Микрофлора смешанная в мазке у женщин: Вопрос задает – Василина, — вопрос-ответ от специалистов клиники «Мать и дитя»

Содержание

Смешанная флора в мазке у женщин

Анализ влагалищного секрета проводится время от времени, чтобы следить за состоянием репродуктивного здоровья, при возникновении жалоб на зуд и жжение в половых путях, в период беременности или при климаксе. Результаты позволяют объективно оценить количество и процентное соотношение болезнетворных и условно-патогенных микроорганизмов.

Микрофлора во влагалище

Мазок на флору у женщин является анализом, который позволяет оценить вероятность возникновения патологических процессов в репродуктивной системе. В анализе могут быть обнаружены клетки плоского эпителия, кокки, лактобациллы Дедерлейна, лейкоциты и другие микроорганизмы. Микрофлора может быть скудной, средней, смешанной или обильной. Если микрофлора во влагалище скудная, то определяется только палочки Дедерлейна, это полезные лактобациллы.

При среднем количестве в поле зрения лаборанта попадут большие колонии палочек и 7-10 лейкоцитов. Если речь идет о смешанной микрофлоре, в мазке у женщин обнаруживается 15-30 лейкоцитов, небольшое количество палочек Дедерлейна, кокки — шарообразные патологические бактерии. Результата «обильная микрофлора» означает, что внутренние стенки влагалища покрыты лейкоцитами при отсутствии лактобацилл. Это провоцирует неприятный запах и выделение значительного количества слизи.

Зачем сдают мазок на флору

Забор биологического материала из влагалища (мазок на флору) у женщин гинеколог совершает, чтобы выявить наличие патогенной микрофлоры и определить наличие патологии. При отсутствии жалоб ранее врачи рекомендовали сдавать анализ ежегодно, но в настоящее время Американский конгресс акушеров и гинекологов ввел новые правила. Сдавать мазки нужно в возрасте от 21 года до 65 лет каждые три года.

Чаще диагностическая манипуляция производится при наличии жалоб: жжение или зуд во влагалище, боли в нижней части живота, изменений консистенции, цвета или запаха выделений. Анализ нужно делать при беременности, подозрении развития гинекологических патологий, климаксе. Специалисты рекомендуют сделать мазок после окончания приема гормональных препаратов, которые могут повлиять на уровень кислотности, и регулярно посещать гинеколога.

Подготовка к анализу

За неделю до взятия биологического материала из влагалища рекомендуется прекратить прием антибиотиков и других лекарств, которые могут оказать существенное влияние на результат мазка. В случае невозможности отказаться от лекарств, нужно сообщить об этом врачу. За сутки до анализа нужно прекратить проведение спринцеваний и лечение свечами или вагинальными таблетками.

Что можно обнаружить в мазке

Для диагностики патологических состояний врач, скорее всего, возьмет мазок не только из влагалища, но и из цервикального канала и уретры. Технически это совершенно разные процедуры, но забор материала обычно производится только один раз. В ходе микроскопической диагностики лаборант может обнаружить в мазке плоский эпителий, слизь, палочки Додерлейна, лейкоциты.

Внутренняя поверхность влагалища и цервикального канала состоит из плоского эпителия. Наличие большого количества клеток такого типа свидетельствует о возможном развитии уретрита или вагинита. Недостаток плоских клеток указывает на недостаточную секрецию прогестерона — гормона, необходимого для успешного зачатия и вынашивания беременности.

Лейкоциты необходимы, чтобы организм справлялся с патогенными микроорганизмами. В норме количество клеток во влагалище не превышает 10, в шейке — 30. Высокая концентрация лейкоцитов чаще всего указывает на наличие воспалительного процесса репродуктивной системы (вагинит, цервицит), сопровождающегося фагоцитозом.

Слизь производится влагалищными железами и шейкой матки. В мазке количество слизи должно быть умеренным. Обильные выделения (это врач оценит и визуально в ходе осмотра) могут свидетельствовать о дисбактериозе влагалища. Палочки Додерлейна составляют нормальную микрофлору, это грамположительные клетки. Недостаток палочек в большинстве случаев указывает на развитие бактериального вагиноза.

Смешанный тип

Если в анализе обнаружена смешанная флора, что это значит? Вопрос актуальный для большинства женщин, а посему следует уделить ему особое внимание. Наличие в мазке флоры по смешанному типу указывает на баланс между нормальными и болезнетворными микроорганизмами. При таком результате в биологическом материале обнаруживается плоский эпителий, лейкоциты, лактобациллы Додерлейна и другие типы микроорганизмов.

При отсутствии воспалительного процесса преобладает количество лактобацилл (приблизительно 90-95 %). Оставшиеся 5 % приходятся на условно-патогенные бактерии, к которым относятся палочки и кокки. Потенциально опасные микроорганизмы не вредят организма, но по мере увеличения их численности возрастает угроза развития патологии.

Очень высок риск развития заболеваний при смешанной обильной флоре в мазке при беременности. Вынашивание ребенка вообще является особым состоянием женского организма, при котором могут обостриться имеющиеся хронические заболевания или появиться новые проблемы. Возможно, необходимо пройти комплексное лечение, чтобы предупредить бесконтрольное размножение патогенных агентов.

Степени содержания флоры

Взятому из влагалища биологическому материалу в процессе анализа присваивают степень чистоты. Этот показатель указывает на наличие болезнетворных микроорганизмов и уровень кислотности микрофлоры. Первая степень — это нормальное состояние, при котором условно-патогенные микроорганизмы и лактобациллы находятся в состоянии баланса, допустимые пределы не нарушены. Вторая степень — относительная норма. При этом процент болезнетворных бактерий немного повышен, но не представляет опасности для здоровья.

Третья степень чистоты предполагает большое количество смешанной флоры в мазке. При этом количество условно-патогенных микроорганизмов преобладает над палочками Додерлейна, содержащимися в выделениях в норме в большом количестве. Однозначно речь идет о патологии, если в результатах значится четвертная степень чистоты влагалища. Это состояние характеризуется преобладанием плоского эпителия, болезнетворных бактерий и лейкоцитов.

Обильная микрофлора

Смешанная флора в большом количестве обычно указывает на наличие в матке патологических процессов. При этом в биологическом материале при микроскопическом исследовании обнаруживается большое количество слизи и плоского эпителия, пласты клеток мпэ, форменные элементы крови, есть следы фагоцитоза. Лечится патологическое состояние вагинальными свечами, угнетающими функционирование болезнетворных микроорганизмов и восстанавливающими нормальный уровень рН.

Коккобацилярная микрофлора

Смешанная флора в небольшом количестве является патологическим состоянием. Если в мазке преобладают коккобациллы (что-то среднее между обычными кокками и бациллами), то в большинстве случаев гинеколог диагностирует наличие гарднереллы вагиналис, гемофильной палочки или хламидий. Увеличение количества патогенных агентов приведет к развитию грибковых поражений, вагинита и бактериального вагиноза.

Причины нарушения флоры

Скудная смешанная флора в мазке может обнаруживаться после приема антибактериальных препаратов, которые сильно влияют на иммунную систему, создавая условия для развития болезнетворных бактерий. К нарушениям баланса микрофлоры может приводить прием гормональных средств контрацепции. При этом в среде обычно увеличивается количество лактобацилл и лейкоцитов.

Женщины самостоятельно провоцируют дисбаланс, предохраняясь от нежелательно беременности. Плохие результаты мазка на флору обычно получают те пациентки, которые установили внутриматочную спираль. Это средство контрацепции создает дисбаланс, подходящий для активного развития коккобацилл.

Провоцирует размножение патогенной микрофлоры и вымывание нормального содержимого влагалища частое спринцевание. Поэтому интимная гигиена должна быть умеренной. Достаточно ежедневных подмываний простой водой (минимум один раз в день, максимум — после каждого посещения туалета или смены гигиенического средства во время менструации). Влагалище является самоочищающейся системой, так что не нуждается в чрезмерных гигиенических процедурах. Нежелательно использовать агрессивные средства для интимной гигиены. Лучше выбирать гели с нейтральным рН, без красителей и ароматизаторов.

Требуется ли лечение

Смешанная флора в мазке требует уточнения диагноза, потому что терапия требуется не во всех случаях. При наличии эрозии назначается прижигание, но некоторые формы заболевания не требуют медицинского вмешательства (только регулярное наблюдение). Гонорея, микоплазмоз, хламидиоз, трихомониаз и подобные болезни лечатся специальными средствами, содержащими компоненты, направленные на борьбу с определенными бактериями.

При незначительном изменении микрофлоры достаточно курса вагинальных свечей или мазей. После окончания лечения нужно сдать анализ повторно. Если в результатах снова будут обнаружены патологические микроорганизмы в большом количестве и смешанная флора в мазке (у женщин это ведь может быть последствием приема определенных медикаментов), возможно, потребуется пройти курс терапии более сильными препаратами.

Гинеколог может порекомендовать пациентке дополнительные обследования, которые позволят исключить вероятность неправильного диагноза (повторный анализ после определенной подготовки, например, окончания курса антибиотиков или отказа от гормональных контрацептивов, УЗИ органов малого таза, анализы биологических жидкостей и тому подобное). Лучше сразу прислушаться к советам врача, чтобы сразу уточнить диагноз.

Особенности при беременности

Часто обнаруживается смешанная микрофлора в мазке у беременных. Женщины в положении сдают этот анализ как минимум три раза: при выдаче обменной карты и постановке на учет, на сроке до тридцати недель и в третьем триместре, незадолго до родов, то есть в тридцать шесть — тридцать семь недель. Иногда может возникнуть необходимость в дополнительном обследовании: если появляются жалобы на зуд, изменение количества, запаха или консистенции выделений, жжение.

Успешным признаком зачатия до наступления задержки менструации является изменения характера влагалищных выделений. Во время имплантации иммунитет немного снижается, потому что плодное яйцо часто воспринимается организмом как инородный объект. Часто беременные сталкиваются с молочницей. От симптомов этого заболевания важно избавиться до родоразрешения, потому что ребенок может заразиться при прохождении по половым путям матери.

Если смешанная флора связана с серьезными заболеваниями, то врач может порекомендовать прервать беременность. Дело в том, что многие препараты запрещены в период вынашивания плода, а отсутствие терапии может привести к внутриутробному инфицированию и гибели эмбриона. Поэтому специалисты рекомендуют сдать анализ и пройти лечение еще на этапе планирования беременности.

Любую патологию гораздо легче предотвратить, чем устранить (особенно если лечиться приходится во время беременности). Не исключение и смешанная флора в мазке у женщин. Не стоит забывать о профилактике заболеваний репродуктивной системы и регулярно посещать гинеколога. Соблюдение простых правил позволит не только предупредить гинекологические заболевания, но и выносить здорового ребенка.

Смешанная микрофлора — вопрос от пациента медицинского центра «ГУТА КЛИНИК»

Функциональная диагностика и УЗИ

Дудин
Михаил Михайлович

Врач УЗИ диагностики

Карпочев
Максим Викторович

Ведущий врач УЗ диагностики

Баранова
Юлия Викторовна

Акушер-гинеколог, гинеколог-эндокринолог, врач УЗ диагностики

Фроловская
Людмила Викторовна

Акушер-гинеколог, врач УЗД

Базарнова
Евгения Васильевна

Врач УЗД

Басаков
Кирилл Сергеевич

Хирург-маммолог, врач УЗД, рентгенолог

Муртазалиева

Айна Абдулаевна

Маммолог-онколог, рентгенолог, врач УЗД

Федоров
Сергей Геннадьевич

Уролог-андролог, врач УЗИ

Рентгенология

Кивасев
Станислав Александрович

Рентгенолог, замдиректора по лучевой диагностике

Нечаев
Валентин Александрович

Рентгенолог

Басарболиев
Алексей Викторович

Рентгенолог

Тихонова
Валерия Сергеевна

Рентгенолог

Мухин

Андрей Андреевич

Рентгенолог

Крысанова
Александра Владимировна

Рентгенолог

Васильева
Юлия Николаевна

Рентгенолог

Шульц
Евгений Игоревич

Рентгенолог

Звездина
Дарья Максимовна

Рентгенолог

Андрианова
Вера Николаевна

Рентгенолог

Гончар
Анна Павловна

Рентгенолог

Терапия

Горбачева
Елена Владимировна

Кардиолог, терапевт

Карданова
Ольга Дмитриевна

Кардиолог, терапевт (ведущий специалист)

Шашкова
Татьяна Валерьевна

Терапевт, кардиолог, врач функц. диагностики

Комиссаренко
Ирина Арсеньевна

Гастроэнтеролог, терапевт, кардиолог

Кускунова
Евгения Александровна

Терапевт

Михейкина
Ирина Васильевна

Терапевт

Ахкямова
Мария Альбертовна

Физиотерапия

Родина
Елена Вячеславовна

Физиотерапевт

Хан
Иннокентий Евгеньевич

Врач ЛФК

Кардиология

Горбачева
Елена Владимировна

Кардиолог, терапевт

Карданова
Ольга Дмитриевна

Кардиолог, терапевт (ведущий специалист)

