARKO), параметры матки (масса матки и площадь поверхности) взрослых самок мышей ugeARKO были в пределах нормы, но андроген-индуцированный рост матки в ovx у мышей было нарушено (41), что согласуется с результатами настоящего исследования, которые описывают андрогенную индукцию роста матки через эпителиальный AR.

    Учитывая, что андрогены способствуют росту матки грызунов, мы исследовали экспрессию маркеров пролиферации в ткани, чтобы выяснить эффекты, специфичные для компартментов. Оценка иммунофлуоресценции маркера пролиферации MKi67, который обнаруживает все активно пролиферирующие клетки (клетки не в G 0 клеточного цикла), выявила обширную пролиферацию в эпителии матки, которая была связана со значительным увеличением концентрации Mki67 мРНК через 24 часа, что также сопровождалось ядерной транслокацией циклина D1 в эпителий (данные не показаны).Пролиферативный эффект DHT был подтвержден оценкой включения BrdU, которая выявила обширную пролиферацию в эпителиальном компартменте, но не в строме после лечения DHT. Примечательно, что повышенная пролиферация была обнаружена только после 24 часов лечения, что соответствовало тому, что DHT индуцировал быстрые изменения в ткани. Наши результаты были дополнительно дополнены Terada et al (42), которые сообщили, что лечение мышей, праймированных ovx E 2 , с помощью DHT значительно снижало апоптотический индекс маточного эпителия, тем самым приводя аргументы в пользу ингибирующего эффекта DHT на гибель клеток на эпителий матки мышей.Кроме того, эффекты DHT частично имитируют эффекты, наблюдаемые после лечения E 2 , где максимальная скорость пролиферации эпителия наблюдается через 21 час лечения E 2 , за которым следует снижение пролиферации и усиление апоптоза после повторных инъекций E 2 ( 43).

    Обработка мышей ovx DHT приводила к значительному увеличению иммунореактивности AR в строме матки, сопровождаемой индуцированной экспрессией AR в железистых и просветных эпителиальных клетках.Предыдущие исследования показали, что, хотя андрогены снижают транскрипцию AR, они положительно модулируют эффективность трансляции и стабильность белка AR, тем самым увеличивая уровни белка AR (44–47). Эти результаты согласуются с нашими данными, в которых мы обнаружили значительное снижение мРНК Ar после лечения DHT в течение 7 дней, сопровождаемое увеличением уровней белка AR. Как уже упоминалось, в предыдущих исследованиях сообщалось, что андрогенные эффекты в матке мыши могут быть опосредованы посредством передачи сигналов ERα (21, 34) с обширным перекрестным взаимодействием между двумя рецепторами (40, 48).Однако не наблюдалось никаких изменений в характере экспрессии ERα после лечения DHT, что позволяет предположить, что если какое-либо функциональное взаимодействие происходит между AR и ERα после лечения DHT, это не связано с измененными уровнями ERα.

    Принимая во внимание пролиферацию эпителия матки после лечения DHT с известной ролью андрогенов в контроле развития клеточного цикла в простате (49) и матке мыши (22), экспрессию транскриптов регуляторов клеточного цикла анализировали в режиме реального времени. ПЦР.Многофункциональный регулятор клеточного цикла Wee1 контролирует целостность хроматина и вступление в митоз путем регулирования транскрипции гистонов и образования активных комплексов с факторами, которые контролируют прогрессирование клеточного цикла [обзор у Mahajan et al (50)]. DHT индуцировал повышающую регуляцию Wee1 через 24 часа, что согласуется с активно пролиферирующим эпителиальным компартментом в этот момент времени, тогда как его экспрессия после 7 дней лечения DHT была значительно снижена по сравнению с VC, что указывает на механизм отрицательной обратной связи, восстанавливающий пролиферацию тканей до базальные уровни.Такой же паттерн экспрессии наблюдался для Ccnd1 (циклин D1), уровни и ядерная локализация которого, как было показано, регулируются E 2 в эпителиальных клетках матки мышей (51). Экспрессия ингибитора клеточного цикла и опухолевого супрессора Rb1 значительно подавлялась DHT в оба момента времени, что согласуется с повышенной пролиферацией и ростом матки, обнаруживаемой в ответ на DHT. Учитывая, что изменения, наблюдаемые в размере матки, отражают изменения во всех клеточных компартментах (включая строму), необходимы дополнительные исследования, чтобы выяснить, происходят ли изменения в пролиферации стромы в ответ на ДГТ в другие моменты времени после введения андрогенов.Результаты настоящего исследования расширяют предыдущие анализы транскрипции образцов, полученных из обработанных DHT изолированных стромальных клеток эндометрия человека, которые демонстрируют AR-зависимую репрессию регуляторов клеточного цикла (52) и DHT-зависимое снижение как пролиферации, так и апоптоза (12). Взятые вместе, эти результаты предполагают, что андрогены могут влиять на стромальный компартмент, подавляя апоптоз стромальных клеток, а не способствуя пролиферации, в дополнение к прямым эффектам на пролиферацию эпителия матки, описанным в текущем исследовании.

    сопровождается понижающей регуляцией, сопровождаемой понижающей регуляцией, участвующей в стромально-эпителиальных взаимодействиях и формировании паттерна органов во время неонатального и постнатального развития матки. Wnt4 и Wnt5a экспрессируются стромальными фибробластами, а Wnt7a — эпителиальными клетками с паракринной и аутокринной передачей сигналов, контролирующих судьбу клеток и дифференцировку матки (53). Мы наблюдали значительные изменения в характере экспрессии этих факторов, при этом Wnt4 и Wnt7a значительно подавлялись, а Wnt5a значительно повышались после обработки DHT.Исследования на мышах продемонстрировали, что все три Wnts необходимы для образования желез в матке, а мыши с нокаутом для этих Wnts нарушают фертильность (54-56). Кроме того, введение прогестерона или синтетического эстрогена диэтилстильбестрола в раннем постнатальном временном окне ингибирует образование эндометриальных желез (аденогенез) в матке мышей (3, 57). Аналогичным образом было показано, что кадгерин 1 ( Cdh2 ) жизненно важен для дифференцировки эндометрия эпителия матки, тогда как потеря Cdh2 в матке приводит к отсутствию желез, дезорганизованному эпителию просвета и усилению регуляции Wnt4a. с сопутствующей понижающей регуляцией Wnt5a в матке новорожденных мышей (58).В нашем исследовании лечение DHT индуцировало значительную повышающую регуляцию Cdh2 как через 24 часа, так и через 7 дней, что сопровождалось понижающей регуляцией Wnt4a и повышением регуляции Wnt5a , что позволяет предположить, что андрогены в матке мыши положительно регулируют образование желез.

    Трофические эффекты в тканях часто сопровождаются их ремоделированием, что привело нас к исследованию экспрессии винкулина ( Vcl ), компонента адгезивного соединения, участвующего в межклеточной адгезии, экспрессия которого регулируется андрогенами в простате (59). . Vcl был значительно повышен после 24 часов обработки DHT, и через 7 дней его экспрессия была такой же, как у носителя, что указывает на начальную фазу изменения свойств клеточной адгезии с последующим восстановлением до базальных уровней. Кроме того, это первое свидетельство андрогенной регуляции Vcl в матке.

    Чтобы подтвердить повышенную пролиферацию эпителия после лечения DHT, оценивали экспрессию факторов роста эпителия. IGF-1 преимущественно продуцируется стромальными клетками эндометрия мышей после обработки E 2 и дает сигнал эпителию о пролиферации (51), а в предыдущих исследованиях сообщалось, что промотор Igf1 содержит элементы андрогенного ответа (60).В текущем исследовании значительное увеличение экспрессии фактора роста эпителия Igf1 было обнаружено после 7 дней лечения DHT. Примечательно, что Nantermet и др. (34) сообщили, что DHT не вызывает гипертрофию матки у мышей, лишенных функционального рецептора эстрогена (мыши с нокаутом ERα), предполагая, что ERα необходим для опосредования ответов DHT. Однако Klotz et al (61) ранее сообщали, что экспрессия ERα необходима для опосредования пролиферативного эффекта IGF-1 в матке мышей.Таким образом, вместе с данными текущего исследования, эти результаты согласуются с тем, что DHT также опосредует косвенные эффекты на пролиферацию в матке посредством стромально-эпителиального перекрестного взаимодействия после индукции IGF-сигнального пути. Факторы роста эпителия, происходящие из стромы, FGF7 и HGF, оба опосредуют стромально-эпителиальные взаимодействия в матке, способствуя пролиферации эпителия, играя важную роль в морфогенезе эпителия (62). Хотя введение прогестерона в матку новорожденных мышей подавляет образование маточных желез, что сопровождается значительным снижением экспрессии Fgf7 и значительным увеличением экспрессии Hgf (62), в нашем исследовании лечение DHT вызывало противоположный эффект. за счет значительного увеличения уровней мРНК Fgf7 и снижения уровней мРНК Hgf .

    Самым поразительным наблюдаемым результатом было влияние DHT на маточные железы. В контрольной матке экспрессия AR в железистых эпителиальных клетках не обнаружена; однако обработка DHT индуцировала экспрессию AR и увеличивала пролиферацию железистого эпителия. Количественная оценка FOXA2-положительных желез продемонстрировала большее количество маточных желез в матке мышей, обработанных DHT, эффект, который был уникальным для DHT, поскольку обработка E 2 не давала этого эффекта. FOXA2 экспрессируется исключительно в железистом эпителии матки мышей, а у Foxa2 -нокаутных мышей не развиваются железы (30).В текущем исследовании DHT вызывал изменения в экспрессии ряда факторов, которые способствуют аденогенезу у взрослых мышей. Хотя экспрессия мРНК Foxa2 в гомогенатах цельной ткани существенно не различалась между контрольными мышами и мышами, получавшими DHT, обработка E 2 значительно снижала концентрации мРНК Foxa2 , подчеркивая важность баланса андрогенов и эстрогенов в регуляции этой клеточной отсек в матке. Взятые вместе, эти данные согласуются с DHT, регулирующим образование желез в матке взрослых мышей, вызывая программу транскрипции, которая приводит к аденогенезу de novo.

    В настоящем исследовании лечение мышей DHT выявило андроген-специфические эффекты на архитектуру эндометрия, характеризующиеся быстрым увеличением пролиферации эпителиальных клеток, выстилающих железы, и значительными DHT-зависимыми изменениями в экспрессии генов, связанных с регуляцией клеточного цикла и стромально-эпителиальный перекрестный ток. Эти результаты предполагают, что любая эндокринная патология, которая приводит к значительному отклонению от нормальных внутриклеточных концентраций андрогенов, может иметь долгосрочное влияние на изобилие железистых эпителиальных клеток, с последующим воздействием на железистую секрецию и необходимость взаимодействия эпителиально-стромальных клеток. для поддержки установления беременности у женщин.

    «> Сокращения

    • AR

    • BrdU

    • DHT

    • E 2

    • ERα

    • ovx 09

    • 9089

      ovx 09 9089 1

      Filant

      J

      ,

      Spencer

      TE

      .

      Клеточно-специфическое профилирование транскрипции выявляет механизмы-кандидаты, регулирующие развитие и функцию эпителия матки у мышей

      .

      Биол Репрод

      .

      2013

      ;

      89

      :

      86

      ,2

      Simon

      L

      ,

      Spiewak

      KA

      ,

      Ekman

      GC

      и др. .

      Рецепторы стромального прогестерона опосредуют индукцию Indian Hedgehog (IHH) в эпителии матки и его нижележащих мишеней в строме матки

      .

      Эндокринология

      .

      2009

      ;

      150

      :

      3871

      3876

      .3

      Хаяси

      K

      ,

      Йошиока

      S

      ,

      Рирдон

      SN

      и др. .