Шашкова
Татьяна Валерьевна

Терапевт, кардиолог, врач функц. диагностики

Комиссаренко
Ирина Арсеньевна

Гастроэнтеролог, терапевт, кардиолог

Ветрова
Зарема Давлетовна

Кардиолог, врач функциональной диагностики

Андреев
Дмитрий Александрович

Кардиолог

Сапожникова
Ольга Алексеевна

Кардиолог

Аудиология и слухопротезирование

Паукова
Марина Владимировна

Сурдолог-оториноларинголог

Колтышева
Екатерина Борисовна

Врач функциональной диагностики

Левина
Юлия Викторовна

Сурдолог-оториноларинголог

Неврология и мануальная терапия

Замерград
Максим Валерьевич

Невролог, консультант Центра головокружения и нарушения равновесия

Небожин
Александр Иванович

Мануальный терапевт, невролог

Иванова
Татьяна Андреевна

Невролог

Екушева
Евгения Викторовна

Невролог-алголог

Толстенева
Александра Игоревна

Невролог, детский невролог

Новиков
Сергей Александрович

Невролог, руководитель Центра алгологии

Лабораторные услуги

Дерматология и трихология

Телешева
Ирина Вадимовна

Дерматолог, трихолог, косметолог

Захарова
Наталья Викторовна

Дерматолог, трихолог, косметолог

Шуляк
Ирина Степановна

Дерматолог, трихолог, косметолог

Массаж

Ермуш
Станислав Геннадьевич

Массажист

Эндокринология

Бахтеева
Ирина Владимировна

Эндокринолог

Аллергология-иммунология

Козулина
Ирина Евгеньевна

Аллерголог-иммунолог

Стационар

Гнелица
Николай Викторович

Анестезиолог-реаниматолог

Добролюбов
Евгений Евгеньевич

Анестезиолог-реаниматолог

Цыба
Николай Александрович

Анестезиолог-реаниматолог

Антоненко
Дмитрий Валерьевич

Анестезиолог-реаниматолог

Сагалович
Михаил Абрамович

Анестезиолог-реаниматолог

Флебология

Даньков
Дмитрий Васильевич

Хирург-флеболог, врач УЗД

Косметология

Телешева
Ирина Вадимовна

Дерматолог, трихолог, косметолог

Захарова
Наталья Викторовна

Дерматолог, трихолог, косметолог

Шуляк
Ирина Степановна

Дерматолог, трихолог, косметолог

Гепатология

Комиссаренко
Ирина Арсеньевна

Гастроэнтеролог, терапевт, кардиолог

Мухамеджанова
Эльвира Равиловна

Гастроэнтеролог

Гинекология

Душкина
Ирина Александровна

Акушер-гинеколог, гинеколог-эндокринолог

Горский
Сергей Леонидович

Ведущий хирург-гинеколог

Егорова
Елена Анатольевна

Акушер-гинеколог, гинеколог-эндокринолог

Афанасьев
Максим Станиславович

Акушер-гинеколог, онкогинеколог

Баранова
Юлия Викторовна

Акушер-гинеколог, гинеколог-эндокринолог, врач УЗ диагностики

Фроловская
Людмила Викторовна

Акушер-гинеколог, врач УЗД

Проктология

Мормышев
Вячеслав Николаевич

Проктолог

Петрук
Максим Николаевич

Проктолог

Педиатрия

Варенкова
Ольга Владимировна

Оториноларинголог

Поддо
Галина Николаевна

Психотерапевт (ведущий специалист)

Небожин
Александр Иванович

Мануальный терапевт, невролог

Маркина
Елена Александровна

Нефролог, руководитель Центра нефрологии

Строк
Ирина Викторовна

Педиатр, неонатолог

Телешева
Ирина Вадимовна

Дерматолог, трихолог, косметолог

Болучевский
Дмитрий Николаевич

Уролог-андролог, детский уролог-андролог

Фроловская
Людмила Викторовна

Акушер-гинеколог, врач УЗД

Малышева
Ольга Дмитриевна

Оперирующий оториноларинголог

Шафоростова
Екатерина Васильевна

Стоматолог-ортодонт

Толстенева
Александра Игоревна

Невролог, детский невролог

Маргиева
Диана Анатольевна

Детский уролог-андролог, хирург

Цибиков
Илья Владимирович

Ортопед-травматолог

Криворотько
Михаил Сергеевич

Ортопед-травматолог

Кибизова
Лаура Георгиевна

Офтальмолог

Щербакова
Елена Михайловна

Детский офтальмолог

Эндоскопия

Мардачев
Олег Александрович

Эндоскопист

Хайдурова
Татьяна Константиновна

Эндоскопист

Центр травматологии и ортопедии

ЛОР (оториноларингология)

Боклин
Андрей Кузьмич

Оториноларинголог

Варенкова
Ольга Владимировна

Оториноларинголог

Марковская
Наталья Геннадьевна

Оториноларинголог

Харина
Дарья Всеволодовна

Оториноларинголог, фониатр

Мирошниченко
Андрей Петрович

Оперирующий оториноларинголог,

Коршунова
Наталья Александровна

Оториноларинголог

Малышева
Ольга Дмитриевна

Оперирующий оториноларинголог

Джафарова
Марьям Зауровна

Оперирующий оториноларинголог

Гастроэнтерология

Комиссаренко
Ирина Арсеньевна

Гастроэнтеролог, терапевт, кардиолог

Мухамеджанова
Эльвира Равиловна

Гастроэнтеролог

Урология-андрология

Долженок
Андрей Николаевич

Уролог-андролог

Болучевский
Дмитрий Николаевич

Уролог-андролог, детский уролог-андролог

Маргиева
Диана Анатольевна

Детский уролог-андролог, хирург

Шамов
Денис Алексеевич

Уролог — андролог

Федоров
Сергей Геннадьевич

Уролог-андролог, врач УЗИ

Шарунов
Вячеслав Викторович

Уролог — андролог

Стоматология. Терапия

Орлова
Елизавета Сергеевна

Стоматолог-терапевт, детский стоматолог

Бабкина
Екатерина Сергеевна

Стоматолог-терапевт

Сизова
Елизавета Игоревна

Стоматолог-терапевт

Хирургия

Трофимова
Ольга Викторовна

Хирург

Туманов
Андрей Борисович

Хирург

Кипарисов
Владислав Борисович

Хирург

Терехин
Алексей Алексеевич

Хирург

Психотерапия

Поддо
Галина Николаевна

Психотерапевт (ведущий специалист)

Офтальмология

Миронкова
Елена Александровна

Офтальмолог

Паршунина
Ольга Алексеевна

Офтальмолог, ретинолог. лазерный хирург

Верещагин
Лев Владиславович

Офтальмолог

Кибизова
Лаура Георгиевна

Офтальмолог

Щербакова
Елена Михайловна

Детский офтальмолог

Центр головокружения и нарушения равновесия

Паукова
Марина Владимировна

Сурдолог-оториноларинголог

Замерград
Максим Валерьевич

Невролог, консультант Центра головокружения и нарушения равновесия

Колтышева
Екатерина Борисовна

Врач функциональной диагностики

Мельников
Олег Анатольевич

Отоневролог, руководитель Центра головокружения и нарушения равновесия

Иванова
Татьяна Андреевна

Невролог

Травматология и ортопедия

Степанов
Андрей Борисович

Травматолог-ортопед

Герасимов
Денис Олегович

Хирург травматолог-ортопед, ведущий специалист

Цибиков
Илья Владимирович

Ортопед-травматолог

Криворотько
Михаил Сергеевич

Ортопед-травматолог

Николаев
Антон Валерьевич

Травматолог-ортопед

Загородний
Николай Васильевич

Травматолог-ортопед

Шнайдер
Лев Сергеевич

Травматолог-ортопед

МРТ Ingenia 3.0T

Кивасев
Станислав Александрович

Рентгенолог, замдиректора по лучевой диагностике

Нечаев
Валентин Александрович

Рентгенолог

Басарболиев
Алексей Викторович

Рентгенолог

Тихонова
Валерия Сергеевна

Рентгенолог

Мухин
Андрей Андреевич

Рентгенолог

Крысанова
Александра Владимировна

Рентгенолог

Васильева
Юлия Николаевна

Рентгенолог

Шульц
Евгений Игоревич

Рентгенолог

Звездина
Дарья Максимовна

Рентгенолог

Компьютерная томография

Кивасев
Станислав Александрович

Рентгенолог, замдиректора по лучевой диагностике

Нечаев
Валентин Александрович

Рентгенолог

Басарболиев
Алексей Викторович

Рентгенолог

Тихонова
Валерия Сергеевна

Рентгенолог

Мухин
Андрей Андреевич

Рентгенолог

Крысанова
Александра Владимировна

Рентгенолог

Васильева
Юлия Николаевна

Рентгенолог

Шульц
Евгений Игоревич

Рентгенолог

Звездина
Дарья Максимовна

Рентгенолог

Маммография

Кивасев
Станислав Александрович

Рентгенолог, замдиректора по лучевой диагностике

Крысанова
Александра Владимировна

Рентгенолог

Басаков
Кирилл Сергеевич

Хирург-маммолог, врач УЗД, рентгенолог

Муртазалиева
Айна Абдулаевна

Маммолог-онколог, рентгенолог, врач УЗД

Денситометрия

Кивасев
Станислав Александрович

Рентгенолог, замдиректора по лучевой диагностике

Нечаев
Валентин Александрович

Рентгенолог

Басарболиев
Алексей Викторович

Рентгенолог

Тихонова
Валерия Сергеевна

Рентгенолог

Мухин
Андрей Андреевич

Рентгенолог

Звездина
Дарья Максимовна

Рентгенолог

Нефрология

Маркина
Елена Александровна

Нефролог, руководитель Центра нефрологии

Центр нефрологии

Детская стоматология

Орлова
Елизавета Сергеевна

Стоматолог-терапевт, детский стоматолог

Стоматология. Хирургия

Кулиш
Александр Александрович

Стоматолог-хирург, имплантолог

Стоматология. Ортопедия

Богословский
Владимир Александрович

Стоматолог-ортопед

Захарченко
Александр Валериевич

Стоматолог-ортопед

Диагностика COVID-19

Маммология

Басаков
Кирилл Сергеевич

Хирург-маммолог, врач УЗД, рентгенолог

Муртазалиева
Айна Абдулаевна

Маммолог-онколог, рентгенолог, врач УЗД

Запиров
Гаджимурад Магомедович

Маммолог-хирург, онколог, рентгенолог

Online-консультация врача от 1490 ₽

Паукова
Марина Владимировна

Сурдолог-оториноларинголог

Варенкова
Ольга Владимировна

Оториноларинголог

Карданова
Ольга Дмитриевна

Кардиолог, терапевт (ведущий специалист)

Марковская
Наталья Геннадьевна

Оториноларинголог

Шашкова
Татьяна Валерьевна

Терапевт, кардиолог, врач функц. диагностики

Поддо
Галина Николаевна

Психотерапевт (ведущий специалист)

Комиссаренко
Ирина Арсеньевна

Гастроэнтеролог, терапевт, кардиолог

Иванова
Татьяна Андреевна

Невролог

Маркина
Елена Александровна

Нефролог, руководитель Центра нефрологии

Бахтеева
Ирина Владимировна

Эндокринолог

Строк
Ирина Викторовна

Педиатр, неонатолог

Коршунова
Наталья Александровна

Оториноларинголог

Петрук
Максим Николаевич

Проктолог

Малышева
Ольга Дмитриевна

Оперирующий оториноларинголог

Туманов
Андрей Борисович

Хирург

Герасимов
Денис Олегович

Хирург травматолог-ортопед, ведущий специалист

Толстенева
Александра Игоревна

Невролог, детский невролог

Цибиков
Илья Владимирович

Ортопед-травматолог

Депозитная система

Служба помощи на дому

Слащева
Ольга Михайловна

терапевт

Коршунова
Наталья Александровна

Оториноларинголог

Ахкямова
Мария Альбертовна

Медицинские справки

Стоматология. Имплантология

Кулиш
Александр Александрович

Стоматолог-хирург, имплантолог

МРТ открытого типа

Кивасев
Станислав Александрович

Рентгенолог, замдиректора по лучевой диагностике

Нечаев
Валентин Александрович

Рентгенолог

Басарболиев
Алексей Викторович

Рентгенолог

Тихонова
Валерия Сергеевна

Рентгенолог

Мухин
Андрей Андреевич

Рентгенолог

Крысанова
Александра Владимировна

Рентгенолог

Васильева
Юлия Николаевна

Рентгенолог

Шульц
Евгений Игоревич

Рентгенолог

Звездина
Дарья Максимовна

Рентгенолог

Центр маммологии

Стоматология. Ортодонтия

Шафоростова
Екатерина Васильевна

Стоматолог-ортодонт

Ревматология

Ушакова
Мария Анатольевна

Ревматолог

Старовойтова
Майя Николаевна

Ревматолог

Вакцинация от COVID-19

Центр алгологии

Микрофлора смешанная скудная у женщин что это


Смешанная флора в мазке – что это такое? О каких заболеваниях может рассказать анализ? Как правильно подготовиться к исследованию? Обязательная процедура при посещении гинеколога – мазок. Он четко показывает, где находится воспалительный процесс и какие бактерии его вызывают. Важное преимущество этого метода – возможность быстро выявить патологию. Без мазка определить многие заболевания просто невозможно. Анализ показывает не только наличие патогенных микроорганизмов и грибов, но и их процентное соотношение к неболезнетворным. Дисбаланс вызывает изменение рН с кислой среды в щелочную. А это показатель развития инфекции. Мазок берется гинекологом непосредственно после осмотра при каждом посещении. Это важно не только для диагностики, но и для профилактики заболеваний. Врач собирает анамнез: учитывает жалобы, оценивает состояние половых органов, наличие неспецифических выделений. Затем одноразовым шпателем делает забор из уретры, влагалища, шейки матки. Собранный материал распределяется по предметному стеклу и отправляется в лабораторию.

Даже здоровые женщины должны раз в год посещать гинеколога и делать мазок. Пациентки с гинекологическими заболеваниями и беременные мазки сдают чаще. Как подготовиться:

  • предварительно не использовать вагинальные препараты;
  • не спринцеваться;
  • в течение 2 суток не иметь половых отношений;
  • 2 часа до приема у врача не мочиться;
  • подмыться водой без мыла;
  • накануне не принимать ванны;
  • не приходить на анализ в начале или конце менструации.

Микрофлора во влагалище

Мазок на флору у женщин является анализом, который позволяет оценить вероятность возникновения патологических процессов в репродуктивной системе. В анализе могут быть обнаружены клетки плоского эпителия, кокки, лактобациллы Дедерлейна, лейкоциты и другие микроорганизмы. Микрофлора может быть скудной, средней, смешанной или обильной. Если микрофлора во влагалище скудная, то определяется только палочки Дедерлейна, это полезные лактобациллы.

При среднем количестве в поле зрения лаборанта попадут большие колонии палочек и 7-10 лейкоцитов. Если речь идет о смешанной микрофлоре, в мазке у женщин обнаруживается 15-30 лейкоцитов, небольшое количество палочек Дедерлейна, кокки — шарообразные патологические бактерии. Результата «обильная микрофлора» означает, что внутренние стенки влагалища покрыты лейкоцитами при отсутствии лактобацилл. Это провоцирует неприятный запах и выделение значительного количества слизи.

Зачем сдают мазок на флору

Забор биологического материала из влагалища (мазок на флору) у женщин гинеколог совершает, чтобы выявить наличие патогенной микрофлоры и определить наличие патологии. При отсутствии жалоб ранее врачи рекомендовали сдавать анализ ежегодно, но в настоящее время Американский конгресс акушеров и гинекологов ввел новые правила. Сдавать мазки нужно в возрасте от 21 года до 65 лет каждые три года.

Чаще диагностическая манипуляция производится при наличии жалоб: жжение или зуд во влагалище, боли в нижней части живота, изменений консистенции, цвета или запаха выделений. Анализ нужно делать при беременности, подозрении развития гинекологических патологий, климаксе. Специалисты рекомендуют сделать мазок после окончания приема гормональных препаратов, которые могут повлиять на уровень кислотности, и регулярно посещать гинеколога.

Что можно обнаружить в мазке

Для диагностики патологических состояний врач, скорее всего, возьмет мазок не только из влагалища, но и из цервикального канала и уретры. Технически это совершенно разные процедуры, но забор материала обычно производится только один раз. В ходе микроскопической диагностики лаборант может обнаружить в мазке плоский эпителий, слизь, палочки Додерлейна, лейкоциты.

Внутренняя поверхность влагалища и цервикального канала состоит из плоского эпителия. Наличие большого количества клеток такого типа свидетельствует о возможном развитии уретрита или вагинита. Недостаток плоских клеток указывает на недостаточную секрецию прогестерона — гормона, необходимого для успешного зачатия и вынашивания беременности.

Лейкоциты необходимы, чтобы организм справлялся с патогенными микроорганизмами. В норме количество клеток во влагалище не превышает 10, в шейке — 30. Высокая концентрация лейкоцитов чаще всего указывает на наличие воспалительного процесса репродуктивной системы (вагинит, цервицит), сопровождающегося фагоцитозом.

Слизь производится влагалищными железами и шейкой матки. В мазке количество слизи должно быть умеренным. Обильные выделения (это врач оценит и визуально в ходе осмотра) могут свидетельствовать о дисбактериозе влагалища. Палочки Додерлейна составляют нормальную микрофлору, это грамположительные клетки. Недостаток палочек в большинстве случаев указывает на развитие бактериального вагиноза.

Оценка результата исследования

Расшифровка полученного анализа проводится только в лаборатории и только сертифицированным специалистом. От достоверности представленных результатов зависит правильность поставленного диагноза и результат лечения.

Увеличение количества лейкоцитов в анализе не всегда является показателем патологического процесса. Причем при анализе на флору наличие лейкоцитов (до 5 штук в поле зрения) является нормой. Если выявлено большее количество,то это характеризует наличие воспалительного процесса как в самой уретре, так и в предстательной железе или наличие опухолевого процесса. Если лейкоцитов найдено более 100, то это может свидетельствовать о наличии у пациента гонореи или трихомониаза. Уточнение возбудителя проводится с помощью дополнительных тестов.

Наличие эритроцитов в большом количестве говорит о присутствии острого воспаления, опухолевого процесса, но и не исключает травму уретры при заборе анализа.

В норме допускается наличие клеток эпителия до 10. Если их большое количество, то это говорит о патологическом процессе в уретре. Этот показатель важен в совокупной оценке с лейкоцитами и отражает активность воспалительного процесса. Избыток клеток эпителия свидетельствует о хроническом процессе, который может быть как последствием вялотекущей инфекции и опухолевой патологии, так и перенесенной травмы.

Небольшое количество слизи в мазке не является патологией, а вот большое количество ее может означать наличие инфекции, а именно:

При обострении воспалительного процесса анализ мазка покажет большое количество слизи и лейкоцитов.

Присутствие единичных кокковых не является патологией. Если различных микроорганизмов выявлено более 5, то это говорит о наличии дисбактериоза, который вызван инфекцией. Гонококки, трихомонады указывают на наличие одноименных инфекций, а грибковое поражение объясняется возбудителем рода кандида.

Мазок на микрофлору у мужчин является показателем не только отсутствия инфекций мочеполовой системы, но и общего здоровья человека.

Выявленная на раннем этапе патология позволяет устранить ее еще до появления признаков заболевания.

Как расшифровывается стандартный анализ?

Расшифровка стандартного анализа, по результатам которой можно сделать вывод о наличии или отсутствии патологии, включает следующие показатели:

  1. Лейкоциты (Le). Клетки, защищающие организм от воздействия различных инфекционных агентов. В норме их должно быть до 5 штук в поле зрения. Большое количество указывает на наличие воспаления в уретре, простате или семенниках.
  2. Эритроциты (Er). Эти клетки переносят кислород. В норме должно быть до 3 в поле зрения. Увеличение их в сочетании с лейкоцитозом указывает на воспаление травматического характера или воспаление слизистой мочеиспускательного канала, не исключает возможность травмы при заборе материала из уретры.
  3. Эозинофилы (Eo). Наличие их более 10% всего клеточного состава в анализе свидетельствует об аллергическом воспалении в уретре.
  4. Слизь. Может отражать как воспалительные явления, так и процесс возбуждения.
  5. Липоидные зерна. Свидетельствуют о выделении простатического секрета. Могут быть при воспалении простаты хронического характера или дисбалансом в половой активности.
  6. Сперматозоиды. Говорит о неправильном функционировании мышц семявыводящего протока.
  7. Эпителий. Наличие его клеток более 10 указывает на наличие патологии в мочеиспускательном канале. Сочетание их с лейкоцитозом отражает острый воспалительный процесс, а норма лейкоцитов на фоне повышенного количества эпителия говорит о хроническом течении процесса.
  8. Наличие микроорганизмов указывает на инфекционный процесс. При этом в норме может быть эпидермальный стафилококк, сапрофитный стафилококк, золотистый стафилококк (не более 5% случаев), зеленящий стрептококк, фекальный стрептококк, кишечная палочка, протей, коринобактерии (до 25%). Патогенными являются гонококки, трихомонады, хламидии, кандиды.

В течение жизни состав микрофлоры человека может меняться. Но наличие большого количества одного из микроорганизмов является признаком воспалительного процесса. При сдаче анализа на микрофлору очень важен опыт и уровень профессионализма сотрудников лаборатории и наличие необходимых реактивов. В некоторых случаях при двойственности полученных результатов прибегают к дополнительным исследованиям. .

Смешанный тип

Если в анализе обнаружена смешанная флора, что это значит? Вопрос актуальный для большинства женщин, а посему следует уделить ему особое внимание. Наличие в мазке флоры по смешанному типу указывает на баланс между нормальными и болезнетворными микроорганизмами. При таком результате в биологическом материале обнаруживается плоский эпителий, лейкоциты, лактобациллы Додерлейна и другие типы микроорганизмов.

При отсутствии воспалительного процесса преобладает количество лактобацилл (приблизительно 90-95 %). Оставшиеся 5 % приходятся на условно-патогенные бактерии, к которым относятся палочки и кокки. Потенциально опасные микроорганизмы не вредят организма, но по мере увеличения их численности возрастает угроза развития патологии.

Очень высок риск развития заболеваний при смешанной обильной флоре в мазке при беременности. Вынашивание ребенка вообще является особым состоянием женского организма, при котором могут обостриться имеющиеся хронические заболевания или появиться новые проблемы. Возможно, необходимо пройти комплексное лечение, чтобы предупредить бесконтрольное размножение патогенных агентов.

Смешанная флора у мужчин

С помощью бактериологического мазка, который берется из уретры, можно выявить скрытые формы инфекции. Именно с этой целью и делается анализ. Если обнаружена смешанная флора, это говорит о том, что патогенные бактерии активно размножаются, провоцируя воспалительные процессы в организме.

Смешанная флора часто указывает на вероятность развития простатита или уретрита, венерических заболеваний. Если обнаруживается, что по результатам лабораторного исследования возросло количество лейкоцитов, это считается явным признаком воспаления.

Тогда есть вероятность, что в организме прогрессирует гонорея, хламидиоз, уреаплазмоз, трихомониаз. Окончательный диагноз ставит только специалист на основании анализов и симптомов болезни.

Степени содержания флоры

Взятому из влагалища биологическому материалу в процессе анализа присваивают степень чистоты. Этот показатель указывает на наличие болезнетворных микроорганизмов и уровень кислотности микрофлоры. Первая степень — это нормальное состояние, при котором условно-патогенные микроорганизмы и лактобациллы находятся в состоянии баланса, допустимые пределы не нарушены. Вторая степень — относительная норма. При этом процент болезнетворных бактерий немного повышен, но не представляет опасности для здоровья.

Третья степень чистоты предполагает большое количество смешанной флоры в мазке. При этом количество условно-патогенных микроорганизмов преобладает над палочками Додерлейна, содержащимися в выделениях в норме в большом количестве. Однозначно речь идет о патологии, если в результатах значится четвертная степень чистоты влагалища. Это состояние характеризуется преобладанием плоского эпителия, болезнетворных бактерий и лейкоцитов.

Если она обнаруживается у женщин

Когда по результатам анализов выявляется смешанная флора у представительниц женского пола, это свидетельствует о:

  • начале у девочек периода полового созревания;
  • развитии венерических болезней;
  • вступлении организма в климатический период;
  • усиленном функционировании женских половых желез;
  • начальном этапе или окончании менструального цикла.

Неоспоримым остается лишь факт дисбаланса между болезнетворными бактериями и полезными. Заниматься расшифровкой мазка может только гинеколог, ему на основании своего опыта виднее, какова истинная причина патологии.

Коккобацилярная микрофлора

Смешанная флора в небольшом количестве является патологическим состоянием. Если в мазке преобладают коккобациллы (что-то среднее между обычными кокками и бациллами), то в большинстве случаев гинеколог диагностирует наличие гарднереллы вагиналис, гемофильной палочки или хламидий. Увеличение количества патогенных агентов приведет к развитию грибковых поражений, вагинита и бактериального вагиноза.

Причины нарушения флоры

Скудная смешанная флора в мазке может обнаруживаться после приема антибактериальных препаратов, которые сильно влияют на иммунную систему, создавая условия для развития болезнетворных бактерий. К нарушениям баланса микрофлоры может приводить прием гормональных средств контрацепции. При этом в среде обычно увеличивается количество лактобацилл и лейкоцитов.

Женщины самостоятельно провоцируют дисбаланс, предохраняясь от нежелательно беременности. Плохие результаты мазка на флору обычно получают те пациентки, которые установили внутриматочную спираль. Это средство контрацепции создает дисбаланс, подходящий для активного развития коккобацилл.