      WNT в матке новорожденных мышей: потенциальная регуляция развития эндометриальных желез

      .

      Биол Репрод

      .

      2011

      ;

      84

      :

      308

      319

      .4

      Павар

      S

      ,

      Старосвецкий

      E

      ,

      Orvis

      GD

      ,

      Behringer 9000R 9000 9000 9000

      Багчи

      МК

      .

      STAT3 регулирует ремоделирование эпителия матки и эпителиально-стромальные перекрестные помехи во время имплантации

      .

      Мол Эндокринол

      .

      2013

      ;

      27

      :

      1996

      2012

      .5

      Rothman

      MS

      ,

      Carlson

      NE

      ,

      Xu

      M

      и др. .

      Повторное исследование уровней тестостерона, дигидротестостерона, эстрадиола и эстрона в течение менструального цикла и у женщин в постменопаузе, измеренных с помощью жидкостной хроматографии и тандемной масс-спектрометрии

      .

      Стероиды

      .

      2011

      ;

      76

      :

      177

      182

      ,6

      Nilsson

      ME

      ,

      Vandenput

      L

      ,

      Tivesten

      Å

      и др. .

      Измерение полного профиля половых стероидов в сыворотке крови грызунов с помощью высокочувствительной газовой хроматографии и тандемной масс-спектрометрии

      .

      Эндокринология

      .

      2015

      ;

      156

      :

      2492

      2502

      ,7

      Макиева

      S

      ,

      Saunders

      PT

      ,

      Norman

      JE

      .

      Андрогены при беременности: роль в родах

      .

      Обновление Hum Reprod

      .

      2014

      ;

      20

      :

      542

      559

      .8

      Apparao

      KB

      ,

      Lovely

      LP

      ,

      Gui

      Y

      ,

      Lininger

      RA

      sey,

      RA Les

      ,

      Повышенная экспрессия рецепторов андрогенов эндометрия у женщин с синдромом поликистозных яичников

      .

      Биол Репрод

      .

      2002

      ;

      66

      :

      297

      304

      ,9

      Ван

      F

      ,

      Пан

      J

      ,

      Лю

      Y

      и др. .

      Альтернативный сплайсинг рецептора андрогенов при синдроме поликистозных яичников

      .

      Proc Natl Acad Sci U S A Proc Natl Acad Sci U S A

      .

      2015

      ;

      112

      :

      4743

      4748

      .10

      Huhtinen

      K

      ,

      Saloniemi-Heinonen

      T

      ,

      Keski-Rahkonen

      P

      , et al..

      Профили внутриканальных стероидов указывают на различный метаболизм прогестерона и тестостерона в эндометрии и очагах эндометриоза

      .

      Дж. Клин Эндокринол Метаб

      .

      2014

      ;

      99

      :

      E2188

      E2197

      .11

      Okon

      MA

      ,

      Laird

      SM

      ,

      Tuckerman

      EM

      ,

      Li

      TC

      Уровни андрогенов в сыворотке у женщин с повторными выкидышами и их корреляция с маркерами функции эндометрия

      .

      Fertil Steril

      .

      1998

      ;

      69

      :

      682

      690

      .12

      Marshall

      E

      ,

      Lowrey

      J

      ,

      MacPherson

      S

      и др. .

      Анализ in silico определяет новую роль андрогенов в регуляции апоптоза эндометрия человека

      .

      Дж. Клин Эндокринол Метаб

      .

      2011

      ;

      96

      :

      E1746

      E1755

      ,13

      Slayden

      OD

      ,

      Nayak

      NR

      ,

      Burton

      KA

      и др..

      Антагонисты прогестерона увеличивают экспрессию рецепторов андрогенов у макак-резусов и эндометрия человека

      .

      Дж. Клин Эндокринол Метаб

      .

      2001

      ;

      86

      :

      2668

      2679

      .14

      Пеллетье

      G

      ,

      Luu-The

      V

      ,

      Li

      S

      ,

      Labrie

      F

      .

      Локализация и эстрогенная регуляция экспрессии мРНК рецепторов андрогенов в матке и влагалище мышей

      .

      Дж Эндокринол

      .

      2004

      ;

      180

      :

      77

      85

      .15

      Xu

      J

      ,

      Li

      M

      ,

      Zhang

      L

      и др. .

      Экспрессия и регуляция рецепторов андрогенов в матке мышей на ранних сроках беременности и децидуализации

      .

      Мол Репрод Дев

      .

      2015

      ;

      82

      :

      898

      906

      .16

      Dart

      DA

      ,

      Waxman

      J

      ,

      Aboagye

      EO

      ,

      Bevan

      CL

      CL

      CL

      CL

      Визуализация активности рецепторов андрогенов у самцов и самок мышей

      .

      PLoS One

      .

      2013

      ;

      8

      :

      e71694

      .17

      Walters

      KA

      ,

      McTavish

      KJ

      ,

      Seneviratne

      MG

      и др. .

      Субфертильные самки мышей с нокаутом рецепторов андрогенов обнаруживают дефекты нейроэндокринной передачи сигналов, внутриовариальной функции и развития матки, но не функции матки

      .

      Эндокринология

      .

      2009

      ;

      150

      :

      3274

      3282

      .18

      Миллер

      N

      ,

      Бедар

      YC

      ,

      Cooter

      NB

      ,

      Shaul

      DL

      DL

      DL

      Гистологические изменения половых путей у транссексуальных женщин после терапии андрогенами

      .

      Гистопатология

      .

      1986

      ;

      10

      :

      661

      669

      ,19

      Perrone

      AM

      ,

      Cerpolini

      S

      ,

      Maria Salfi

      NC

      и др..

      Влияние длительного приема тестостерона на эндометрий транссексуалов от женщины к мужчине

      .

      Дж. Секс Мед

      .

      2009

      ;

      6

      :

      3193

      3200

      .20

      Gibson

      DA

      ,

      Simitsidellis

      I

      ,

      Collins

      F

      ,

      Saunders

      PT

      .

      Доказательства действия андрогенов при раке эндометрия и яичников

      .

      Рак, связанный с эндокринными инфекциями

      .

      2014

      ;

      21

      :

      T203

      T218

      .21

      Weihua

      Z

      ,

      Ekman

      J

      ,

      Almkvist

      A

      и др. .

      Участие рецептора андрогенов в пролиферации клеток, индуцированной 17бета-эстрадиолом, в матке крысы

      .

      Биол Репрод

      .

      2002

      ;

      67

      :

      616

      623

      .22

      Иванга

      M

      ,

      Лабри

      Y

      ,

      Calvo

      E

      и др..

      Тонкий временной анализ модуляции транскрипции DHT сигнальных путей ATM / Gadd45g в матке мышей

      .

      Мол Репрод Дев

      .

      2009

      ;

      76

      :

      278

      288

      ,23

      Сото

      AM

      ,

      Sonnenschein

      C

      .

      Два лица януса: половые стероиды как медиаторы пролиферации и гибели клеток

      .

      J Национальный онкологический институт

      .

      2001

      ;

      93

      :

      1673

      1675

      .24

      Groothuis

      PG

      ,

      Dassen

      HH

      ,

      Romano

      A

      ,

      Punyadeera

      C

      .

      Эстроген и эндометрий: уроки, извлеченные из профилей экспрессии генов у грызунов и человека

      .

      Обновление Hum Reprod

      .

      2007

      ;

      13

      :

      405

      417

      ,25

      Ли

      AE

      .

      Деление клеток и синтез ДНК в матке мыши во время непрерывного лечения эстрогенами

      .

      Дж Эндокринол

      .

      1972

      ;

      55

      :

      507

      513

      .26

      Lee

      AE

      ,

      Rogers

      LA

      ,

      Trinder

      G

      .

      Изменение скорости пролиферации клеток в эпителии матки мышей при непрерывном лечении эстрогенами

      .

      Дж Эндокринол

      .

      1974

      ;

      61

      :

      117

      121

      ,27

      Geck

      P

      ,

      Szelei

      J

      ,

      Jimenez

      J

      ,

      Lin

      TM

      ens

      Сото

      AM

      .

      Экспрессия новых генов, связанных с индуцированным андрогеном пролиферативным отключением в клетках рака простаты

      .

      Дж Стероид Биохим Мол Биол

      .

      1997

      ;

      63

      :

      211

      218

      .28

      Schindelin

      J

      ,

      Арганда-Каррерас

      I

      ,

      Frize

      E

      и др. .

      Фиджи: платформа с открытым исходным кодом для анализа биологических изображений

      .

      Нат Методы

      .

      2012

      ;

      9

      :

      676

      682

      .29

      Zhang

      Y

      ,

      Calvo

      E

      ,

      Martel

      C

      ,

      Luu-The

      V

      ,

      Labrie

      F

      ,

      Tchernof 9.

      Ответ транскриптома жировой ткани на дигидротестостерон у мышей

      .

      Physiol Genomics

      .

      2008

      ;

      35

      :

      254

      261

      .30

      Jeong

      JW

      ,

      Kwak

      I

      ,

      Lee

      KY

      и др..

      Foxa2 необходим для развития эндометриальных желез и фертильности мышей

      .

      Биол Репрод

      .

      2010

      ;

      83

      :

      396

      403

      .31

      Filant

      J

      ,

      Spencer

      TE

      .

      Эндометриальные железы необходимы для имплантации бластоцисты и децидуализации в матке мыши

      .

      Биол Репрод

      .

      2013

      ;

      88

      :

      93

      .32

      Спенсер

      TE

      .

      Биологическая роль маточных желез при беременности

      .

      Семин Репрод Мед

      .

      2014

      ;

      32

      :

      346

      357

      .33

      Azzi

      L

      ,

      El-Alfy

      M

      ,

      Martel

      C

      ,

      Labrie

      F

      F

      F

      Гендерные различия в морфологии кожи мышей и специфические эффекты половых стероидов и дегидроэпиандростерона

      .

      Дж Инвест Дерматол

      .

      2005

      ;

      124

      :

      22

      27

      .34

      Nantermet

      PV

      ,

      Masarachia

      P

      ,

      Gentile

      MA

      и др. .

      Андрогенная индукция роста и дифференцировки в матке грызунов включает модуляцию регулируемых эстрогеном генетических путей

      .

      Эндокринология

      .

      2005

      ;

      146

      :

      564

      578

      .35

      De Giorgio

      MR

      ,

      Yoshioka

      M

      ,

      St-Amand

      J

      .

      Однократная доза дигидротестостерона вызвала миогенную транскрипционную программу в женской интраабдоминальной жировой ткани

      .

      Дж Стероид Биохим Мол Биол

      .

      2010

      ;

      122

      :

      53

      64

      ,36

      Loeb

      L

      ,

      Suntzeff

      V

      ,

      Burns

      EL

      .

      Процессы роста, индуцированные эстрогенными гормонами в матке мышей

      .

      Ам Дж. Рак

      .

      1938

      ;

      34

      :

      413

      427

      .37

      Grunert

      G

      ,

      Porcia

      M

      ,

      Tchernitchin

      AN

      .

      Дифференциальная эффективность эстрадиола-17 бета и диэтилстильбоэстрола на отдельные группы ответов в матке крысы

      .

      Дж Эндокринол

      .

      1986

      ;

      110

      :

      103

      114

      .38

      Ruh

      TS

      ,

      Wassilak

      SG

      ,

      Ruh

      MF

      .

      Андроген-индуцированное накопление рецептора эстрогена в ядре

      .

      Стероиды

      .

      1975

      ;

      25

      :

      257

      273

      .39

      Korach

      KS

      ,

      Muldoon

      TG

      .

      Ингибирование образования комплекса эстроген-рецептор в передней доле гипофиза за счет низкоаффинного взаимодействия с 5 альфа-дигидротестостероном

      .

      Эндокринология

      .

      1975

      ;

      97

      :

      231

      236

      .40

      Шмидт

      WN

      ,

      Катценелленбоген

      BS

      .

      Андрогенно-маточные взаимодействия: оценка взаимодействия андрогенов с системами рецепторов тестостерона и эстрогенов и стимуляция роста матки и синтеза рецепторов прогестерона

      .

      Молекулярный эндокринол

      .

      1979

      ;

      15

      :

      91

      108

      .41

      Choi

      JP

      ,

      Zheng

      Y

      ,

      Skulte

      KA

      ,

      Handelsman

      DJ

      Развитие и характеристика железистого эпителия матки, специфического для мышей с нокаутом рецепторов андрогенов, модель

      .

      Биол Репрод

      .

      2015

      ;

      93

      :

      120

      .42

      Terada

      N

      ,

      Yamamoto

      R

      ,

      Takada

      T

      и др. .

      Ингибирующее действие андрогенов на гибель клеток эпителия матки мышей

      .

      Дж Стероид Биохим

      .

      1990

      ;

      36

      :

      305

      310

      .43

      Мартин

      L

      ,

      Финн

      CA

      ,

      Триндер

      G

      .

      Гипертрофия и гиперплазия матки мышей после лечения эстрогенами: авторадиографическое исследование

      .

      Дж Эндокринол

      .

      1973

      ;

      56

      :

      133

      144

      .44

      Krongrad

      A

      ,

      Wilson

      CM

      ,

      Wilson

      JD

      ,

      Allman

      DR

      Pha.

      Андроген увеличивает белок рецептора андрогена при уменьшении мРНК рецептора в клетках LNCaP

      .

      Молекулярный эндокринол

      .

      1991

      ;

      76

      :

      79

      88

      .45

      Wolf

      DA

      ,

      Herzinger

      T

      ,

      Hermeking

      H

      ,

      Blaschke

      D

      .

      ,

      z

      Транскрипционная и посттранскрипционная регуляция экспрессии андрогенных рецепторов человека андрогенами

      .

      Мол Эндокринол

      .

      1993

      ;

      7

      :

      924

      936

      .46

      Zhou

      ZX

      ,

      Lane

      MV

      ,

      Kemppainen

      JA

      ,

      EM

      FS

      FS

      Специфичность стабилизации лиганд-зависимых андрогенных рецепторов: взаимодействия рецепторных доменов влияют на диссоциацию лиганда и стабильность рецептора

      .

      Мол Эндокринол

      .

      1995

      ;

      9

      :

      208

      218

      .47

      Yeap

      BB

      ,

      Krueger

      RG

      ,

      Leedman

      PJ

      .

      Дифференциальная посттранскрипционная регуляция экспрессии гена рецептора андрогена андрогеном в клетках рака простаты и груди

      .

      Эндокринология

      .

      1999

      ;

      140

      :

      3282

      3291

      .48

      Панет-Раймонд

      V

      ,

      Gottlieb

      B

      ,

      Beitel

      LK

      ,

      Pinsky

      Pinsky

      .

      Взаимодействие между рецепторами андрогенов и эстрогенов и влияние на их трансактивационные свойства

      .

      Молекулярный эндокринол

      .

      2000

      ;

      167

      :

      139

      150

      .49

      Lamb

      AD

      ,

      Massie

      CE

      ,

      Neal

      DE

      .

      Программа транскрипции рецептора андрогенов (AR) при раке простаты

      .

      БЖУ Инт

      .

      2014

      ;

      113

      :

      358

      366

      .50

      Махаджан

      К

      ,

      Махаджан

      НП

      .

      Тирозинкиназа WEE1, новый эпигенетический модификатор

      .

      Тенденции Genet

      .

      2013

      ;

      29

      :

      394

      402

      .51

      Zhu

      L

      ,

      Pollard

      JW

      .

      Эстрадиол-17бета регулирует пролиферацию эпителиальных клеток матки мышей посредством передачи сигналов инсулиноподобного фактора роста 1

      .

      Proc Natl Acad Sci U S A

      .

      2007

      ;

      104

      :

      15847

      15851

      .52

      Cloke

      B

      ,

      Huhtinen

      K

      ,

      Fusi

      L

      и др. .

      Рецепторы андрогенов и прогестерона регулируют различные генные сети и клеточные функции в децидуализации эндометрия

      .

      Эндокринология

      .

      2008

      ;

      149

      :

      4462

      4474

      .53

      Миллер

      C

      ,

      Павлова

      A

      ,

      Sassoon

      DA

      .

      Дифференциальные паттерны экспрессии генов Wnt в репродуктивном тракте самок мышей во время развития и эстрального цикла

      .

      Mech Dev

      .

      1998

      ;

      76

      :

      91

      99

      .54

      Franco

      HL

      ,

      Dai

      D

      ,

      Lee

      KY

      и др. .

      WNT4 является ключевым регулятором нормального постнатального развития матки и передачи сигналов прогестерона во время имплантации и децидуализации эмбриона у мышей

      .

      FASEB J

      .

      2011

      ;

      25

      :

      1176

      1187

      .55

      Mericskay

      M

      ,

      Kitajewski

      J

      ,

      Sassoon

      D

      .

      Wnt5a необходим для правильного эпителиально-мезенхимального взаимодействия в матке

      .

      Развитие

      .

      2004

      ;

      131

      :

      2061

      2072

      .56

      Dunlap

      KA

      ,

      Filant

      J

      ,

      Hayashi

      K

      и др..

      Постнатальная делеция Wnt7a ингибирует морфогенез маточных желез и ставит под угрозу фертильность взрослых мышей

      .

      Биол Репрод

      .

      2011

      ;

      85

      :

      386

      396

      .57

      Filant

      J

      ,

      Zhou

      H

      ,

      Spencer

      TE

      .

      Прогестерон подавляет развитие маточных желез в матке новорожденных мышей

      .

      Биол Репрод

      .

      2012

      ;

      86

      :

      146

      ,

      141

      149

      .58

      Рирдон

      SN

      ,

      King

      ML

      ,

      MacLean

      JA

      и др. .

      CDh2 необходим для дифференцировки эндометрия, развития желез и функции взрослых в матке мышей

      .

      Биол Репрод

      .

      2012

      ;

      86

      :

      141

      ,

      141

      110

      .59

      Yu

      YP

      ,

      Landsittel

      D

      ,

      Jing

      L

      и др..

      Изменения экспрессии генов при раке простаты, предсказывающие опухолевую агрессию и предшествующее развитию злокачественных новообразований

      .

      Дж. Клин Онкол

      .

      2004

      ;

      22

      :

      2790

      2799

      .60

      Wu

      Y

      ,

      Zhao

      W

      ,

      Zhao

      J

      и др. .

      Идентификация элементов андрогенного ответа в вышестоящем промоторе инсулиноподобного фактора роста I

      .

      Эндокринология

      .

      2007

      ;

      148

      :

      2984

      2993

      .61

      Klotz

      DM

      ,

      Hewitt

      SC

      ,

      Ciana

      P

      и др. .

      Потребность в рецепторе эстрогена-альфа в ответах матки, индуцированных инсулиноподобным фактором роста-1 (IGF-1), и доказательства in vivo перекрестного взаимодействия IGF-1 / рецептора эстрогена

      .

      Дж. Биол. Хим.

      .

      2002

      ;

      277

      :

      8531

      8537

      .62

      Серый

      CA

      ,

      Bartol

      FF

      ,

      Tarleton

      BJ

      и др. .

      Биология развития маточных желез

      .

      Биол Репрод

      .

      2001

      ;

      65

      :

      1311

      1323

      .

      Заметки автора

      Авторские права © 2016 Эндокринологическое общество

      Эта статья была опубликована в соответствии с условиями лицензии Creative Commons Attribution License (CC-BY; https: // creativecommons.org / licenses / by / 4.0 /), что разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника. Авторские права на эту статью принадлежат авторам.

      Различная пролиферативная активность железистых и миоэпителиальных клонов при доброкачественных пролиферативных и ранних злокачественных заболеваниях груди

      В течение последних десятилетий в нескольких исследованиях изучалась пролиферативная активность инвазивного рака груди, его предшественников и доброкачественных поражений груди различными методами. 22, 23, 24, 25 Большинство этих исследований рассматривали поражения груди как однородное заболевание в отношении клеточного состава фракции роста. В отличие от этой точки зрения, наши предыдущие результаты, 8, 9, 10, 11, 12 в соответствии с выводами других, 26 показали, что разные типы клеток участвуют в развитии и прогрессировании доброкачественных пролиферативных заболеваний молочной железы на с одной стороны, и предраковых и злокачественных заболеваний груди, с другой стороны.В дополнение к хорошо известным железистым (CK8 / 18/19 +) и миоэпителиальным (гладкомышечный актин +) клеткам, в паренхиме груди можно четко идентифицировать третий тип клеток, который характеризуется экспрессией кератинов базального типа CK5. Только / 14. Совсем недавно, основываясь на результатах иммуно-мечения с двойной флуоресценцией и результатов вестерн-блоттинга, мы предположили, что эти диссеминированные, только экспрессирующие CK5 / 14 клетки базального типа представляют собой клетки-предшественники молочных желез, которые дают начало как железистым, так и миоэпителиальным клонам. 13, 14

      В настоящем исследовании мы оценили пролиферативный потенциал различных иммунофенотипов в нормальной ткани молочной железы, обычной протоковой гиперплазии, атипичной протоковой и дольчатой ​​гиперплазии, а также протоковой и дольковой карциноме in situ с использованием двойных- меченая иммуногистохимия для фракции роста MIB1 и клон-специфичных маркеров. Чтобы понять аспекты клеточной биологии таких разнообразных поражений, мы также проанализировали небольшую когорту репрезентативных поражений с использованием коммерчески доступных антител к CK5 / 6, CK8 / 18/19 и актину гладких мышц в экспериментах с двойной иммунофлуоресценцией, как описано ранее. 13, 14

      Как и ожидалось, мечение MIB1 наблюдалось в основном в пулах клеток CK8 / 18/19 + и CK5 / 14 +, тогда как фенотипы актин + гладких мышц редко демонстрировали одновременное положительное окрашивание MIB1 в нормальной молочной железе. В соответствии с нашей концепцией клеток-предшественников, показанной на схематическом рисунке на рисунке 4, данные настоящего исследования показывают, что клетки с миоэпителиальным иммунофенотипом (включая CK5 / 6 + / актин гладких мышц + промежуточные и гладкомышечный актин + конечные клетки) обладают очень ограниченными пролиферативными свойствами. и поэтому представляют собой относительно стабильную клеточную линию как в нормальной груди, так и в проанализированных пролиферативных поражениях.Это удивительно, поскольку в экспериментах с двойной флуоресценцией были обнаружены многочисленные промежуточные миоэпителиальные клетки, обычно указывающие на то, что многие из гладкомышечных актин + клеток еще не полностью дифференцированы. 13, 14 Тем не менее, наши настоящие данные, по-видимому, предполагают, что клетки, однажды вступившие в путь миоэпителиальной дифференцировки, теряют свою пролиферативную способность.

      Рисунок 4

      Гипотетические пути дифференцировки нормальных эпителиальных клеток молочной железы человека, основанные на профилях экспрессии цитокератина и различных скоростях пролиферации MIB1.Клетки-предшественники (CK5 +) дают начало промежуточным железистым (CK5 + / 8/18/19 +) или промежуточным миоэпителиальным клеткам (CK5 + / гладкомышечный актин +). Промежуточные железистые клетки далее дифференцируются в транзитные железистые клетки (CK8 / 18/19 +) и лактирующие конечные клетки. Промежуточные миоэпителиальные клетки дифференцируются в миоэпителиальные концевые клетки (только гладкомышечный актин +).