Провоцирует размножение патогенной микрофлоры и вымывание нормального содержимого влагалища частое спринцевание. Поэтому интимная гигиена должна быть умеренной. Достаточно ежедневных подмываний простой водой (минимум один раз в день, максимум — после каждого посещения туалета или смены гигиенического средства во время менструации). Влагалище является самоочищающейся системой, так что не нуждается в чрезмерных гигиенических процедурах. Нежелательно использовать агрессивные средства для интимной гигиены. Лучше выбирать гели с нейтральным рН, без красителей и ароматизаторов.

Зачем производят чувствительность к антибиотикам при исследовании мазка?

Чувствительность к антибиотикам или антибиотикограмма – выяснение чувствительности бактерий к антибиотикам. Исследование проводят одновременно с посевом мазка при обнаружении во влагалище болезнетворных бактерий, вызывающих воспаление или половые инфекции.

Существует большое количество антибиотиков, но не все они одинаково эффективны по отношению к разным группам бактерий (на вирусы антибиотики не влияют). Случается, что после курса антибиотиков пациентка не выздоровела или болезнь вернулась через несколько дней/недель.

Это произошло, потому что для лечения были назначены антибиотики, слабо влияющие на возбудителя болезни.Для того чтобы лечение было максимально эффективным необходимо определить, какие антибиотики:

  • полностью уничтожают бактерию — возбудителя болезни;
  • останавливают рост возбудителя;
  • не влияют на жизнедеятельность данной бактерии.

На основе проведенного исследования составляется антибиотикограмма. Это перечень антибиотиков, к которым чувствительны бактерии.

После того, как были определены бактерии, вызвавшие болезнь, их распределяют в несколько пробирок с питательными средами. В каждую пробирку добавляют определенный антибиотик. Пробирки помещают в термостат, где созданы оптимальные условия для их размножения.

После культивации (около 7 дней) анализируют рост бактерий в пробирках. Там, где бактерии чувствительны к антибиотику, колоний не образуется. Этот препарат оптимальный для лечения пациентки.

В пробирку, где добавлены препараты, к которым антибиотики нечувствительны, рост бактерий самый интенсивный. Такие лекарственные средства не могут быть использованы для лечения данного заболевания.

Особенности при беременности

Часто обнаруживается смешанная микрофлора в мазке у беременных. Женщины в положении сдают этот анализ как минимум три раза: при выдаче обменной карты и постановке на учет, на сроке до тридцати недель и в третьем триместре, незадолго до родов, то есть в тридцать шесть — тридцать семь недель. Иногда может возникнуть необходимость в дополнительном обследовании: если появляются жалобы на зуд, изменение количества, запаха или консистенции выделений, жжение.

Успешным признаком зачатия до наступления задержки менструации является изменения характера влагалищных выделений. Во время имплантации иммунитет немного снижается, потому что плодное яйцо часто воспринимается организмом как инородный объект. Часто беременные сталкиваются с молочницей. От симптомов этого заболевания важно избавиться до родоразрешения, потому что ребенок может заразиться при прохождении по половым путям матери.

Если смешанная флора связана с серьезными заболеваниями, то врач может порекомендовать прервать беременность. Дело в том, что многие препараты запрещены в период вынашивания плода, а отсутствие терапии может привести к внутриутробному инфицированию и гибели эмбриона. Поэтому специалисты рекомендуют сдать анализ и пройти лечение еще на этапе планирования беременности.

Любую патологию гораздо легче предотвратить, чем устранить (особенно если лечиться приходится во время беременности). Не исключение и смешанная флора в мазке у женщин. Не стоит забывать о профилактике заболеваний репродуктивной системы и регулярно посещать гинеколога. Соблюдение простых правил позволит не только предупредить гинекологические заболевания, но и выносить здорового ребенка.

После лабораторной диагностики мазка гинеколог нередко сообщает пациентке, что у нее смешанная микрофлора в мазке. Что это такое? Во время лабораторного исследования медик выявляет в биоматериале наличие и концентрацию вредоносных микроорганизмов, наличие воспалительного процесса, грибка.

Такая диагностика позволяет обнаружить опасные заболевания на самой ранней стадии развития, еще до проявления первых тревожных симптомов. Даже профилактическое посещение гинеколога предусматривает сдачу мазка на анализ микрофлоры шейки матки и влагалища.

У здоровой женщины соотношение полезных и вредных бактерий в половых органах составляет 95:5. Если такое равновесие нарушается, ставится диагноз смешанная микрофлора. Он особенно опасен для девушек, которые вынашивают ребенка.

Определение

Что такое смешанная флора в мазке у женщин? Ответ на этот вопрос волнует многих пациенток, впервые услышавших подобный диагноз. Он означает, что в половых органах женщины нарушен баланс между полезными и вредоносными микроорганизмами.

Во время лабораторного исследования мазка медик может обнаружить в образце клетки плоского эпителия, лактобациллы, лейкоциты, кокки и прочие бактерии, опасные для половой системы. Если их слишком много, у пациентки может развиваться гинекологическое заболевание.

Особенно опасно размножение стафилококков, коккобацилл и гонококков для беременных женщин. Если у такой пациентки обнаружена смешанная микрофлора, медик рекомендует пройти комплексное лечение.

Флора смешанная в мазке у женщин может сигнализировать о начале климакса, месячных, наличии венерических заболеваний, гиперфункции яичников. Также такое состояние наблюдается у пациенток в период полового созревания.

У здоровой пациентки в образце слизистой влагалища или матки преобладают лактобациллы. Также в нормальном анализе могут обнаружиться клетки эпителия, лейкоциты, слизь. Все эти элементы свидетельствуют об отсутствии воспалительного процесса и крепкой иммунной защите.

Если в мазке обнаружено увеличение численности грибков и кокков, у пациентки возрастает риск развития воспаления. Большая концентрация лейкоцитов, эпителия и слизи также свидетельствует о гинекологических патологиях. При значительном превышении нормы лейкоцитов, в мазке содержится очень мало лактобактерий, преобладают патогенные микроорганизмы. Такое состояние пациентки требует незамедлительной терапии для предотвращения прогрессирования недуга.

Флора смешанная обильная в мазке может возникнуть по разным причинам. Как правило такой диагноз возникает на фоне:

  • Длительного приема сильнодействующих антибактериальных препаратов, что приводит к незначительному угнетению функций иммунной системы и дисбактериозу.
  • Использования вагинальных контрацептивов. Такие средства могут нарушать баланс полезных и вредных микроорганизмов в половых органах.
  • Применение противозачаточной внутриматочной спирали. Этот метод контрацепции также нарушает баланс микрофлоры, способствует размножению коккобацилл.

Если вредоносные микроорганизмы активно размножаются, в половых органах начинается дисбактериоз. Это может способствовать развитию воспаления, венерического заболевания и пр. Кроме того, пациентка наблюдает неприятную симптоматику в форме зуда, жжения, обильных выделений из влагалища. Если вас беспокоят такие признаки дисбаланса микрофлоры, обязательно запишитесь на прием к гинекологу и сдайте мазок.

Что представляет собой дисбиоз?

Дисбиоз определяется как нарушение микрофлоры влагалищной среды. Если его не лечить, то болезнь будет прогрессировать, вызвав при этом ряд самых негативных последствий.
I степень – явление довольно редкое, мазок чистый, только палочковая флора, единичные лейкоциты и клетки плоского эпителия в оптимальных количествах;

II степень – среди палочек могут «проскакивать» единичные кокки или примешиваться другие непатогенные микроорганизмы тоже в единичных экземплярах, эта степень самая распространенная среди здоровых в гинекологическом плане женщин;

III степень – для нее характерна условно-патогенная флора и дрожжеподобные грибы, проявляющие тенденцию к активному размножению. Это может свидетельствовать о развитии воспалительной реакции на присутствие избыточного количества условно-патогенных микроорганизмов.

IV степень – признаки явного воспалительного процесса: обильная кокковая или кокко-бациллярная (смешанная) флора, возможно наличие трихомонад, гонококков или других патогенных микроорганизмов.

В подобных случаях назначаются дополнительные лабораторные исследования (бактериологические, ПЦР и др.) для поиска возбудителя и дальнейшего лечения.

Она не требует много затрат, да и ответ долго ждать не придется.

Причины

Смешанная флора в мазке может возникнуть как у взрослых женщин, ведущих активную половую жизнь, так и у молодых девочек подростков. Причин развития такого отклонения от нормы может быть несколько – это и воспалительные процессы в половых органах и инфекционные венерические заболевания.

Сильный зуд, жжение, выделения из влагалища с неприятным запахом могут свидетельствовать о развитии кольпита или бактериального вагиноза. Основными возбудителями таких недугов являются вредоносные микроорганизмы. Некоторые патологии развиваются при повышении количества лейкоцитов, для других же заболеваний такое условие не обязательно. Однако в любом случае в мазке наблюдается повышенная концентрация вредоносных патогенных бактерий.

Некоторые заболевания невозможно полностью вылечить без антибиотиков. Однако такие лекарства уничтожают часто не только вредные, но и полезные бактерии из-за чего у женщины начинается дисбаланс вагинальной микрофлоры. Также антибиотики снижают иммунную защиту, что провоцирует размножение болезнетворных микроорганизмов.

Еще одной причиной смешанной микрофлоры могут стать слишком частые спринцевания. Раствор вымывает микрофлору во влагалище и провоцирует рост вредных бактерий. Если вы хотите сохранить баланс флоры, лучше откажитесь от внутриматочных спиралей и гормональных контрацептивов.

Определить точную причину развития патологического состояния может только квалифицированный медик после комплексного обследования организма пациентки. Современная диагностика позволит установить точный диагноз и назначить эффективное лечение.

На что обратить внимание?

Девушкам и женщинам стоит обратить внимание на симптомы.

  1. При появлении сильного зуда, жжения и выделения неприятный слизи с неприятным запахом возможно развитие венерического недуга, что бывает у девочек вначале полового созревания или у женщин с приходом климактерического периода.
  2. Важно обратить внимание на правила сдачи мазка на флору. Перед проведением процедуры нельзя принимать ванны, использовать свечи, тампоны и таблетки. Стоит отказаться от посещения туалета за 2 часа до сдачи мазка.
  3. Провести спринцевание накануне можно, но только теплой водой без использования мыла, иных средств гигиены.
  4. Нельзя сдавать мазок в период месячных, в начале либо в конце цикла.
  5. При взятии мазка из носоглотки нужно отказаться от приема пищи и питья воды.
  6. Женщинам обратить внимание на симптомы. Может быть, болит нижняя часть живота, наблюдается покраснение, зуд, неспецифические выделения из половых органов, что бывает после длительного приема антибиотиков и диагностируется кандидоз.

Женщинам важно знать, что должно и чего не должно быть в мазке. Для того, чтобы свою флору, нет ли развития воспалительного процесса и в норме ли микроорганизмы в мазке во избежание развития инфекционных возбудителей: грибка Кандиды, стрептококка, стафилококка, гонококка, грамотрицательных бактерий. Например, наличие стрептококков во флоре в большом количестве может привести к выкидышу, гибели плода у беременных, развитию воспалительных процессов в мочеполовой системе, поражению мочеточника, мочевого пузыря и половых органов.

Низкий уровень эстрогенов в организме говорит о размножении палочки дедерлейна или дисбактериоза при повышенном содержании лейкоцитов и отсутствие палочки дедерлейна, при этом нарушено соотношение между эритроцитами и лактобациллами. Э может быть после длительного приема антибиотиков. Приводит к эрозии шейки матки, развитию воспалительных процессов в мочеполовой системе. Рост патогенной флоры во влагалище неизбежно ведет к воспалению в слизистой влагалища, развитию неспецифического воспаления, такого как смешанная флора.

Анализ

Смешанная флора в мазке у женщин может быть скудной, обильной или нормальной. От правильной подготовки к сдаче лабораторного анализа во многом зависит точность результата исследования.

Гинеколога нужно посещать в профилактических целях не реже 1 раза в год. Во время осмотра медик обязательно берет мазок на флору влагалища. Если пациентка беременна или у нее есть какие-либо гинекологические заболевания, проводить такую диагностику придется намного чаще.

Чтобы сдать анализ успешно, обязательно воспользуйтесь приведенными ниже рекомендациями медицинских специалистов.

  • За несколько часов до приема у гинеколога обязательно посетите туалет, так как позже мочеиспускание запрещено.
  • Для ежедневной интимной гигиены используйте теплую воду. От мыла или гелей для интимной гигиены рекомендуется отказаться минимум на сутки.
  • В течение нескольких дней воздерживайтесь от интимной близости.
  • Откажитесь от спринцеваний, использования вагинальных суппозиториев или тампонов.

Во время месячных сдавать мазок на флору не рекомендуется, так как обильные выделения могут исказить картину, и медик не сможет поставить точный диагноз. Несмотря на то, что расшифровку мазка нужно доверять только опытному медицинскому специалисту, каждая женщина должна знать, каких микроорганизмов не должно быть обнаружено в нормальном анализе. В категорию инфекционных возбудителей входят – стрептококк, стафилококк, гонококк, грибок Кандида, грамотрицательные бактерии.

Как подготовиться к взятию мазка из уретры

  1. За неделю до назначенной даты прекратить прием препаратов, о которых скажет уролог.
  2. За двое суток не заниматься сексом.
  3. Подмыться накануне исследования, но не в день его проведения, чтобы случайно не смыть бактерии.