      Напротив, линия железистых клеток (включая промежуточные CK5 / 6 + / CK8 / 18/19 + и железистые клетки CK8 / 18/19 +) имеет высокую пролиферативную активность.Это согласуется с относительно незрелыми характеристиками просветного эпителия, как продемонстрировано в наших исследованиях двойной флуоресценции. 13, 14 Поскольку частота клеток MIB1 + / CK8 / 18/19 + значительно превышает таковую для фенотипов MIB1 + / CK5 / 14 +, мы заключаем, что железистые клетки CK8 / 18/19 + в покоящемся эпителии молочной железы все еще сохраняют значительный пролиферативный потенциал.

      Из одних только этих результатов мы не можем экстраполировать пролиферативную способность только клеток CK5 +. Наши недавние исследования предоставляют четкие доказательства того, что эти клетки представляют собой клетки-предшественники как клонов железистых, так и миоэпителиальных клеток. 13, 14 Весьма вероятно, что этот пул клеток также содержит подходящие стволовые клетки груди человека (Boecker et al , в стадии подготовки), пролиферативная способность которых должна быть довольно низкой, в соответствии со стволовыми клетками в другие ткани. 27

      Обычная гиперплазия протоков отличалась от всех других доброкачественных поражений из-за статистически значимого увеличения скорости пролиферирующих фенотипов MIB1 + / CK5 / 14 + в просвете просвета, в то время как доля пролиферирующих железистых фенотипов (CK8 / 18/19 + ) практически не изменилась.Присутствие пролиферирующих «гибридных» клеток CK5 / 14 + / CK8 / 18/19 + в люминальном компартменте, как однозначно идентифицировано на серийных срезах того же поражения, указывает на участие промежуточных железистых клеток в установке обычной гиперплазии протоков. . Эти находки, согласующиеся с наблюдением, что фенотипы CK5 / 14 + локализуются в основном в просветных слоях в пределах нормальной молочной железы, предполагают, что эти клетки могут быть связаны с физиологическим обновлением клеток и возникновением доброкачественных пролиферативных заболеваний груди.Основываясь на концепции функциональных клеток-предшественников, 13 , мы предполагаем, что эпителиальные клетки CK5 / 14 + представляют собой пул мультипотентных клеток (или резервных клеток), которые при возмущении различными сигналами из микроокружения: (i) дифференцируются вдоль железистого линии происхождения, или (ii) пролиферируют и вызывают гиперплазию. Это соответствует результатам исследований in vitro . 28 Однако несколько повышенный риск развития рака груди в случаях с обычной гиперплазией протоков 29, 30 нельзя объяснить только этими исследованиями.Прямое, ступенчатое, линейное прогрессирование обычной протоковой гиперплазии до протоковой карциномы низкой степени in situ , как предполагают некоторые исследователи, 31, 32, 33 , кажется маловероятным. Напротив, несколько линий доказательств подтверждают биологическую концепцию канцерогенеза de novo в груди, определяя атипичную протоковую гиперплазию как «нижний предел» протоковой карциномы in situ низкой степени злокачественности. 18, 34

      Однако не совсем ясно, являются ли миоэпителиальные клетки неотъемлемой частью пролиферативных заболеваний или они участвуют в реактивном процессе.Основываясь на наших настоящих открытиях, миоэпителиальные клетки, по-видимому, не участвуют в пролиферативных заболеваниях молочной железы, они скорее представляют собой персистирующий слой базальных клеток вокруг протоково-дольчатых структур в паренхиме молочной железы. Однако молекулярные исследования Lakhani et al ; 35 , демонстрирующие потерю гетерозиготности (LOH) также в миоэпителиальных клетках, прилегающих к карциноме молочной железы и вдали от них, противоречат нашей точке зрения.

      Интересно, что при ранних злокачественных внутрипротоковых заболеваниях молочной железы (атипичная гиперплазия протоков) и карциноме in situ (протоковая карцинома in situ ) фенотипы MIB1 + / CK5 / 14 + были спорадическими и ограничивались просветным отделом в очень небольшом количестве атипичных клеток. случаи протоковой гиперплазии, но не протоковой карциномы in situ невысокой степени по сравнению с обычной протоковой гиперплазией.Однако при атипичной лобулярной гиперплазии и лобулярной карциноме in situ частота их возникновения увеличивалась. Это можно объяснить разным характером роста протоковых и дольчатых новообразований. В то время как протоковая неоплазия замещает и разрушает нормальные железистые клетки, опухолевые клетки лобулярных неоплазий часто инфильтрируют нормальный эпителий, оставляя нормальные эпителиальные клетки в сетчатом виде между опухолевыми клетками. Преимущественно экспрессируемые цитокератины в пуле пролиферирующих опухолевых клеток были, по сути, кератинами железистого типа (CK8 / 18/19).Это согласуется с наблюдением, что> 95% инвазивных карцином молочной железы проявляют просветный фенотип (CK8 / 18/19) 12, 21, 36, 37, 38 , что указывает на то, что злокачественная трансформация эпителия молочной железы происходит в клетке. принадлежат к железистой линии. 15 Это дополнительно подтверждается исключительно редким возникновением карцином с фенотипом чистых стволовых клеток (CK5 + / CK8 / 18 / 19− / актин гладких мышц), что указывает на плохой прогноз 39 и миоэпителиальные злокачественные новообразования. 40

      В настоящем исследовании мы могли продемонстрировать, что монотипическая экспрессия железистых цитокератинов (CK8 / 18/19) во фракции роста как при атипичной гиперплазии протоков, так и при протоковой карциноме in situ невысокой степени выражена ярко. в отличие от гетерогенной морфологии и смешанного иммунофенотипа обычных протоковых гиперплазий.

      Тем не менее, небольшая фракция плохо дифференцированных in situ и инвазивных карцином протоков может развиваться непосредственно из клеток CK5 / 14 + или промежуточных клеток CK5 / 14 + / CK8 / 18/19 +, поскольку некоторые из этих опухолей экспрессируют обе подгруппы кератина. (не показано в этом исследовании).Это указывает на альтернативные пути канцерогенеза груди, что также отражено в недавних цитогенетических исследованиях и исследованиях молекул адгезии, проведенных нашей группой. 41, 42

      Мы пришли к выводу, что как при нормальной груди, так и при доброкачественных пролиферативных заболеваниях груди наблюдается гетерогенная пролиферация клеток-предшественников, железистых и миоэпителиальных клеток, а также их промежуточных предшественников в различных пропорциях. Напротив, внутрипротоковые неопластические поражения груди (атипичная протоковая гиперплазия и протоковая карцинома in situ невысокой степени) состоят из одного типа пролиферирующих клеток, а именно злокачественно трансформированных железистых эпителиальных клеток.Важность этого открытия для рутинной патологии заключается в том, что определение иммунофенотипического состава фракции роста позволяет проводить дифференциальную диагностику в морфологически неоднозначных случаях, например, обычная гиперплазия протоков против атипичной гиперплазии протоков , различные эволюционные черты которой могут быть легко обнаружены. может быть проиллюстрирован гипотезой взрослых клеток-предшественников. 13, 14 Таким образом, мы предлагаем эту концепцию в качестве оперативной модели для понимания гистогенеза доброкачественных и злокачественных заболеваний груди.

      Типы рака груди — патология груди | Патология Джона Хопкинса

      Доброкачественное изменение груди, при котором строма становится плотной, похожей на рубцовую ткань, которая искажает окружающую ткань.

      Изменение ДНК клетки. Некоторые мутации приводят к благоприятному изменению функции гена или белка, неблагоприятному изменению, потере функции или вообще отсутствию изменений (см. Также генетические мутации).

      Метод визуализации, использующий лучи радиации (рентгеновские лучи) для получения изображения тела.Маммограмма — это специализированная форма рентгеновского изображения.

      Междисциплинарная встреча врачей и лиц, осуществляющих уход за больными раком, включая патологов, онкологов-хирургов, медицинских онкологов, радиологов, медсестер и консультантов-генетиков, для обсуждения планов лечения отдельных пациентов.

      Доброкачественная гиперплазия (рост) эпителиальных клеток молочной железы, выстилающих протоки и дольки.

      Процесс, с помощью которого организм считывает код РНК, чтобы произвести белки.

      Масса или комок. Опухолевая масса может быть неопухолевой и возникать из-за чего-то вроде отека или воспаления. Масса опухоли также может быть неопластической и включать как доброкачественные, так и злокачественные опухоли.

      Метод визуализации, использующий цифровые двумерные изображения маммограммы для построения трехмерного изображения груди.

      Процесс копирования ДНК в РНК.

      Тип лечения, который специфически нацелен на одну молекулу или путь, вовлеченный в рост и прогрессирование раковых клеток.Примеры лечения рака груди включают препараты, нацеленные на HER-2, такие как трастузумаб и пертузумаб.

      Единица в груди, состоящая из долек и связанного с ними терминального протока. Грудь содержит бесчисленные дольчатые единицы терминального протока. Все карциномы молочной железы возникают из эпителиальных клеток в дольчатой ​​единице терминального протока.

      Болезнь, поражающая все тело.

      Лечение, которое может воздействовать на раковые клетки, потенциально распространившиеся по всему телу.Примеры включают химиотерапию, гормональную терапию и таргетную терапию. Системные методы лечения могут иметь побочные эффекты из-за воздействия на нормальные клетки тела, такие как выпадение волос или желудочно-кишечные расстройства.

      Соединительная ткань груди, то есть фиброзная ткань, в которой расположены эпителиальные элементы.

      Врач, специализирующийся на хирургическом лечении (удалении) онкологических заболеваний.

      Любое изменение, отмеченное пациентом, которое может быть вызвано болезнью.

      Термин для обычного лечения конкретного заболевания, основанный на прошлых исследованиях и опыте, подтверждающем эффективность и безопасность лечения.

      Биопсия стержневой иглы, которая выполняется с использованием маммограммы для выявления поражения и направления иглы для биопсии.

      Биопсия стержневой иглы, которая выполняется с использованием ультразвука (сонограммы) для локализации образования и направления иглы в правильное место.

      Мера того, насколько опухоль выросла и / или распространилась в организме (т. Е. Насколько развит рак). Наиболее распространенной системой стадирования является система TNM , которая обозначает T umor, лимфу N odes и M etastasis.Стадия варьируется от 0 до 4, причем стадия 0 является преинвазивным заболеванием (например, DCIS), а стадия 4 — метастатическим заболеванием. Стадия часто пишется римскими цифрами: стадия 0, стадия I, стадия II, стадия III и стадия IV. Стадия — это прогностический фактор, так как высокая стадия связана с худшим прогнозом или исходом.

      Процесс хирургического удаления сторожевых лимфатических узлов для выявления рака.

      Мутация гена, спонтанно возникающая в тканях тела или в раковых клетках и не передающаяся потомству (т.е., не передается по наследству).

      Процесс привлечения второй группы врачей для изучения вашей уникальной медицинской ситуации, чтобы высказать свое мнение о диагнозе и / или плане лечения.

      Термин, используемый для описания теста, который использовался для поиска болезни до , когда она вызвала симптомы. Маммография — это первичный скрининговый тест, используемый для выявления рака груди у женщин.

      Первый лимфатический узел в цепи регионарных узлов, отводящих лимфатическую жидкость от груди.Сторожевой лимфатический узел чаще всего располагается в подмышечной впадине (подмышечная впадина) и обычно является первым лимфатическим узлом, который будет поражен раком, когда рак начнет метастазировать.

      Рак, возникающий из соединительной ткани тела. Примеры включают ангиосаркому (возникающую из кровеносных сосудов) и лейомиосаркому (возникающую из гладкомышечных клеток).

      Доброкачественное разрастание грудных желез.

      Все, что увеличивает риск развития болезни.Для рака груди это семейный анамнез и возраст.

      Термин, используемый для описания баланса между риском (например, побочными эффектами) и пользой терапии, процедуры или другого курса действий.

      Молекулы

      РНК являются копией генетической информации, закодированной в ДНК, и эта копия РНК затем используется для создания белков.

      Исследовательское исследование, в ходе которого изучаются истории болезни и файлы пациентов для поиска результатов (исходов), которые уже имели место в прошлом.

      Шанс или вероятность развития болезни в определенный период времени.

      Лимфатические узлы, отводящие (собирающие) лимфатическую жидкость из определенной части тела. Основные региональные узлы груди находятся в подмышечной впадине, но также включают подключичные (под ключицей), надключичные (над ключицей) и внутренние молочные (под грудной мышцей) цепи лимфатических узлов.

      Уменьшение размера.

      Врачи-резиденты — это врачи, которые закончили медицинский институт и теперь углубленно изучают определенные области, такие как патология, внутренняя медицина, хирургия, педиатрия, радиология и другие.

      Тип исследования, в котором пациенты случайным образом распределяются по лечебным группам для получения экспериментального лечения («группа вмешательства») или стандартного лечения («контрольная группа»).

      Когда рак возвращается после того, как ранее был устранен. Это может быть местный рецидив в области груди, где впервые был обнаружен рак, или отдаленный рецидив, когда рак метастазирует в новый орган.

      Врач, специализирующийся на использовании направленной лучевой терапии для уничтожения опухолевых клеток в определенной области.

      Средство для лечения некоторых форм рака, при котором используется излучение высокой энергии для повреждения ДНК клеток. Это форма местной терапии груди или другой области, например костей.

      Врач, специализирующийся на использовании методов визуализации, таких как рентген, маммография, компьютерная томография и МРТ. Это может включать в себя просмотр сканированных изображений для обнаружения физических аномалий или новообразований или размещение иглы в точном месте для выполнения центральной биопсии.

      Тип биопсии, при котором исследуется кожа и непосредственно подлежащая ткань путем удаления небольшого круглого / столбчатого кусочка ткани.

      Подобно сложному склерозирующему поражению, радиальный рубец представляет собой доброкачественное новообразование в груди, которое содержит рубцеподобные изменения в строме и изогнутых железах.

      Научное исследование, которое проводится с участием новых пациентов и следит за их курсом для наблюдения за результатом

      Используемый термин описывает лечение, которое проводится за до заболевания, чтобы предотвратить его возникновение.

      Хирургическое удаление ткани груди для предотвращения развития рака.Один сценарий, в котором это может быть выполнено, — это пациенты с высоким риском развития рака груди в будущем, например, с известными мутациями зародышевой линии в BRCA1 или BRCA2 .

      Термин, используемый для описания продолжающегося роста рака.

      Мера того, насколько быстро растет опухоль, путем оценки количества делящихся клеток. Мера варьируется от 0% (нет деления клеток) до 100% (все клетки делятся). (См. Также Ki67.)

      Белок, отвечающий за связывание и обнаружение прогестерона в организме; рецептор расположен в ядрах многих типов клеток, включая клетки эпителия молочной железы.Некоторые виды рака экспрессируют рецептор прогестерона и называются «раковыми опухолями, положительными по рецепторам гормонов».

      Термин, используемый для описания ожидаемого исхода рака или заболевания (т. Е. Благоприятного или неблагоприятного).

      Результат теста, который можно использовать для прогнозирования прогноза пациента. Например, экспрессия рецептора эстрогена (ER) и рецептора прогестерона (PR) является благоприятным прогностическим признаком.

      Результат теста, который можно использовать для прогнозирования эффективности терапии.Прогностические биомаркеры помогают выбрать лечение. Например, положительность HER-2 является прогностическим биомаркером, который предсказывает, что опухоль ответит на терапию, направленную на HER-2.

      Половой гормон, вырабатываемый организмом, который участвует в сигнальном пути эстрогена.

      После менопаузы.

      Перед менопаузой.

      Термин, описывающий изменение размера и формы ядра клетки.

      Редкий тип фиброэпителиального поражения груди, который содержит неопластические стромальные клетки и связанный с ними доброкачественный эпителий.Опухоли филлодий отличаются от фиброаденом, потому что они более клеточные и имеют уникальный «листоподобный» характер роста. Опухоли филлодий могут быть доброкачественными, пограничными (то есть между доброкачественными и злокачественными) или злокачественными, и все они требуют хирургического удаления.

      Врач, специализирующийся на методах реконструкции груди для восстановления формы груди после мастэктомии.

      Тип исследования изображений, в котором используется радиоактивный элемент, прикрепленный к молекула сахара для обнаружения частей тела с быстрорастущими клетками (которые потребляют больше сахара), например раковых клеток.

      Способ обработки ткани для оценки ее под микроскопом; ткань фиксируется формалином и заделывается парафином, чтобы ее можно было тонко нарезать и превратить в слайды для просмотра под микроскопом.

      Около и во время менопаузы.

      Описание реакции рака на терапию под микроскопом.

      Врач, специализирующийся на диагностике болезней; патологи используют микроскоп, чтобы исследовать клетки ткани, чтобы определить, является ли ткань нормальной или раковой.

      Ткань органа.

      Лечение, направленное на облегчение боли и симптомов, а не на лечение болезни.

      Хирургическая процедура удаления яичника.

      Наличие клеток карциномы in situ в коже (эпидермисе) соска и ареола.

      Скрыто или неизвестно.

      Часть клетки, содержащая генетический материал клетки, ДНК.

      Гистологическая мера того, насколько близко ядро ​​раковой клетки похоже на ядро ​​нормальной клетки, или мера того, насколько аномальным является ядро ​​раковой клетки.Обычно он оценивается как 1 (похож на нормальный), 2 (умеренно ненормальный) и 3 (заметно ненормальный).

      Отношение размеров ядра к цитоплазме. При многих формах рака ядро ​​становится заметно и ненормально увеличенным, что приводит к аномальной характеристике «высокого отношения N: C».

      Место, где встречаются большие молочные протоки для выделения молочного белка во время лактации.

      Относится к ядру клетки.

      Терапия, которую назначают пациенту перед операцией , чтобы попытаться уменьшить размер опухоли.Неоадъювантная терапия обычно представляет собой химиотерапию или таргетную терапию, но также может включать гормональную терапию или лучевую терапию.

      Аномальный рост клональных клеток, то есть они произошли друг от друга и имеют общий генетический материал. Новообразования могут быть доброкачественными и злокачественными.

      Установка металлической проволоки в массу радиологом, чтобы помочь хирургу-онкологу (хирургу) определить местонахождение образования во время операции.

      Клетка, образующая строму или фиброзную ткань груди.Миофибробласты груди также могут реагировать на изменения уровня эстрогена в организме.

      Клетка, окружающая нормальные протоки и дольки молочной железы; миоэпителиальные клетки обладают некоторыми сократительными свойствами, а также производят нормальную базальную мембрану, окружающую протоки и дольки. Миоэпителиальные клетки все еще присутствуют вокруг протоков, содержащих карциному in situ, однако инвазивные карциномы не имеют миоэпителиальных клеток.

      Метод визуализации, использующий мощное магнитное поле и радиоволны для получения снимков тканей глубоко в теле.

      Подход к уходу за пациентами, который включает в себя несколько медицинских дисциплин и позволяет общаться между врачами и опекунами разных специальностей. В области лечения рака груди это включает в себя консультантов-генетиков, медицинских онкологов, медсестер-навигаторов, патологов, онкологов-радиологов, радиологов и онкологов-хирургов. Усаживая всех одновременно, поставщики медицинских услуг могут лучше координировать уход, что приводит к лучшему уходу за пациентами.

      Классификация рака на основе экспрессии его гена.

      Процесс, при котором клетка делится на две клетки. Под микроскопом делящиеся клетки можно идентифицировать по обнаженным хромосомам (ДНК).

      Подсчет количества делящихся клеток в образце. Количество митотических клеток обычно измеряется количеством митотических клеток на 10 полей высокого увеличения (HPF). Чем больше митотических клеток присутствует, тем быстрее клетки растут.

      Место доброкачественного образования внутри дольчатых единиц терминального протока. Не требует хирургического иссечения.

      Устройство, используемое патологами для исследования тканей на предметных стеклах; микроскоп увеличивает ткань, чтобы патолог мог исследовать отдельные клетки и поставить диагноз.

      Рак груди, который распространяется за пределы груди и разрастается в отдаленном органе, таком как кости, печень, легкие или мозг.

      Небольшие скопления кальция, которые видны на маммограмме и могут быть связаны либо с доброкачественными процессами (такими как фиброзно-кистозные изменения), либо с атипичными процессами (такими как DCIS или инвазивный рак).

      Распространение и присутствие раковых клеток, которые распространились на другие органы тела за пределами первичного очага.

      Естественный процесс, при котором у женщины прекращается менструальный цикл; обычно это происходит в конце 40-50-х годов. Яичники больше не овулируют (т.е. больше не производят яйцеклетки) и больше не производят гормон эстроген.

      Врач, специализирующийся на лечении рака с помощью гормональной терапии, химиотерапии и таргетной терапии.

      Воспаление протоков молочных желез.

      Операция, при которой хирург удаляет грудь.

      «Край» образца, содержащий ободок из нормально выглядящей ткани вокруг опухоли. Патологи оценивают краевую ткань под микроскопом, чтобы убедиться, что опухоль полностью удалена. «Отрицательные» или чистые поля означают, что вся опухоль была удалена. «Положительные» или вовлеченные поля означают, что опухоль не была удалена полностью и может потребоваться дополнительная операция

      Шишка или припухлость.Масса может быть из-за избытка жидкости или аномального роста клеток; рост клеток может быть доброкачественным или злокачественным.

      Радиологический тест, при котором используются рентгеновские снимки груди, используемые для поиска аномалий, включая образования или патологические образцы микрокальцификаций.

      Относится к груди или тканям груди.

      Протоки и дольки груди, вырабатывающие молочный белок; протоки соединяются у соска, выделяя молоко на поверхность кожи.

      Наличие раковых клеток, распространяющихся по лимфатическим каналам.

      Раковые клетки, способные проникать в окружающие ткани и способные метастазировать (распространяться) в лимфатические узлы и отдаленные органы.

      Тип лейкоцитов, принадлежащих иммунной системе. Лимфоциты выполняют множество функций, включая борьбу с вирусами и раком.

      Отек тела из-за скопления лимфатической жидкости; это может произойти в руках и руках после удаления лимфатических узлов во время операции.

      Небольшие каналы, по которым лимфатическая жидкость проходит по всему телу и вытекает через лимфатические узлы.

      Маленькие органы, состоящие из групп лимфоцитов (иммунных клеток), которые фильтруют лимфатическую жидкость, протекающую по лимфоваскулярным или лимфатическим каналам тела. Рак часто сначала использует лимфатические каналы для распространения по телу. Рак молочной железы обычно сначала распространяется на лимфатические узлы в подмышечной впадине, а затем распространяется в других частях тела.

      Хирургическая процедура, при которой из груди удаляется ограниченное количество ткани, включая опухоль и непосредственно окружающую ткань.

      Группа раковых заболеваний, определяемых экспрессией определенных генов; большинство раковых образований в просвете молочной железы являются положительными по рецепторам эстрогена (ER).

      Масса.

      Эпителиальные клетки, выстилающие протоки молочной железы.

      Рак, который еще не распространился на близлежащие ткани (путем прямой инвазии) или на отдаленные органы (путем метастазирования).

      Лечение, направленное только на анатомическую область опухоли; например, хирургическое вмешательство и облучение груди — это местные методы лечения.

      См. Дольку груди.