За 2-3 часа до назначенного времени нельзя ходить в туалет по малой нужде. Объясняется это требование просто — током мочи можно вымыть из уретры бактерии, а потому результат будет неточным или вообще ошибочным.

Чтобы добиться максимальной достоверности, к предстоящей процедуре нужно тщательным образом подготовиться. Обычно перед назначением анализа доктор объясняет подобные нюансы. Рассмотрим, как проводится подготовка к мазку из уретры:

  • За неделю до предстоящего исследования мужчине нужно отказаться от приема медикаментозных средств, которые не являются жизненно необходимыми. В особенности это касается гормональных, антибактериальных и противовоспалительных средств.
  • За трое суток до забора мазка стоит ограничить половую жизнь. Это касается не только секса, но и мастурбации.
  • Вечером, перед утренней манипуляцией, мужчине необходимо произвести гигиенические процедуры, касаемо полового члена. Следует отметить, что утром мыть или чем-либо обрабатывать орган строго запрещено.
  • Осуществить акт мочеиспускания разрешено не менее чем за 3 часа до взятия мазка на исследование.

При проведении гигиенических процедур накануне откажитесь от ароматизированных косметических средств. Делать подмывания можно с помощью обычного детского мыла.

  • не рекомендуется мочиться за 2–3 часа перед взятием мазка из уретры;
  • гигиенические процедуры лучше всего делать вечером, а не утром;
  • следует ограничить занятия сексом за два дня до манипуляции;
  • в случае приема антибиотиков, процедура может осуществляться только по истечении недели после окончания курса.

Данные меры способствуют получению правдивых результатов.

Иногда врач может порекомендовать провести массаж предстательной железы или мочеиспускательного канала перед проведением процедуры на взятие мазка из уретры. После манипуляции наблюдаются незначительные боли, жжение и ощущение дискомфорта в области полового члена, которые пройдут через 2–3 часа без медикаментозного воздействия

Расшифровка

Результат лабораторного исследования микрофлоры матки и влагалища должен внимательно изучить гинеколог. Эта информация поможет ему обосновать возникновение у пациентки неприятной симптоматики, поставить точный диагноз и при необходимости назначить лечение. Самостоятельно заниматься расшифровкой гинекологических анализов не рекомендуется, но некоторые подробности все же знать необходимо.

Во время гинекологического осмотра медик изымает небольшое количество слизи из влагалища или шейки матки, и отправляет образец на лабораторное исследование. Если у женщины нормальная микрофлора, полезных бактерий в образце будет не менее 95%. Такие микроорганизмы защищают мочеполовую систему от вредных элементов, предотвращая их патологическое размножение.

Существует несколько степеней чистоты флоры во влагалище, а именно:

  • Степень №1. В образце есть небольшое количество слизи, лейкоциты и эпителиальные клетки в норме. Обнаружено большое количество полезных лактобактерий. Это свидетельствует о нормальной микрофлоре и отсутствии воспалительных процессов в половых органах.
  • Степень №2. В образце нормальное содержание лейкоцитов. Дрожжевых грибков и лактобактерий немного больше нормы. У пациенток с таким анализом значительно возрастает риск развития воспаления. Такой результат исследования мазка может также сообщать о недавно проведенном аборте, выскабливании или биопсии.
  • Степень №3. В мазке много лейкоцитов и клеток эпителия.
  • Сетепень №4. В образце микрофлоры слишком много лейкоцитов, лактобактерии вообще не обнаружены. Мазок полностью заселен вредными бактериями и микроорганизмами. На такой стадии не рекомендуется проводить какие-либо гинекологические процедуры, так как у пациентки развивается воспаление. При необходимости медик может назначить пересдачу анализа.

Если в мазке пациентки обнаружена смешанная патогенная микрофлора, кокки или дрожжевые грибки, необходимо незамедлительно начинать соответствующее лечение. У пациенток с плохими анализами нередко возникают дополнительные неприятные симптомы – зуд, выделения слизи из влагалища, жар, повышение температуры тела.

При беременности

Влагалищная микрофлора каждой женщины уникальна. Когда пациентка вынашивает ребенка, патогенные микроорганизмы начинают активно размножаться. Именно из-за этого у беременных часто обнаруживается молочница или бактериальный вагиноз.

Это связано с нарушением кислотно-щелочного баланса. Смешанная микрофлора может возникнуть не только из-за развития инфекционных или обострения хронических гинекологических заболеваний. Такое нарушение также нередко является следствием изменения гормонального фона в женском организме.

Гинекологи рекомендуют сдать мазок на флору еще на этапе планирования беременности. Такая диагностика позволит предотвратить развитие воспаления, которое нередко возникает у женщин на ранних сроках беременности. Важно, чтобы во время вынашивания ребенка во флоре пациентки было не более 5% вредных микроорганизмов. Изменение pH может возникать по разным причинам, а именно:

  • Длительное лечение антибиотиками;
  • Снижение иммунной защиты организма;
  • Воспалительные патологии мочеполовой системы;
  • Нарушение баланса микрофлоры влагалища.

Смешанная флора во время беременности может крайне негативно отразиться на росте и развитии плода. Своевременное обнаружение и устранение отклонения позволит нормализовать уровень pH во влагалище, блокировать размножение вредоносных микроорганизмов.

Комплексное лечение смешанной микрофлоры во время беременности направлено на уничтожение вредных микроорганизмов – коккобацилл, стафилококка, гонококка и тд. Терапия подбирается медиком индивидуально для каждой пациентки. Во время вынашивания ребенка категорически запрещено заниматься самолечением. Если вы обнаружили какие-либо тревожные симптомы, незамедлительно сообщите об этом гинекологу.

Во время гинекологического осмотра врачи берут биологический материал с целью последующего микроскопического и бактериологического исследования. Рассмотрим детально, насколько опасна смешанная флора в мазке.

Результат указывает на нормальную, смешанную, палочковую флору в мазке, но что это такое известно не каждой девушке. Подобная диагностика определяет на ранней стадии патологические изменения в функционировании половой системы и отдельных органов

Анализ выявляет: бластоспоры (грибок Candida), гарднереллы, клебсиеллы, коки, коринекобактерии, коринобактерии, лептотриксы,нейтрофилы и прочее.

Что означает смешанная флора

Влагалищная среда населена неопасными и условно-опасными микроорганизмами. Когда количество болезнетворных представителей превышает число полезных бактерий, повышается риск развития гинекологических заболеваний. Потенциально опасным считается увеличение численности лейкоцитов, лактобацилл, мицелия, фибрина, эритроцитов.

Такие результаты свидетельствуют о прогрессировании патологий инфекционного или воспалительного характера. В период беременности обнаружение патогенной флоры в мазке представляет опасность для внутриутробного развития плода. Стафилококки, гонококки и коккобациллярные представители провоцируют выкидыш и преждевременные роды.


Процесс забора мазка на флору из влагалища

В норме концентрация полезных бактерий составляет 95%, а условно-патогенных не больше 5%. Патогенных микроорганизмов в мазке здоровой женщины быть не должно. При смешанной флоре наблюдается дисбаланс между количеством полезных лактобактерий и условно-патогенных кокков и палочек. Количество последних резко увеличивается.

Смешанная флора появляется при снижении местного иммунитета. Существует несколько причин такого состояния:

  1. Лечение антибиотиками. Препараты этой группы нарушают баланс между болезнетворными и естественными микроорганизмами, в результате чего развивается молочница, бактериальный вагиноз.
  2. Использование спермицидных средств контрацепции. Они повышают содержание во влагалищной среде и на шейке матки лейкоцитов и условно-патогенной флоры.
  3. Ношение внутриматочных спиралей. Увеличивается риск активного размножения коккобацилл, нарушения биоценоза влагалища.
  4. Перенесенная ОРВИ, кишечная инфекция. Баланс микрофлоры половых путей также нарушается при хронической патологии пищеварительного тракта.

Когда влагалищная флора перенаселена болезнетворными микроорганизмами, развивается дисбактериоз. Это одна из причин воспалительных процессов в половых путях.

Дисбактериоз всегда сопровождаются зудом и жжением половых органов, а при гинекологическом осмотре отмечается покраснение влагалища, зева матки.

При молочнице появляется белый налет (споры грибов Candida). На фоне бактериального вагиноза при активизации гарднерелл появляется сероватый налет с запахом тухлой рыбы.

При таких симптомах важно посещение гинеколога, проведение осмотра на кресле с зеркалами и выполнение микроскопического анализа (обзорный мазок на вагинальную флору).

Показано и бактериологическое исследование (посев материала из шейки матки и влагалища на флору). Исследование предусматривает выращивание микроорганизмов на питательной среде. Если колонии увеличиваются, выявляют тип возбудителя, его чувствительность к антибиотикам, а затем назначают лечение.

Лечение патогенной флоры

Нормальная или умеренная смешанная флора влагалищной среды говорит о хорошем уровне здоровье пациентки, что отмечается первой или второй степенью чистоты. В этом случае проведение какой-либо специфической терапии не требуется.

Наравне с этим, если появляются дополнительные тревожные симптомы (зуд, раздражение, жжение, покраснение, обильные выделения, неприятный запах), следует посетить гинеколога и пройти осмотр на кресле.

Зачастую нарушение баланса микрофлоры влагалища (умеренное или выраженное) наблюдается после приема медикаментов из группы антибиотиков. Эти лекарства убивают патогенные и полезные бактерии. Но только благодаря этому появляется возможность справиться с различными инфекционными заболеваниями.


Медикаментозное лечение дисбактериоза влагалища, вызванного гарднереллой

Выбор препарата для лечения воспалительных процессов в половых путях будет зависеть от выявленного возбудителя болезни:

  • Молочницу (кандидозный кольпит) лечат противогрибковыми препаратами.
  • При выявлении гарднерелл в высоком титре показан прием метронидазола.
  • Условно-патогенная флора хорошо лечится антисептиками широкого спектра действия.
  • При смешанной инфекции применяются препараты, воздействующие сразу и на грибы, и на бактерии.

Приоритет отдается средствам местного действия (суппозитории, вагинальные таблетки). Системные препараты в таблетках и капсулах в гинекологии назначаются крайне редко: при выраженном воспалительном процессе у женщин с иммунодефицитом, при хламидийной и микоплазменной инфекции.

Ультразвук шейки матки: способы проведение и процедуры при беременности

Если женщины лечатся антибиотиками, нужно придерживаться следующих правил:

  1. Соблюдать терапевтическую схему.
  2. Не прерывать курс после исчезновения симптомов.
  3. Принимать назначенную дозу.
  4. Провести курс восстановления микрофлоры половых путей пробиотиками после завершения антибактериальной терапии.

Если дисбиоз влагалища – последствие антибактериальной терапии, то необходимо в течение 2-3 недель придерживаться диетического питания, ввести в рацион кисломолочные продукты, свежие овощи и фрукты, исключить алкоголь и газированные напитки, сладости.

По назначению врача стоит принимать препараты, восстанавливающие флору. Они идут в виде капсул, таблеток и суппозиториев.

При кандидозном поражении прописывают медикаменты из группы противогрибковых средств. Если были выявлены гонококки, обязательно комплекс включает антибактериальные препараты.

Контролируется эффективность назначенной терапии посредством изучения результатов анализа: бактериологического посева из цервикального канала. Контрольное исследование делается спустя 2 недели после завершения курса терапии. Определять, какие именно принимать лекарства, должен только лечащий врач.

смешанная флора в мазке — 25 рекомендаций на Babyblog.ru

нашла тут в интернете интересную статью по поводу лечения этих бяк и его целесообразности (много букв). может, кому-то будет интересно. не убирается под кат(((((((((( модераторы, если можно, уберите под кат, плииииз.

Уреаплазма и микоплазма, а также принципы лечения воспалительных заболеваний в гинекологии

Ура! Наконец-то по этому вопросу и у нас в стране выработана официальная позиция ведущих научных учреждений! Поздравляю всех вас, больше не надо сидеть и оправдываться — мол, существуют разные позиции, мнения разделились, четкого алгоритма нет, кто-то считает….. Ура! теперь можно ссылаться на официальнейшие источники! Уреаплазма и микоплазма не являются абсолютными патогенами, и их обнаружение в анализах не требует лечения — это теперь не точка зрения, а официальная позиция.