      Иммуноокрашивание, которое маркирует ген, участвующий в пролиферации или росте клеток. Степень маркировки Ki67 в раковой клетке коррелирует с тем, насколько быстро опухоль растет и насколько она агрессивна. Мера варьируется от 0% (нет деления клеток) до 100% (все клетки делятся). См. Также индекс распространения.

      Аномальное разрастание клеток в протоках и долях груди; в этих клетках отсутствует экспрессия E-кадгерина, и они могут быть клетками-предшественниками инвазивной лобулярной карциномы.Наличие LCIS увеличивает риск последующего развития рака обеих молочных желез у пациента.

      Модель роста, при которой раковые клетки прорастают (вторгаются) в окружающие ткани (см. Также инфильтрацию).

      Что-то, что происходит во время операции. Например, во время операции делают замороженный разрез.

      Доброкачественный сосочковый рост клеток, полностью расположенный внутри протоков груди. Это может вызвать выделения из сосков.

      Лимфатический узел, расположенный в груди.

      «Внутри воздуховода.«Это относится к чему-то, что полностью находится внутри воздуховода и не выходит за границы стенки воздуховода.

      Результат присутствия иммунных клеток («воспалительных» клеток) в части тела. Воспаленные участки тела часто выглядят опухшими и красными.

      Редкий и агрессивный тип рака груди, при котором раковые клетки проникают в лимфоваскулярные пространства дермы кожи, вызывая изменения в вышележащей коже груди. Кожа часто выглядит опухшей, утолщенной, покрытой ямочками и красной.

      Модель роста, при которой раковые клетки прорастают (вторгаются) в окружающие ткани (см. Также инвазивный).

      Тип лечения, использующий иммунную систему для борьбы с раком; эти методы лечения нацелены на белки, экспрессируемые иммунными клетками или на раковых клетках.

      Тип лабораторного теста, который может обнаруживать белки, экспрессируемые клеткой. В тесте используются специальные антитела («иммуноокрашенные»), каждое из которых связывается с конкретным рассматриваемым белком; Иммуноокрашивание изменит цвет ткани, чтобы показать, присутствует ли белок.Примеры включают иммуногистохимию для поиска сверхэкспрессии HER-2, а также экспрессию рецептора эстрогена (ER) и рецептора прогестерона (PR) в клетках рака груди.

      Естественная защита организма от заражения такими микроорганизмами, как бактерии и вирусы. Иммунные клетки постоянно ищут клетки, которые выглядят «чужеродными». Помимо микроорганизма, иммунные клетки могут также распознавать раковых клеток как «чужеродных», поскольку раковые клетки могут экспрессировать аномальные белки.Таким образом, иммунная система иногда может быть частью атаки организма против рака.

      Рецепторный белок, который связывает гормоны внутри клетки, чтобы влиять на изменения внутри клетки. Опухоли с большим количеством рецепторов гормонов нуждаются в гормонах для роста.

      Увеличено количество ячеек. Это может быть доброкачественным (см. Обычная гиперплазия протоков) или атипичным (см. Атипичная гиперплазия протоков).

      Форма системного лечения, которая блокирует попадание гормонов в раковые образования с рецепторами гормонов.Одним из примеров является тамоксифен.

      Вещество, попадающее в кровь, влияет на поведение и рост других тканей. Примеры включают эстроген, прогестерон и андроген.

      Относительно внешнего вида клеток и тканей под микроскопом.

      Сигнатура молекулярного гена, связанная с амплификацией гена HER-2.

      Область ткани, видимая при максимальном увеличении микроскопа (т. Е. Наиболее «увеличенная»).

      Белок, называемый тирозинкиназой, который экспрессируется на поверхности всех клеток и помогает клеткам расти.Некоторые виды рака сверхэкспрессируют HER-2 / neu на своей поверхности, то есть они имеют больше копий гена и, следовательно, белка, чем обычно; они называются «HER-2-положительными» опухолями. Эта сверхэкспрессия HER-2 позволяет клеткам аномально расти. Существует несколько типов лекарств, которые напрямую воздействуют на белок HER-2 на раковые клетки; одним из примеров является трастузумаб.

      Тип красителя, который наносится на срезы тканей, чтобы клетки поглощали цвет и их можно было увидеть невооруженным глазом под микроскопом.Этот краситель делает ядра синими, а цитоплазму розовыми.

      Гистологическое описание того, насколько близко раковые клетки напоминают свои нормальные клетки происхождения. В груди общий балл рассчитывается исходя из скорости митоза, степени ядерной атипии и степени образования железы. Итоговая оценка будет 1, 2 или 3. Как правило, более высокая степень опухоли связана с более агрессивным поведением.

      Небольшой тонкий прямоугольный кусок стекла, куда помещаются срезы ткани из биопсии или хирургического образца и окрашиваются красителем, чтобы ткань можно было исследовать под микроскопом.

      Ткани тела, вырабатывающие белковые выделения; железы имеют форму небольших круглых структур. В груди протоки и дольки — это железистая ткань, вырабатывающая молочный белок. Раковые образования, возникающие в железах, называются «аденокарциномами» (см. Также молочную железу).

      Мутация в ДНК, которая присутствует при рождении и может передаваться от родителей к ребенку.

      Изменение ДНК клетки. Некоторые мутации приводят к благоприятному изменению функции гена или белка, неблагоприятному изменению, потере функции или вообще отсутствию изменений (см. Также мутации).

      Тест ДНК пациента для поиска определенных генных мутаций или других аномалий, которые могут вызвать рак или другие заболевания.

      Встреча пациента и медицинского генетика или консультанта для обсуждения потенциального воздействия результата генетического теста на здоровье пациента и его семью.

      Член медицинской бригады, специализирующийся на диагностике и интерпретации результатов генетических тестов. Можно проконсультироваться с генетиком, чтобы помочь понять мутации зародышевой линии или соматические мутации.

      Лабораторный тест, который анализирует экспрессию нескольких генов, чтобы определить, какие белки создают опухолевые клетки.

      Отдельная последовательность ДНК, кодирующая белок.

      Метод, который патологоанатомы могут применять во время операции (т. Е. Во время операции), чтобы быстро заморозить кусок ткани пациента, чтобы взять тонкие срезы и сделать слайд для оценки «в реальном времени» во время операции. все еще продолжается. Иногда это делается на сторожевых лимфатических узлах груди, чтобы сообщить хирургу, есть ли там метастатические раковые клетки.Однако результаты являются только предварительными и должны быть подтверждены рассмотрением окончательных разделов FFPE.

      Термин, используемый для описания того, как свежие образцы тканей обрабатываются и хранятся, чтобы их можно было сделать и исследовать патологом. Свежие ткани «фиксируются» в консерванте, называемом формалином, чтобы ткани не разлагались или не разлагались. Затем их «заделывают» в парафин, то есть помещают в небольшой блок или воск, похожий на воск для свечей, чтобы их можно было легко нарезать тонкими ломтиками и поместить на предметное стекло для просмотра патологоанатомом.

      Тип биопсии, при котором полая игла используется для аспирации (отсасывания) небольших скоплений и отдельных клеток из массы.

      Лабораторный тест, который можно использовать для поиска амплификации гена HER-2 / neu при раке груди. В этом тесте используется молекула зонда, к которой прикреплена флуоресцентная метка; когда присутствует ген HER-2 / neu, зонд связывается с геном и ярко светится. Количество генов можно подсчитать с помощью специального флуоресцентного светового микроскопа.

      Категория опухолей, которые содержат пролиферации как стромальных, так и эпителиальных клеток.В эту категорию входят фиброаденома и филлодийная опухоль.

      Нормальный доброкачественный процесс, который происходит в груди, при котором в ткани развиваются маленькие или большие кисты, разрастание доброкачественного эпителия и усиление фиброза. Из-за этого грудь может казаться бугристой или бугристой. Эти изменения могут быть болезненными и обычно меняются в течение менструального цикла.

      Доброкачественное поражение груди, содержащее как стромальные, так и эпителиальные клетки. Фиброаденомы являются наиболее распространенным типом фиброэпителиального поражения груди и чаще всего встречаются у молодых взрослых женщин.Фиброаденомы не требуют хирургического удаления, но их можно удалить, если они растут или имеют симптомы, например, вызывают боль.

      Процесс, возникающий при гибели жировых клеток; эти жировые клетки составляют жировую ткань груди и могут подвергнуться некрозу жира из-за травмы или хирургического вмешательства. Некроз жира может образовывать пальпируемое образование или образование, видимое на изображениях, что приводит к необходимости проведения биопсии стержневой иглой. Однако некроз жировой ткани — это доброкачественная находка, и со временем она проходит спонтанно.

      История болезни всех биологических (связанных с кровью) членов семьи; этот семейный медицинский анамнез может показать образцы общих заболеваний. Поскольку у вас общие гены с членами вашей семьи, «положительный семейный анамнез» определенных заболеваний может рассматриваться как фактор риска развития болезни у человека.

      Отрицательный результат теста, который на самом деле должен быть положительным (т. Е. Неправильный результат теста, который говорит о том, что у человека нет болезни, что означает, что этот человек действительно болен).

      Положительный результат теста, который на самом деле должен быть отрицательным (т. Е. Неправильный результат теста, который указывает на то, что у человека положительный результат на болезнь, которая фактически не вызывает болезни).

      Белок, отвечающий за связывание и обнаружение эстрогена в организме; рецептор расположен в ядрах многих типов клеток, включая клетки эпителия молочной железы. Раковые образования, которые экспрессируют рецептор эстрогена, называются «раком, положительным по рецепторам гормонов».

      Хирургическая процедура по удалению аномальной области груди для постановки точного диагноза.Эксцизионная биопсия обычно выполняется либо когда биопсия стержневой иглой невозможна (т. Е. Аномальная область находится слишком глубоко в ткани молочной железы, чтобы ее можно было достичь стержневой иглой), либо когда стержневая биопсия дала диагноз атипии и дополнительных тканей. необходим, чтобы поставить точный диагноз: рак или доброкачественный.

      Главный женский половой гормон, отвечающий за многие физиологические функции организма. Эстроген вырабатывается яичниками и надпочечниками. Эстроген вызывает нормальный рост многих типов клеток в груди.Некоторым видам рака для роста требуется эстроген.

      Тип клетки в организме, который составляет множество различных типов тканей, включая протоки и дольки груди. Эти специализированные эпителиальные клетки называются «протоковыми» или «просветными» клетками груди. Эпителиальные клетки в других частях тела выстилают поверхность тела (например, «плоский эпителий» кожи) и полости тела. Эпителиальная клетка является клеткой или источником карциномы.

      Отек части тела из-за избытка жидкости (см. Также лимфедему).

      Часть клетки вне ядра, но все еще внутри клеточной мембраны.

      Молекула, содержащая все ваши гены, расположенная в ядре клетки … длинная сложная молекула, с помощью которой кодируются ваши гены.

      Доброкачественное, заполненное жидкостью пространство, выстланное эпителием; кисты могут вызывать ощущение неровности или неровностей груди.

      Тип изображения, при котором для получения трехмерных изображений используются рентгеновские лучи. КТ обычно не используется для визуализации груди.

      Консультация по патологии происходит, когда образец отправляется во второе (или иногда третье) учреждение для проверки результатов. Это может произойти, когда другим патологоанатомам требуется помощь в особенно сложном или редком случае, или если пациент или клиницист хотят получить второе мнение по этому случаю.

      Тонкие кусочки ткани, взятые тонкой иглой; ткань отправляется патологам для оценки и постановки диагноза. Биопсия молочной железы с помощью стержневой иглы выполняется с использованием радиографической визуализации, выполняемой одновременно с тем, чтобы направить иглу в правильное место.Используемая визуализация может быть маммограммой («стереотаксическая сердцевинная биопсия»), ультразвуком («сердцевинная биопсия» или «сердцевинная биопсия под ультразвуковым контролем) или МРТ (сердцевинная биопсия под контролем МРТ»).

      Слой клеток, выстилающий внешнюю часть тела, выстилающий внутреннюю часть полостей тела и выстилающий внешнюю и внутреннюю части органов тела. Эпителий — это один из четырех типов тканей тела; другие три типа — это соединительная ткань (например, жировая и фиброзная ткань), мышечная ткань и ткань нервной / нервной системы.Эпителий, выстилающий каждую из поверхностей тела, имеет разные названия; например, эпителий, выстилающий внешнюю часть тела, называется кожей, а эпителий, выстилающий внутреннюю часть грудной полости, называется плеврой. Эпителий в груди состоит из слоя клеток, образующих протоки и дольки, которые производят молочный белок во время лактации (грудного вскармливания).

      Тип доброкачественного изменения клеток, выстилающих грудь, из-за которого под микроскопом они кажутся выше, как столбики.

      Системный препарат для лечения рака, убивающий делящиеся клетки. Иногда это приводит к нежелательным побочным эффектам, таким как выпадение волос, поскольку химиотерапевтические препараты также убивают нормальные делящиеся клетки организма.

      Исследование, организованное больницей, организацией или другой группой для систематического и тщательного изучения нового лекарства, техники или другого подхода к лечению. Клинические испытания тщательно контролируются, чтобы убедиться, что они проводятся безопасным, этичным и справедливым образом.

      Процесс роста новых кровеносных сосудов, необходимых для роста раковых клеток.

      Тип мутации ДНК, при которой один ген дублируется несколько раз для увеличения его активности.

      Адъювантная терапия — это любое лечение, проводимое в дополнение к хирургическому вмешательству. Он может включать химиотерапию, лучевую терапию или другое лечение. Это контрастирует с неоадъювантной химиотерапией, которая проводится перед операцией .

      Тип карциномы (рака), который возникает из железистых клеток.

      Абсолютный и относительный риск — это два разных способа измерения риска. Относительный риск сравнивает риски между группами, в то время как абсолютный риск — это общая вероятность того, что что-то, например, болезнь, произойдет в определенный период времени.

      Круглый участок пигментированной (темной тени) кожи вокруг соска на груди.

      Технический термин, обозначающий ткани в области подмышек («подмышки»).

      Часть ткани груди, доходящая до подмышечной впадины.

      Хирургическая процедура, при которой хирург исследует жир в подмышечной впадине на предмет лимфатических узлов, которые затем отправляются на патологическое исследование для исследования под микроскопом на наличие рака.

      Неравномерный и беспорядочный рост протоков, выстилающих эпителий. В отличие от обычной гиперплазии протоков, атипичная дольчатая гиперплазия считается ранней стадией рака. Атипичная дольчатая гиперплазия возникает из долек груди.

      Заболевание, при котором эпителиальные клетки молочной железы аномально разрастаются в протоках.Атипичная гиперплазия протоков не является раком, но увеличивает риск последующего развития рака груди.

      Тип рака, возникающий из эпителиальной клетки.

      С «обеих сторон», например, с обеих грудей. Это контрастирует с односторонним, что означает только с одной стороны.

      Неопластический (клональный) рост клеток с возможностью метастазирования (распространения по всему телу). Рак может возникать из эпителиальных клеток («карциномы»), меланоцитов («меланомы»), клеток стромы или соединительной ткани («саркомы») и лимфоидных клеток («лимфомы и лейкемии»).

      Определенный тип рака, классифицируемый на основе его ДНК. Эти виды рака обычно являются «тройными отрицательными», поскольку они не экспрессируют рецептор прогестерона, рецептор эстрогена или HER2 / neu.

      Долька — это железа, которая в первую очередь производит молоко в груди. Набор долек вместе с небольшим протоком составляют конечные протоковые дольчатые единицы груди.

      Трубчатая конструкция, по которой молоко передается от конечной долевой единицы протока к соску.

      Трубчатая структура, по которой кровь переносится как к различным частям тела, так и от них. Это включает артерии, вены и капилляры.

      Любое химическое вещество или белок, созданное организмом, которое можно измерить и которое можно использовать для получения полезной информации, например, о том, растет или уменьшается рак во время лечения. Биомаркеры также могут предоставить информацию о прогнозе рака (прогностический биомаркер), а также о том, будет ли рак реагировать на определенные методы лечения (прогностический биомаркер).

      Хирургическая процедура, при которой хирург удаляет ткань обеих молочных желез.

      Неинвазивная клональная пролиферация эпителиальных клеток, не способных проникать в нормальную ткань или распространяться по организму. Иногда это называют «предраком».

      Без злокачественных новообразований. Доброкачественная опухоль не может проникнуть в близлежащие ткани или распространиться на другие части тела.

      без названия

      % PDF-1.5 % 79 0 объект > эндобдж 66 0 объект > эндобдж 67 0 объект > поток приложение / pdfdoi: 10.1136 / gutjnl-2013-306171;

    • без названия
    • 2014-12-02T14: 42: 48 + 05: 30Arbortext Advanced Print Publisher 10.0.1465 / W Unicode2021-10-13T16: 17: 31-07: 002021-10-13T16: 17: 31-07: 00 Acrobat Distiller 10.1.5 (Windows) uuid: a1f71bb3-0f50-4605-97b5-8f9781db9fb6uuid: 7e2a2b6d-1dd2-11b2-0a00-b800f895d2ff10.1136 / gutjnl-2013-306171http: //dx. -01false10.1136 / gutjnl-2013-306171
    • http://gut.bmj.com/
    • 10.1136 / gutjnl-2013-3061712014-12-01true
    • http: // gut.bmj.com/
    • конечный поток эндобдж 63 0 объект > эндобдж 65 0 объект > эндобдж 80 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageB / ImageC / ImageI] / Properties> / Shading> / XObject >>> / Rotate 0 / Thumb 54 0 R / Type / Page >> эндобдж 1 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 55 0 R / Type / Page >> эндобдж 4 0 obj > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 56 0 R / Type / Page >> эндобдж 8 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 57 0 R / Type / Page >> эндобдж 11 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 58 0 R / Type / Page >> эндобдж 15 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 59 0 R / Type / Page >> эндобдж 19 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 60 0 R / Type / Page >> эндобдж 23 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 61 0 R / Type / Page >> эндобдж 29 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 62 0 R / Type / Page >> эндобдж 400 0 объект [403 0 R] эндобдж 401 0 объект > поток HWrF} W «) Ad, YJTj ڂ 91 nŲ ~ t E ~ Lw>} j {] \ v3sg 狄%]; b N7mˋ_w7ko6 * + NR ޹ yB! Ŋdſ آ +] на 㸋 _Suy [/ I) 7r 2> А.[-VEu m’۲n

      Ключевые этапы развития молочной железы — Альвеолярный переключатель: координация пролиферативных сигналов и решений клеточной судьбы, которые управляют формированием лобулоальвеол из протокового эпителия | Исследование рака груди

    • 1.

      Brisken C: Гормональный контроль альвеолярного развития и его значение для канцерогенеза груди. J Mammary Gland Biol Neoplasia. 2002, 7: 39-48. 10.1023 / А: 1015718406329.

      Артикул PubMed Google ученый

    • 2.

      Кардифф Р.Д., Веллингс С.Р .: Сравнительная патология молочных желез человека и мыши. J Mammary Gland Biol Neoplasia. 1999, 4: 105-122. 10.1023 / А: 10187124.

      CAS Статья PubMed Google ученый

    • 3.

      Ричерт М.М., Швертфегер К.Л., Райдер Дж. У., Андерсон С. М.: атлас развития молочной железы мыши. J Mammary Gland Biol Neoplasia. 2000, 5: 227-241. 10.1023 / А: 1026499523505.

      CAS Статья PubMed Google ученый

    • 4.

      Streuli CH, Edwards GM, Delcommenne M, Whitelaw CB, Burdon TG, Schindler C, Watson CJ: Stat5 как мишень для регуляции внеклеточным матриксом. J Biol Chem. 1995, 270: 21639-21644. 10.1074 / jbc.270.45.26794.

      CAS Статья PubMed Google ученый

    • 5.

      Fata JE, Werb Z, Bissell MJ: Регулирование морфогенеза ветвления молочных желез внеклеточным матриксом и его ферментами ремоделирования. Рак молочной железы Res. 2004, 6: 1-11.

      CAS PubMed Google ученый

    • 6.

      Невилл MC, McFadden TB, Forsyth I: Гормональная регуляция дифференцировки молочных желез и секреции молока. J Mammary Gland Biol Neoplasia. 2002, 7: 49-66. 10.1023 / А: 1015770423167.

      Артикул PubMed Google ученый

    • 7.

      Рудольф М.К., Макманаман Д.Л., Хантер Л., Фанг Т., Невилл М.К.: Функциональное развитие молочной железы: использование профилей экспрессии и кластеризации траекторий для выявления изменений в экспрессии генов во время беременности, лактации и инволюции.J Mammary Gland Biol Neoplasia. 2003, 8: 287-307. 10.1023 / B: JOMG.0000010030.73983.57.

      Артикул PubMed Google ученый

    • 8.

      Нгуен Д.А., Парлоу А.Ф., Невилл М.К.: Гормональная регуляция закрытия плотных соединений в эпителии молочных желез мышей во время перехода от беременности к лактации. J Endocrinol. 2001, 170: 347-356. 10.1677 / joe.0.1700347.

      CAS Статья PubMed Google ученый

    • 9.

      Невилл М.С., Медина Д., Монкс Дж., Хови Р.С.: Жировая подушечка молочной железы. J Mammary Gland Biol Neoplasia. 1998, 3: 109-116. 10.1023 / А: 1018786604818.

      CAS Статья PubMed Google ученый

    • 10.

      Джонов В., Андрес А.С., Зиемецки А. Ремоделирование сосудов во время нормального и злокачественного жизненного цикла молочной железы. Microsc Res Tech. 2001, 52: 182-189. 10.1002 / 1097-0029 (20010115) 52: 2 <182 :: AID-JEMT1004> 3.0.CO; 2-M.

      CAS Статья PubMed Google ученый

    • 11.

      Лукас Б.К., Орманди С.Дж., Бинарт Н., Бриджес Р.С., Келли П.А.: Нулевая мутация гена рецептора пролактина вызывает дефект в материнском поведении. Эндокринология. 1998, 139: 4102-4107. 10.1210 / en.139.10.4102.

      CAS Статья PubMed Google ученый

    • 12.

      Смолли М., Эшворт A: Стволовые клетки и рак груди: поле в пути. Нат Рев Рак. 2003, 3: 832-844. 10.1038 / nrc1212.

      CAS Статья PubMed Google ученый

    • 13.

      DeOme KB, Faulkin LJJ, Bern HA, Blair PB: Развитие опухолей молочной железы из гиперпластических альвеолярных узлов, трансплантированных в жировые подушечки молочных желез самок мышей C3H. Исследования рака. 1959, 19: 515-520.

      CAS PubMed Google ученый

    • 14.

      Smith GH, Boulanger CA: Эпителиальные стволовые клетки молочных желез: трансплантация и анализ самообновления. Cell Prolif. 2003, 36: 3-15. 10.1046 / j.1365-2184.36.s.1.2.x.

      CAS Статья PubMed Google ученый

    • 15.

      Шеклтон М., Ф. В., Симпсон К. Дж., Стингл Дж., Смайт Г. К., Асселин-Лабат М. Л., Ву Л., Линдеман Г. Дж., Висвадер Дж. Э .: Создание функциональной молочной железы из одной стволовой клетки. Природа. 2006, 439: 84-88. 10.1038 / природа04372.

      CAS Статья PubMed Google ученый

    • 16.