История вопроса:
Мое мнение по этому поводу всегда было отражено в ВиО, вопрос достаточно частый, и я привыкла на него отвечать одной фразой «уреаплазмы и микоплазмы не имеют клинического значения в акушерстве и гинекологии». Уреаплазма и микоплазама — возбудители неспецифических уретритов, чаще у мужчин. В 30% случаев и более — представители нормальной микрофлоры половых путей. Обнаружение их методом ПЦР не является показанием к их прицельному лечению, даже если имеются симптомы воспалительного процесса — надо лечить более частых возбудителей, а поскольку ими являются хламидии, а препараты, используемые против них и мико- и уреаплазм — одни и те же, то и вопрос о лечении мико- и уреаплазмоза снят. Даже если принять, что они есть и имеют значение, они все равно лечатся теми же препаратами, следовательно определять их не имеет смысла.
Но людей редко удовлетворяет мой ответ, они читают интернет и находят всякие страсти. Специально для них два года назад я задала вопрос на уважаемом мной сайте www.antibiotiс.ru и представляю вам ответ профессионалов-микробиологов:

Являются ли мико- и уреаплазмоз клинически значимыми инфекциями? Целесообразно ли их лечить перед планируемой беременностью или при наличии клиники? Отличается ли схема лечения от таковой хламидиоза? Правда ли, что один из биоваров уреаплазмы чаще проявляет устойчивость к доксициклину? В чем клиническое значение определения этих биоваров?

На вопрос о клинической значимости генитальных микоплазм трудно дать однозначный ответ, по крайней мере, на данный момент времени. Дело в том, что исследования их этиологической роли при различный патологических состояниях как женской, так и мужской урогенитальных систем начались сравнительно недавно.

Так, например, Horowitz J. с соавторами (1995 г.) указывают на то, что наличие в цервикальном канале уреаплазмы в сочетании с повышенным титром антител к данному микроорганизму могут служить маркером для выявления группы женщин с повышенным риском развития осложнений беременности (преждевременные роды и преждевременное излитие околоплодных вод) [1].

Исследователи из Испании в результате обследования 219 матерей и их новорожденных (1992 г.) делают вывод о том, что колонизация матерей генитальными микоплазмами не связана с преждевременным излитием околоплодных вод, преждевременными родами и низким весом новорожденных. Колонизация новорожденных уреаплазмами также не повышала риск развития преждевременных родов, низкого веса новорожденных и каких-либо заболеваний в первые 3 месяца жизни [2].

По данным, полученным в двойном слепом плацебо-контролируемом исследовании применения короткого курса эритромицина для профилактики преждевременных родов (1990 г.), преждевременное излитие околоплодных вод встречалось у 6% пациенток, получавших эритромицин против 16%, получавших плацебо. При этом эритромицин значительно уменьшал частоту преждевременного излития околоплодных вод в группе пациенток с хламидийной инфекцией. Бактериальный вагиноз, Ureaplasma urealyticum (уреаплазма) и Mycoplasma hominis (микоплазма) значимо не повышали риск описанных осложнений беременности [3].

В США в 1991 г. были опубликованы результаты очень большого исследования 4900 беременных, обследованных на носительство Ureaplasma urealyticum (уреаплазмы) на 23-26 неделях беременности. После проведения многовариантного анализа было установлено, что колонизация уреаплазмы не была связана с низким весом новорожденных, преждевременным излитием околоплодных вод и преждевременными родами [4].

Более свежие исследования также различаются по полученным результатам. Так, при сравнении исходов беременности у 172 беременных, колонизированных Ureaplasma urealyticum (уреаплазма) и 123 беременных без колонизации было выявлено, что высокий уровень колонизации является фактором риска развития хориоамнионита и преждевременных родов (2000 г.). В то же время низкий уровень колонизации не вызывал описанных осложнений [5].

В Бельгии после обследования 228 беременных (2000 г.) в первом триместре на наличие бактериального вагиноза, микоплазмы и уреаплазмы, была установлена их связь с повышенным риском прерывания беременности в сроке до 20 недель [6].

По результатам рандомизированного исследования проведенного у 166 беременных в Италии (2000 г.) была выявлена роль колонизации Ureaplasma urealyticum (уреаплазма) в развитии преждевременного разрыва плодных оболочек [7].

При обследовании 303 беременных в Индии (1998 г.) было выявлено, что Ureaplasma urealyticum (уреаплазма) является распространённым обитателем нижних отделов половых органов у женщин на момент родов (примерно у половины обследованных). Несмотря на это, микроорганизм не являлся фактором риска преждевременных родов или низкого веса новорожденных [8].

В Дании при обследовании 484 беременных (2001 г.) было установлено, что ни бактериальный вагиноз, ни колонизация Ureaplasma urealyticum не были связаны с развитием преждевременных родов [9].

Если есть клиника цервицита и/или уретрита у женщин или уретрита у мужчин, то на начальном этапе экономически не целесообразно обследование на генитальные микоплазмы. Даже если не обнаружены гонококки и хламидии доступными методами при данных заболеваниях, то лечить их нужно в любом случае. Рекомендуется назначать противогонококковый препарат (однократно цефтриаксон или ципрофлоксацин) в сочетании с противохламидийным (однократно — азитромицин или 7-дневный курс других препаратов). Если лечение неэффективно, то необходимо повторное обследование культуральными методами на гонорею и хламидиоз. При обнаружении гонококков — повторное лечение после определения чувствительности или при невозможности её определения — препаратом из другой группы. У хламидий до сих пор не было выявлено клинически значимой резистентности к специфическим препаратам (тетрациклинам, эритромицину, азитромицину).

Противохламидийные препараты эффективны и в отношении генитальных микоплазм в тех же дозах. Тетрациклины действуют и на мико- и на уреаплазмы. Однако в последнее время установлено, что около 10% уреаплазм устойчивы к тетрациклинам, поэтому при неэффективности лечения уретрита с использованием доксициклина, необходимо назначение эритромицина или азитромицина или офлоксацина [10].

Вид Ureaplasma urealyticum состоит из 14 или более сероваров, которые разделены на 2 биовара. Ранее они назывались биовар 1 или parvo и биовар 1 или Т960. В настоящее время эти биовары расцениваются, как 2 различных вида: U.parvum и U.urealyticum, соответственно [11]. Они различаются по распространённости. U.parvum встречается у 81-90%, U.urealyticum у 7-30% женщин, а иногда они сочетаются — 3-6% случаев [9, 12]. Вид U.urealyticum, т.е. бывший биовар 2 (Т960) преобладает у женщин воспалительными заболеваниями органов малого таза, осложнениями беременности, а также чаще бывает устойчив к тетрациклинам [12]. Определение этих биоваров проводится в исследовательских целях и не является необходимым и экономически целесообразным в рутинной клинической практике.

Беременные должны проходить обследование на гонорею, генитальный хламидиоз, трихомониаз, бактериальный вагиноз и при выявлении — получать антибактериальную терапию. Нет оснований для целенаправленного обследования их на генитальные микоплазмы и эрадикации этих микроорганизмов. Не следует рутинно назначать антибиотики для пролонгирования беременности при угрозе её прерывания, кроме как при выявлении гонореи, хламидиоза трихомониаза или бактериального вагиноза [13].

С.В. Сехин, НИИ антимикробной химиотерапии

Литература

Horowitz J et al. Ureaplasma urealyticum cervical colonization as a marker for pregnancy complications. Int J Gynaecol Obstet. 1995; 48: 15-9. Fullana Montoro A. et al. Ureaplasma urealyticum and Mycoplasma hominis: incidence and clinical significance of their isolation in the perinatal period. An Esp Pediatr. 1992; 36: 285-8. McGregor JA, et al. Cervicovaginal microflora and pregnancy outcome: results of a double-blind, placebo-controlled trial of erythromycin treatment. Am J Obstet Gynecol. 1990; 163: 1580-91. Carey CJ, et al. Antepartum cultures for Ureaplasma urealyticum are not useful in predicting pregnancy outcome. Am J Obstet Gynecol. 1991; 164: 728-33. Abele-Horn M., Scholz M., Wolff C., Kolben M. High-density vaginal Ureaplasma urealyticum colonization as a risk factor for chorioamnionitis and preterm delivery. Acta Obstet Gynecol Scand. 2000; 79: 973-8. Donders G.C., Van Bulck B., Caudron J. et al. Relationship of bacterial vaginosis and mycoplasmas to the risk of spontaneous abortion. Am J Obstet Gynecol. 2000; 183: 431-7. Calleri L.F., Taccani C., Porcelli A. Ureaplasma urealyticum vaginosis and premature rupture of membranes. What is its role? Minerva Ginecol. 2000; 52: 49-58. Paul V.K., Gupta U., Singh M. et al. Association of genital mycoplasma colonization with low birth weight. Int J Gynaecol Obstet. 1998; 63: 109-14. Povlsen K., Thorsen P., Lind I. Relationship of Ureaplasma urealyticum biovars to the presence or absence of bacterial vaginosis in pregnant women and to the time of delivery. Eur J Clin Microbiol Infect Dis. 2001; 20: 65-67. Taylor-Robinson D. Ureaplasma urealyticum, Mycoplasma hominis and Mycoplasma genitalium. In: Mandell GL, Bennett JE, Dolin R (Eds). Principles and Practice of Infectious Diseases. 5th Ed. Philadelphia. Churchill Livingstone. 2000: 2027-2032. Kong F., Ma Z., James G., Gordon S., Gilbert G.L. Species identification and subtyping of Ureaplasma parvum and Ureaplasma urealyticum using PCR-based assays. J Clin Microbiol. 2000; 38: 1175-9. Abele-Horn M., Wolff C., Dressel P. et al. Association of Ureaplasma urealyticum biovars with clinical outcome for neonates, obstetric patients, and gynecological patients with pelvic inflammatory disease. J Clin Microbiol. 1997; 35: 1199-202. Gibbs R.S., Eschenbach D.A. Use of antibiotics to prevent preterm birth. Am J Obstet Gynecol. 1997; 177: 375-80. http://www.antibiotic.ru/faq.php?cat=5#13

Но все равно по данным интернета и журнальных статей, среди ученых этой позиции придерживались только сотрудники данного НИИ. В журналах изобиловали статьи о роли уреаплазм и мелькали схемы их лечения. А я продолжала оправдываться, отвечать на повторные письма «как же вы говорите, что лечить не надо — ведь везде написано обратное», и чтобы не посылать всем этот ответ — написала эту статью. И вот в июне 2005 г. я получаю экстравыпуск издательства МедиаМедика, посвященный антибиотикотерапии гинекологических инфекций. И хотя там подробно прописан копирайт, все равно позволю себе процитировать (цитаты — в кавычках):

«Частые ошибки в назначении антибиотиков при воспалительных заболеваниях органов малого таза»

«1. Монотерапия.» Имеется в виду назначение схем, не перекрывающих весь спектр возможных возбудителей, а направленных только против конкретного, выявленного в ПЦР или посеве. Так любимые всеми исследования на определение чувствительности к антибиотикам, праведный гнев «мне назначили схему наугад, не сделав исследования», «против чего меня лечат, что значит воспаление, кто там живет конкретно» — с такими претензиями тоже сталкиваешься ежедневно. И есть врачи, которые спекулируют этим желанием узнать математическую истину и назначают схемы конкретно по результатам посевов, не перекрывая полный спектр возможных, а не только выявленных возбудителей. Математики в медицине нет, выявленный микроб не всегда означает, что именно он является возбудителем, что нет других возбудителей, которых анализы не выявили. И нельзя обрезать схемы по выявленным возбудителям, обязательно в схему должен входить противохламидийный препарат и препарат против анаэробов, даже если все это не обнаружено в анализах. Т.е. схемы подбираются эмпирически — [2]

«2. Переоценка роли внутриклеточных возбудителей. Широкое применение неадекватных тестов и их свободная интерпретация привели сегодня к гипердиагностике хламидиозов, необоснованному назначению макролидных антибиотиков, формированию к ним резистентных микроорганизмов, напрасным затратам на лечение и контрольную диагностику, нередко вновь положительную, хотя устойчивость к макролидам у хламидий редка. Оцениваемая при скрининговых программах частота выявления хламидий при воспалительных заболеваниях органов малого таза составляет около 50%, при учете ложноположительных результатов и контрольном исследовании иным методом частота участия хламидий составляет около 10-12% (I.VanValkengoed et al, 2004).»

«3. Несмотря на установленную условную неабсолютную патогенность урогенитальных микоплазм и уреаплазм, нередко при их обнаружении начинается специфическая антибактериальная терапия даже при отсутствии клинической симптоматики. В настоящее время микоплазмы и уреаплазмы относят к обычным комменсалам, в небольших количествах присутствующих в микрофлоре влагалища. Они могут быть участниками воспалительных процессов органов малого таза смешанной этиологии, но не требуют специфического лечения, направленного на эрадикацию только данных возбудителей.»

«4. Недостаточные дозы и курсы антибактериальных препаратов». Тут все ясно. Псевдозабота и укорочение курса до 5 дней, недостаточная кратность приема препарата — и все, все побочные эффекты антибиотиков вы получили, прямого эффекта — полного уничтожения возбудителя — нет. Инфекция осталась и стала резистентна к применяемым препаратам. Теперь ее надо лечить чем-то другим, а организм ослаблен первым лечением, и вы опять себя жалеете (или врач вас) и опять укорачивается схема, и опять все напрасно. Потом вам говорят, что «вообще-то хламидии редко окончательно вылечиваются, давайте-ка лучше поднимать ваш иммунитет».

«5. Отказ от антибактериальной терапии. Увлечение иммунокоррекцией, применением препаратов пищеварительных ферментов (энзимотерапия) и других методов с недоказанной и сомнительной эффективностью нередко заменяет основу лечения инфекции — антибактериальную терапию.» Золотые слова!