      Смолли М.Дж., Кларк РБ: «Побочная популяция» молочной железы: предполагаемый маркер стволовых / предшественников ?. J Mammary Gland Biol Neoplasia. 2005, 10: 37-47.10.1007 / s10911-005-2539-0.

      Артикул PubMed Google ученый

    • 17.

      Стингл Дж., Рауф А., Эмерман Дж. Т., Ивс К. Дж.: Эпителиальные предшественники в нормальной молочной железе человека. J Mammary Gland Biol Neoplasia. 2005, 10: 49-59. 10.1007 / s10911-005-2540-7.

      Артикул PubMed Google ученый

    • 18.

      Traurig H: пролиферация клеток в молочной железе на поздних сроках беременности и в период лактации.Анатомическая запись. 1967, 157: 489-503. 10.1002 / ar.10309.

      Артикул Google ученый

    • 19.

      Brisken C, Park S, Vass T, Lydon JP, O’Malley BW, Weinberg RA: паракринная роль эпителиального рецептора прогестерона в развитии молочной железы. Proc Natl Acad Sci USA. 1998, 95: 5076-5081. 10.1073 / pnas.95.9.5076.

      CAS Статья PubMed PubMed Central Google ученый

    • 20.

      Conneely OM, Jericevic BM, Lydon JP: рецепторы прогестерона в развитии молочной железы и туморогенезе. J Mammary Gland Biol Neoplasia. 2003, 8: 205-214. 10.1023 / А: 1025952

      4.

      Артикул PubMed Google ученый

    • 21.

      Кларк Р.Б., Хауэлл А., Поттен С.С., Андерсон Е: диссоциация между экспрессией стероидных рецепторов и пролиферацией клеток в груди человека. Cancer Res. 1997, 57: 4987-4991.

      CAS PubMed Google ученый

    • 22.

      Grimm SL, Seagroves TN, Kabotyanski EB, Hovey RC, Vonder-haar BK, Lydon JP, Miyoshi K, Hennighausen L, Ormandy CJ, Lee AV и др .: Нарушение паттерна стероидных и пролактиновых рецепторов в молочной железе коррелирует с блок в лобуло-альвеолярном развитии. Молекулярная эндокринология. 2002, 16: 2675-2691. 10.1210 / me.2002-0239.

      CAS Статья PubMed Google ученый

    • 23.

      Brisken C, Heineman A, Chavarria T, Elenbaas B, Tan J, Dey SK, McMahon JA, McMahon AP, Weinberg RA: Существенная функция Wnt-4 в развитии молочной железы после передачи сигналов прог-эстерона.Genes Dev. 2000, 14: 650-654.

      CAS PubMed PubMed Central Google ученый

    • 24.

      Fata JE, Kong YY, Li J, Sasaki T, Irie-Sasaki J, Moorehead RA, Elliott R, Scully S, Voura EB, Lacey DL, et al: Фактор дифференциации остеокластов остеопротегерин-лиганд имеет важное значение для развития молочной железы. Клетка. 2000, 103: 41-50. 10.1016 / S0092-8674 (00) 00103-3.

      CAS Статья PubMed Google ученый

    • 25.

      Cao Y, Karin M: NF-kappaB в развитии молочной железы и раке груди. J Mammary Gland Biol Neoplasia. 2003, 8: 215-223. 10.1023 / А: 1025

      8934.

      Артикул PubMed Google ученый

    • 26.

      Said TK, Conneely OM, Medina D, O’Malley BW, Lydon JP: Прог-эстерон, помимо эстрогена, индуцирует экспрессию циклина D1 в эпителиальных клетках молочной железы мыши in vivo. Эндокринология. 1997, 138: 3933-3939. 10.1210 / en.138.9.3933.

      CAS PubMed Google ученый

    • 27.

      Mulac-Jericevic B, Lydon JP, DeMayo FJ, Conneely OM: Дефектный морфогенез молочной железы у мышей, лишенных изоформы рецептора прог-эстерона B. Proc Natl Acad Sci USA. 2003, 100: 9744-9749. 10.1073 / pnas.1732707100.

      CAS Статья PubMed PubMed Central Google ученый

    • 28.

      Binart N, Helloco C, Ormandy CJ, Barra J, Clement-Lacroix P, Baran N, Kelly PA: Спасение доимплантационного развития яйцеклетки и имплантации эмбриона мышам с дефицитом рецептора пролактина после введения прогестерона.Эндокринология. 2000, 141: 2691-2697. 10.1210 / en.141.7.2691.

      CAS Статья PubMed Google ученый

    • 29.

      Орманди С.Дж., Камю А., Барра Дж., Дамотт Д., Лукас Б., Бюто Х, Эдери М., Брусс Н., Бабине С., Бинарт Н. и др.: Нулевая мутация гена рецептора пролактина вызывает множественные репродуктивные дефекты. в мышке. Genes Dev. 1997, 11: 167-178.

      CAS Статья PubMed Google ученый

    • 30.

      Brisken C, Kaur S, Chavarria TE, Binart N, Sutherland RL, Wein-berg RA, Kelly PA, Ormandy CJ: Пролактин контролирует развитие молочной железы с помощью прямых и косвенных механизмов. Developmental Biol. 1999, 210: 96-106. 10.1006 / dbio.1999.9271.

      CAS Статья Google ученый

    • 31.

      Wynick D, Hammond PJ, Akinsanya KO, Bloom SR: Галанин регулирует базальную и стимулируемую эстрогенами функцию лактотрофа. Природа. 1993, 364: 529-532.10.1038 / 364529a0.

      CAS Статья PubMed Google ученый

    • 32.

      Naylor MJ, Ginsburg E, Iismaa TP, Vonderhaar BK, Wynick D, Ormandy CJ: Нейропептид галанин усиливает развитие лобулоальв-оларов. J Biol Chem. 2003, 278: 29145-29152. 10.1074 / jbc.M303746200.

      CAS Статья PubMed Google ученый

    • 33.

      Naylor MJ, Oakes SR, Gardiner-Garden M, Harris J, Blazek K, Ho TW, Li FC, Wynick D, Walker AM, Ormandy CJ: Транскрипционные изменения, лежащие в основе секреторной фазы активации развития молочной железы.Мол Эндокринол. 2005, 19: 1868-1883. 10.1210 / me.2004-0254.

      CAS Статья PubMed Google ученый

    • 34.

      Wynick D, Small CJ, Bacon A, Holmes FE, Norman M, Ormandy CJ, Kilic E, Kerr NC, Ghatei M, Talamantes F и др.: Галанин регулирует высвобождение пролактина и пролиферацию лактотрофов. Proc Natl Acad Sci USA. 1998, 95: 12671-12676. 10.1073 / pnas.95.21.12671.

      CAS Статья PubMed PubMed Central Google ученый

    • 35.

      Allan GJ, Tonner E, Barber MC, Travers MT, Shand JH, Vernon RG, Kelly PA, Binart N, Flint DJ: гормон роста, действуя частично через ось инсулиноподобного фактора роста, спасает развитие, но не метаболизм, активность в молочной железе мышей, экспрессирующих единственный аллель рецептора пролактина. Эндокринология. 2002, 143: 4310-4319. 10.1210 / en.2001-211191.

      CAS Статья PubMed Google ученый

    • 36.

      Всадник Н.Д .: Пролактин и развитие молочной железы.J Mammary Gland Biol Neoplasia. 1999, 4: 79-88. 10.1023 / А: 1018708704335.

      CAS Статья PubMed Google ученый

    • 37.

      Хеннигхаузен L, Робинсон GW: Информационные сети в молочной железе. Nature Rev Mol Cell Biol. 2005, 6: 715-725. 10.1038 / nrg1677.

      CAS Статья Google ученый

    • 38.

      Han Y, Watling D, Rogers NC, Stark GR: JAK2 и STAT5, но не JAK1 и STAT1, необходимы для индуцированной пролактином транскрипции бета-лактоглобулина.Мол Эндокринол. 1997, 11: 1180-1188. 10.1210 / me.11.8.1180.

      CAS PubMed Google ученый

    • 39.

      Pezet A, Buteau H, Kelly PA, Edery M: последний пролин из блока 1 необходим для ассоциации с JAK2 и функциональной активации рецептора пролактина. Mol Cell Endocrinol. 1997, 129: 199-208. 10.1016 / S0303-7207 (97) 00063-4.

      CAS Статья PubMed Google ученый

    • 40.

      Лебрун Дж. Дж., Али С., Гоффин В., Ульрих А., Келли П. А.: Один фосфотирозиновый остаток рецептора пролактина отвечает за активацию транскрипции гена. Proc Natl Acad Sci USA. 1995, 92: 4031-4035. 10.1073 / pnas.92.9.4031.

      CAS Статья PubMed PubMed Central Google ученый

    • 41.

      DaSilva L, Rui H, Erwin RA, Howard OM, Kirken RA, Malabarba MG, Hackett RH, Larner AC, Farrar WL: пролактин рекрутирует STAT1, STAT3 и STAT5 независимо от консервативных рецепторных тирозинов TYR402, TYR5479 и TYR580.Mol Cell Endocrinol. 1996, 117: 131-140. 10.1016 / 0303-7207 (95) 03738-1.

      CAS Статья PubMed Google ученый

    • 42.

      Wakao H, Gouilleux F, Groner B: Фактор молочной железы (MGF) является новым членом семейства генов факторов транскрипции, регулируемых цитокинами, и обеспечивает пролактиновый ответ. EMBO J. 1995, 14: 854-855.

      CAS PubMed PubMed Central Google ученый

    • 43.

      Лю Х, Робинсон Г.В., Вагнер К.Ю., Гарретт Л., Виншоу-Борис А., Хеннигхаузен Л.: Stat5a обязательна для развития молочной железы и лактогенеза у взрослых. Genes Dev. 1997, 11: 179-186.

      CAS Статья PubMed Google ученый

    • 44.

      Лю X, Робинсон GW, Gouilleux F, Groner B, Hennighausen L: Клонирование и экспрессия Stat5 и дополнительного гомолога (Stat5b), участвующих в передаче сигнала пролактина в ткани молочной железы мыши.Proc Natl Acad Sci USA. 1995, 92: 8831-8835. 10.1073 / pnas.92.19.8831.

      CAS Статья PubMed PubMed Central Google ученый

    • 45.

      Teglund S, McKay C, Schuetz E, van Deursen JM, Stravopodis D, Wang D, Brown M, Bodner S, Grosveld G, Ihle JN: белки Stat5a и Stat5b выполняют существенные и несущественные или повторяющиеся роли. в цитокиновых ответах. Клетка. 1998, 93: 841-850. 10.1016 / S0092-8674 (00) 81444-0.

      CAS Статья PubMed Google ученый

    • 46.

      Орманди К.Дж., Нейлор М., Харрис Дж., Робертсон Ф., Коньмен Н.Д., Линдеман Дж. Дж., Висвадер Дж., Келли П.А.: Исследование транскрипционных изменений, лежащих в основе функциональных дефектов в молочных железах мышей с нокаутом рецептора пролактина. Недавний Prog Hormone Res. 2003, 58: 297-323. 10.1210 / rp.58.1.297.

      CAS Статья Google ученый

    • 47.

      Harris J, Stanford PM, Sutherland K, Oakes SR, Naylor MJ, Robertson FG, Blazek KD, Kazlauskas M, Hilton HN, Wittlin S, et al: Socs2 и Elf5 опосредуют индуцированное пролактином развитие молочной железы.Мол Эндокринол. 2006,

      Google ученый

    • 48.

      Харрис Дж, Стэнфорд П.М., Оукс С.Р., Орманди К.Дж.: Пролактин и рецептор пролактина: новые мишени старого гормона. Ann Med. 2004, 36: 414-425. 10.1080 / 078538