Резюме:

Диагностика мико- и уреаплазмоза не нужна. Не надо сдавать на них анализы — ни кровь на антитела, ни посев (тем более что только в единичных столичных лабораториях его действительно делают, а определение чувствительности к антибиотикам технически малореально, в обычных местах пишут результаты ПЦР как посев), ни ПЦР.Если по каким-то причинам анализ сделан, на его результаты не надо обращать внимания, он не являются критерием ни постановки диагноза, ни тем более назначения лечения.

Планирование беременности и сама беременность — не показание для ПЦР-диагностики вообще, а тем более для ПЦР-диагностики уреа- и микоплазм. Ведение в данном случае не отличается от ведения небеременных женщин — жалобы и мазок.

Лечат не анализы, а жалобы. Если жалоб нет, и обычный мазок на флору показывает нормальное количество лейкоцитов, никакое дальнейшее обследование и лечение не нужно. Если дополнительное обследование все-таки сделано, и в ПЦР что-то найдено, это не критерий для назначения лечения. Помимо отсутствия клинической значимости уреа- и микоплазм, необходимо помнить о высокой частоте ложноположительных результатов ПЦР. Назначать этот анализ в отсутствии жалоб вообще, а в присутствии жалоб — до или вместо мазка — некомпетентность и развод на деньги. Если жалобы есть, а мазок, сделанный в хорошей лаборатории, хороший, показаний для антибиотиков нет, надо искать другие причины жалоб — дисбактериоз, сопутствующие заболевания, гормональный дисбаланс, аллергию, папилломатоз.

Если есть жалобы и признаки воспалительного процесса в мочеполовой системе, назначается антибиотикотерапия — либо по результатам дополнительных обследований (ПЦР и посев с определением чувствительности) — на различных возбудителей (хламидии, гонококки, трихомонады, стрептококки, кишечную палочку и тд и тп), но не на уреа- и микоплазмы, либо «вслепую» — против основных возбудителей таких заболеваний (гонококков и хламидий). Противохламидийный препарат назначается обязательно, в любом случае, независимо от результатов анализов, поскольку это самый частый возбудитель, и поскольку у него нет резистентности к противохламидийным антибиотикам (посев с определением чувствительности хламидий — тоже профанация). Все мико- и уреаплазмы чувствительны к противохламидийным препаратам (исключение — некоторая доля уреаплазм устойчива к доксициклину). Поэтому даже если через какое-то время докажут патогенность и клиническую роль этих микроорганизмов, все равно адекватное лечение воспалительных заболеваний без их определения устраняет и их вместе с хламидиями. Поэтому опять же — определять их нет никакого смысла. Вопреки тому, что говорят сейчас во многих коммерческих центрах, лечение в данном случае не зависит от результатов анализов, схема одна.

Эта схема очень проста и недорога, многокомпонентный список антибиотиков на двух листах против положительной ПЦР на уреаплазму — это некомпетентность и развод на деньги. Доксициклин — старый препарат, но основные возбудители воспалительных заболеваний в гинекологии сохранили к нему чувствительность. Однако длительность лечения им не короче 10 дней. Эквивалентным по эффективности против основных возбудителей является однократный прием 1 г сумамеда. Для тех, кто продолжает бояться уреаплазм, это препарат выбора, поскольку те уреаплазмы, которые генетически нечувствительны к доксициклину, чувствительны к сумамеду. Научные исследования доказали эквивалентность курсового лечения однократному приему 1 г. Быстро, просто, дешево.

Сегодняшний подход коммерческой медицины к воспалительным заболеваниям в гинекологии и их лечению — невспаханное поле мифов и некомпетентности. ПЦР-лаборатории должны быть загружены работой 🙂 Поскольку в платной медицине вы можете сдавать только то, что хотите — сэкономьте на лишнем анализе и уж тем более на дорогой схеме лечения абсолютной нормы. Потому что как правило ситуация выглядит следующим образом: приходит здоровый человек, которого ничего не беспокоит, но который хочет убедиться, что он здоров. Его (ее) сразу отправляют на ПЦР на 12 инфекций, называя это «обследованием на все» (можно подумать, больше в мире инфекций нет). 4 инфекции из этих 12 — уреаплазмы (2 биовара) и микоплазмы (hominis — та, что не имеет клинического значения в гинекологии, но имеет в этиологии хронического кашля, и определение антител в крови — это антитела именно к ней, они часто присутствуют, но это не говорит о генитальной локализации микроба — и genitalium — та, что имеет клиническое значение в урологии, вызывая неспецифический уретрит у мужчин, и у женщин вообще не должна определяться), т.е. их определять не надо вовсе. 2 — кандидоз и бактериальный вагиноз — прекрасно видны в обычном мазке, как и еще 3 — стрептококк, гонококк и трихомонады, но эти 3 лучше подтвердить методом ПЦР, правда — после мазка. Из оставшегося списка определение папилломавирусов не имеет никакого значения, диагностика проводится методом кольпоскопии — осмотр наружных половых органов и шейки матки. Ибо лечат не наличие папилломавируса в ПЦР, которая может быть ложноположительной, а папилломавирусное поражение гениталий, которое видно глазом. Наличие вируса в отсутствие патологии шейки матки — не критерий для лечения. Т.о., остается одна позиция в этом 12-компонентном списке, имеющая смысл, — хламидиоз. Но. При хорошем мазке результат ПЦР не имеет значения, а при плохом мазке противохламидийный препарат добавляется в схему лечения обязательно…. Зачем вы делали ПЦР? ….. Но на этом беды пришедшего человека не заканчиваются. Заплатив сумму с лишними нулями за полную ПЦР-диагностику вместо обычного мазка на флору, он получает бланк с положительной гарднереллой и уреаплазмой (самый частый случай, ибо это действительно частые нормальные сожители организма человека, чувствительность ПЦР-диагностики которых часто завышена. Т.е. обнаруживается положительная реакция ПЦР на гарднереллы при идеальном мазке, отсутствии ключевых клеток и жалоб, характерных для бактериального вагиноза. Это не повод для лечения!) и дальше — рассказ об опасностях этих микробов и назначение схемы лечения на огромном листе, с инъекциями, иммуномодуляторами, эубиотиками, ферментами, гепатопротекторами, сильными противогрибковыми препаратами «для профилактики молочницы» (не надо провоцировать ее необоснованным лечением — не понадобится профилактика. Современные исследования показали, что профилактика кандидоза во время антибиотикотерапии — неэффективна. Он не так часто развивается на фоне РАЦИОНАЛЬНОЙ антибиотикотерапии, а уж если развивается, то предварительная профилактика противогрибковыми препаратами неэффективна. Поэтому современный подход таков — есть кандидоз — есть его лечение. Нет — нет. В схему лечения других инфекций противогрибковые препараты для профилактики добавлять не надо. Если кандидоз после приема антибиотиков все-таки развивается, его тогда и лечат.) и несколькими антибиотиками разных классов. Все это на двоих стоит внушительно, но не это — главная беда. Главная беда — полное расстройство собственной микрофлоры, в результате чего наконец-то появляются жалобы, которых раньше не было. Это интерпретируется как неэффективность одного курса терапии, назначаются следующие и так долго-долго человек лечится непонятно от чего. Особо добрые доктора запрещают на время лечения половую жизнь 🙂 Во время лечения инфекций — имейте в виду — половая жизнь возможна! просто с презервативом строго (т.е. надевать его вовремя — с самого начала, не только для предохранения от беременности, но в первую очередь для профилактики прямого контакта слизистых и перезаражения). Дополнительную проблему создает неправильная проверка эффективности «лечения» — повтор ПЦР раньше чем через 4 недели после приема последней таблетки. Ну те уреаплазмы и гарднереллы, что являются нормальными сожителями, как правило остаются 🙂 их можно лечить годами :).

А вот например хламидии, которых лечить действительно надо, при слишком рано проведенной контрольной ПЦР, снова обнаруживаются, и необоснованно назначается повторный курс лечения. А потом рано или поздно наступает момент, когда испробованы все возможные препараты (часто в разных курсах используют разные названия одного и того же препарата — либо по реальному незнанию синонимов, либо просто чтобы создать видимость разнообразия и смены препаратов — не так их много, а схемы многокомпонентны, надо же чем-то их заполнить. Вот и давайте сегодня попейте сумамед, ах, он вам не помог, ну давайте в следующий раз новый суперпрепарат азивок, сегодня офлоксин, а в следующий раз таривид и тд и тп.), и тогда вам заявляют или вы находите спасительное мнение в интернете — «не переживайте, что препараты не помогли и не удивляйтесь этому. Хламидии вообще нельзя вылечить!» Надо же что-то придумать в оправдание некомпетентности, а люди верят в то, чему хотят верить.

Поэтому если Вы все-таки по каким-то показаниям принимаете антибиотики, то соблюдайте принципы рациональной антибиотикотерапии воспалительных заболеваний органов малого таза:- если схема назначается не по результатам посева с определением чувствительности, она должна включать в себя антибиотики широкого спектра действия, действующие на гонококки, хламидии, кишечную флору и анаэробы. — противохламидийный препарат (доксициклин, сумамед) должен входить в схему обязательно, независимо от результатов анализов. Как и противоанаэробный (трихопол, тиберал)- неправильная схема приема препарата сводит на нет все лечение. Очень важно соблюдать длительность антибиотикотерапии, кратность приема в течение дня, учитывать сочетание препаратов с едой, друг с другом и тд. Для этого есть аннотации, и тут я опять рекомендую сайт www.antibiotic.ru — там есть информация по препаратам для пациентов.- лечение всегда назначается всем партнерам, по результатам самого плохого анализа (т.е. если у женщины гноевидные выделения, повышены лейкоциты в мазке, а у мужчины ничего нет и ПЦР «на все» отрицательно — ему назначается та же схема, что и ей, кроме вагинальных средств.) Поэтому и смысла обследования партнера, если его самого ничего не беспокоит, — нет. Лечиться ему все равно нужно, а если он получит отрицательные результаты анализов — его будет еще сложнее на это уговорить.- во время лечения воздержания не нужно, но необходимо строгое предохранение и от беременности и от инфекций — только презерватив! Гормональные контрацептивы при совместном приеме с антибиотиками теряют свою эффективность. Только презерватив. Смысла в воздержании нет.- принимать алкогольные напитки одновременно с антибиотиками можно, если Вы это перенесете 🙂 И то и другое метаболизируется в печени, будет больше побочных реакций, только и всего.- профилактическое назначение противогрибковых препаратов, если кандидоза в мазке нет, — не нужно- для профилактики дисбактериоза кишечника целесообразен прием препаратов бифидо- и лактобактерий (лакто — только если нет кандидоза) в суточной дозе для взрослых, начать прием надо за неделю до антибиотиков, продолжить на фоне антибиотиков и не меньше 2 недель после них.- контрольные анализы ПЦР делают не раньше, чем через 4 недели после приема последней таблетки.

Если лечили не венерическое заболевание (не гонорею, на хламидиоз и не трихомониаз), и жалоб после лечения нет — можно контрольные анализы не делать. Если есть жалобы раньше, можно делать анализ раньше — мазок и посев.- начинать антибиотикотерапию лучше всего с первого дня менструального цикла. Если в этом цикле не было строгого предохранения, принимать антибиотики можно только по строгим показаниям, поскольку прием их в цикле зачатия — официальное показание для прерывания беременности.- если все же после приема антибиотиков наступает беременность, следует помнить о принципе «все или ничего». На таких ранних сроках повреждающее воздействие оказывается либо в целом, и беременность замирает, либо не оказывается, и она сохраняется. Это утешение для тех, кто оказался в такой ситуации, но все-таки лучше в ней не оказываться. После приема антибиотиков мужчиной предохраняться желательно 2-3 месяца, до обновления спермы. Женщине необходимо предохраняться строго весь цикл. В урологии уреаплазмы имеют клиническое значение, вызывая неспецифический уретрит, чаще у мужчин. ПЦР в этом случае (при уретрите у женщин) берут из мочеиспускательного канала, а не из шейки матки.

Вообще — значение правильного забора материала для анализов и вообще качество анализов и степень доверия им — отдельная тема отдельного разговора. См. статью Анализы на ЗППП. В лечении негонококковых уретритов также обязательно используются противохламидийные препараты, эффективные против уреаплазм, поэтому и тут необходимость анализа на уреаплазмы сомнительна. Вот так 🙂

Почему я так упорствую против ПЦР на уреаплазму, кроме того что экономлю деньги в чужих кошельках, — потому что опыт показывает очень частую положительную реакцию, практически в 90% случайного ПЦР-обследования уреаплазма оказывается положительной. В хороших, надежных, проверенных лабораториях, в которых хламидиоз и микоплазма встречаются гораздо реже. Речь идет о Москве. Либо уреаплазма действительно гораздо более часто является нормальным представителем микрофлоры, чем о ней это пишут, либо в лабораториях Москвы так настроена диагностика, что порог положительной реакции занижен. Может быть со временем это изменится. Но пока своим пациентам я говорю не только, что уреаплазма и микоплазма не имеют клинического значения в гинекологии и их не надо проверять — так же я говорю и об иммунном статусе, например, но не протестую, если люди его сдают. А против ПЦР на уреаплазму протестую. Потому что скорее всего она окажется положительной. И мне жалко психику людей, читающих интернет 🙂 Но теперь, слава Богу, мне есть на что сослаться и что ответить, теперь уже это не мое личное мнение, а официальная позиция российского акушерства и гинекологии.

Ссылки — см. начало, ответ НИИ АМХА

также:

1. В.И.Кулаков, А.С.Анкирская, С.М.Белобородов. «Антибактериальная терапия воспалительных заболеваний органов малого таза: задачи, решения, ошибки». /Гинекология, 2005, экстравыпуск «Современные экспертные рекомендации по антибиотикотерапии инфекций в гинекологии». С. 3-5.

2. А.П.Никонов «Диагностика и антимикробная химиотерапия инфекций верхнего отдела генитального тракта». Там же, с. 5-7.

В этой статье две замечательные цитаты: «Выделение U.urealiticum и M.hominis не является критерием диагностики и не может служить показанием к проведению специфической терапии»

И еще, оправдывающая назначение эмпирических схем:»Обнаружение в половых путях женщин значительного количества микробов-ассоциатов (большинство из которых обнаруживается и в норме) подчас представляет значительные трудности в плане диагностики и рациональной этиотропной терапии, поскольку наличие того или иного микроорганизма в большинстве случаев не может являться единственным диагностическим критерием, впрочем как и тестом на излеченность. Именно поэтому в гинекологии так часто используют эмпирические схемы лечения, обеспечивающие элиминацию очень широкого спектра возможных возбудителей».

Малярская Мария Михайловна

Источник: http://www.myriamm.ru

Гинекологические заболевания — Ответы специалистов на вопросы по медицине (страница 34)

!

Для взрослых

Для детей

На ваши вопросы отвечают ведущие врачи медицинских учреждений Челябинска.



Всего вопросов 893 показывается по 5 10 15 25

15.01.2008

Здравствуйте! С чем может быть связан длительный воспалительный процесс (лейкоцитоз на шейке более 100 с июня и до сих пор)? Анализы на ИППП отрицательные. У партнера тоже все нормально. Мой гинеколог не знает причину воспаления. Назначила свечи Нео-пенотрон. Ирина

Ирина!
Наверное, обследование было недостаточным для выяснения причины. Основная причина — конечно, инфекция. Возможно, имеет место хронический цервицит, эндометрит. Необходимо провести углубленное обследование. В такой ситуации высокий риск получить серьезные заболевания (изменения эпителия шейки матки). Вы можете обратиться к нашим специалистам для проведения обследования.

С уважением, врач акушер-гинеколог, директор
Клиники репродуктивной медицины
Канаева Елена Юрьевна

15.01.2008

Здравствуйте! Маме ставят диагноз миома 6-7 недель и признаки ГПЭ. Предлагают делать диагностическое выскабливание, причем на фоне всего этого у нее гипертония. Процедура неприятная, поэтому такой вопрос: какое обезболивающее можно делать во время выскабливания, и сколько оно стоит? Заранее благодарю. Ольга

Уважаемая Ольга!
Обезболивание обычно используется общее — внутривенный наркоз. При выборе препарата для наркоза врач-анестезиолог будет учитывать, что у Вашей мамы гипертония. Стоимость наркоза может быть разной в разных клиниках. Оптимальным вариантом процедуры является выполнение диагностической гистероскопии с раздельным диагностическим выскабливанием (это предварительный осмотр полости матки до и контрольный — после выскабливанияс использованием эндоскопической техники. Вы можете обратиться в нашу клинику для выполнения этой процедуры, стоимость гистероскопии с РДВ и наркозом — 7500, срок госпитализации — 1 день.

С уважением, врач акушер-гинеколог, директор
Клиники репродуктивной медицины
Канаева Елена Юрьевна

09.01.2008

Здравствуйте, мне 16 лет, и я девственница. но до того как у меня начались месячные, у меня были белые выделения- бели, сейчас же у меня неделю идут месячные,а в остальное время бели. Но они такие обильные последнее время, что ощущение что у меня весь год идут месячные.. только неделю настоящие, остальное время бесцветные. Я не знаю может это какое-то заболевание?? просто это же невозможно терпеть…Заранее спасибо Ксения

Не нужно терпеть, Ксения.
Выделения у женщины есть в любом возрасте из половых путей (за исключением возраста с 1 месяца жизни до 7-8 лет). После того, как циклы у девочки становятся овуляторными (то есть в середине цикла в яичнике происходит овуляция — разрыв фолликула и выход яйцеклетки), выделения приобретают свои особенности в зависимости от фазы менструального цикла. Вкратце: в норме в середине цикла (в периовуляторный период) выделения становятся слизистыми. Слизь напоминает белок сырого куриного яйца. Это может длиться около 3-5 дней. В остальное время выделения напоминают рисовый отвар — они светлые, без неприятного запаха и не вызывают дискомфорта. Количество их может чуть увеличиться за несколько дней до менструации.
Если все же выделения вызывают дискомфорт, даже девственница может обратиться на прием к женскому врачу. Врач осмотрит (безболезненно) внешне, возьмет обзорный мазок. Все станет понятно.

С уважением, акушер-гинеколог,
директор Медицинского центра «Ты и Я» 
Коробченко Людмила Олеговна

21.12.2007

Здравствуйте! Мне 32 года. Сходила к гинекологу и у меня обнаружили эрозию, да и она еще и кровила при осмотре. нашли 3 кисты. поставили Дз: эндоцервиоз. Назначили лечение Генфероно свечи и тержинан свечи. Можно ли вылечить кисты с помощью этих препаратов? Спасибо! Галина

Добрый день, Галина.
Скорее всего, врач назначил противовоспалительное лечение, так как различают эрозии ш/матки неосложнённые и осложнённые, например сопровождающиеся воспалительным процессом. При помощи противовоспалительного лечения, к сожалению, полностью вылечить эрозию и кисты ш/матки невозможно. Нужны дополнительно деструктивные методы лечения (ДЭК, криотерапия, радио-волновой метод и т.п.)

С уважением, врач акушер-гинеколог
Шталь Мария Петровна
Медицинский центр «Аист»

21.12.2007

Скажите, пожалуйста, если девушке, не живущей половой жизнью врач поставил диагноз Эрозия шейки матки и требуется прижигание, то можно ли прижигание делать житким азотом? И как эта процедура проходит? Заранее спасибо. Ольга

Добрый день, Ольга.
Выбор метода лечения эрозии шейки матки зависит не от того, живёт ли пациентка половой жизнью, или нет, а от состояния шейки матки на момент осмотра (кольпоскопии), наличия инфекций и др. Метод криодеструкции (воздействие на изменненую слизистую шейки матки, в том числе эрозию шейки матки, очень низкими температурами, грубо говоря не прижигание, а замораживание) является одним из наиболее щадящих методов лечения. Криодеструкция проводиться в «Медицинском центре» Аист», более подробную информацию по поводу стоимости данной манипуляции, условий её проведения вы можете узнать по телефону: 232-99-68.

С уважением, врач акушер-гинеколог
Шталь Мария Петровна
Медицинский центр «Аист»

20.12.2007

Здравствуйте! Мне 21 год. Не знаю что делать! У меня большая эрозия, проходила обследование, в том числе сдавала анализы. Пролечилась. Получилась так, что наблюдалась у троих врачей. Двое гинекологов говорят, что надо делать прижигание житким азотом (тем более выявили ВПЧ), другой- прижигание делать нельзя, т.к. я не рожавшая. Что можете посоветовать Вы!? И можно ли при большой эрозии ходить в солярий? Заранее спасибо. Ольга

Ольга! Заочно только с Ваших слов нельзя назначать лечение. Это в принципе не правильно, так как человек существо индивидуальное и не похожее на других. Конечно если у Вас есть заболевание шейки матки, то его надо лечить, а уж каким методом это Ваш лечащий доктор должен решать, так как он берет ответственность на себя. Подумайте об этом, может стоит обратиться по данной проблеме к врачу который занимается именно заболеваниями шейки матки и еще раз проконсультироваться. Во многих частных центрах и женских консультациях есть данные специалисты.
А на счет посещения солярия, то эта процедура не совсем безопасная для кожи, хотя выглядить красивой и загорелой хочется наверное всем. Просто надо соблюдать меру и все.

С уважением, врач акушер-гинеколог, врач УЗИ
директор МЦ «Репродуктивное здоровье»
Родионов Александр Сергеевич

14.12.2007

Здравствуйте! Мне 22 года, замужем. Планирую беременность. Скажите пожалуйста, что означяют мои результаты узи … Делала узи на 49 д.ц., беременности сказали нет.
Тело матки определяется в обычном положении.
Длина 58 мм, Толщина 39 мм, Ширина 48
Эндометрий — толщина 17 мм
Левый яичник длина 46мм, толщина 20мм, фолликулы в стороне и по переферии левого яичника d до 4,5 мм
Правый яичник длина 37 мм, толщина 22 мм
Эхоструктура изменена за счет визуализации доминир. фолликула справа размером 18*20 мм, по переферии ан.фолликулы. Это все, что смогла разобрать, что было написано врачом.
Помогите! Заранее спасибо. Оксана

Оксана! По результатам УЗИ у Вас утолщен эндометрий. Такое состояние бывает если у женщины есть беременность (маточная или внематочная) или это гиперплазия эндометрия (патологическое разрастание эндометрия на фоне эндокринных нарушений). Так как у Вас есть задержка месячных, то я бы посоветовал Вам сдать анализ крови на хорионический гонадотропин или хотя бы сделать тест на беременность. Ну и конечно же повторить УЗИ в зависимости от их результатов.

С уважением, врач акушер-гинеколог, врач УЗИ
директор МЦ «Репродуктивное здоровье»
Родионов Александр Сергеевич

11.12.2007

Мне 23 года, замужем. Два года назад у меня был бартолинит. Делали вскрытие, чистили, кололи антибиотики. Вскрытие делали, кололи новокаин, боль адская, я даже поседела. Скажите такие операции можно делать под общим наркозом или более сильными обезбаливающими? Полгода назад я лечились у частного врача. У меня спустя два года рана не затянулась, отверстие осталось, оно не болит и не беспокоит. Врач сказала, что с этим можно жить. Скажите, так ли это? А недавно я начала чувствувать дискомфорт при занятии сексом с мужем, вроде как тянет и трёт об рубец. Вопрос: обязательно ли удалять железу или она нужна? может ли после удаления быть большой рубец, который тоже может мешать? Как делается операция по удалению железы наиболее безболезненно? Елена

Если бартолинит не лечится консервативно, то его лечат оперативно. Операцию конечно можно делать под любым видом наркоза, это зависит от оперирующего хирурга, анестезиолога и есть или нет противопоказания к наркозу. Естественно, наличие рубца может вызывать дискомфорт при половой жизни, так как мягкие ткани замещаются на более плотные соединительно-тканные или фиброзные.

С уважением, врач акушер-гинеколог, врач УЗИ
директор МЦ «Репродуктивное здоровье»
Родионов Александр Сергеевич

04.12.2007

Здравствуйте. У меня выявили Вирус папилломы человека, тип 16. Что это означает, скажите, пожалуйста?! Ольга

Ольга! Вирус папилломы человека — это вирус, который может длительно существовать в организме, в том числе в эпителии шейки матки. Опасность, которая при этом существует — это активная пролиферация клеток эпителия с возможным появлением атипичных клеток. Эта возможность существует, но не обязательно осуществляется — это уже зависит от ряда факторов — наличие других факторов риска, иммунная защита организма и т.п. Существуют препараты для лечения в таких ситуациях, однако одного противовирусного препарата, который убивал бы вирус папилломы — пока не найдено. Вам необходимо следить за состоянием эпителия шейки матки (кольпоскопия, мазки на цитологию) — 2 раза в год. Иногда имеются случаи самопроизвольного выздоровления — то есть при следующем обследовании (даже если не было лечения) вирус не выявляется. Таким образом, если нет патологии шейки (при кольпоскопии и цитологическом исследовании) и нет других инфекций, то идет наблюдение. Из препаратов можно порекомендовать препарат индинол (его молекулярное действие — подавление факторов роста, то есть торможение пролиферации клеток эпителия). В дальнейшем необходимо наблюдаться у специалиста.

С уважением, врач акушер-гинеколог, директор
Клиники репродуктивной медицины
Канаева Елена Юрьевна

04.12.2007

Здравствуйте. Скажите, пожалуйста, как применять солковагин при эрозии шейки матки? Ольга

Ольга! Солковагин будет использовать врач, самостоятельно Вы не сможете провести лечение. Химическая коагуляция эпителия шейки матки происходит сразу после обработки эпителия солковагином (это смесь кислот). Пользоваться препаратом нужно очень осторожно, чтобы не повредить здоровые ткани. Через 2-3 нед. на месте патологического эпителия появляется новый — здоровый. Солковагин используется как правило, при небольших поражениях шейки матки. Предварительно необходимо полное обследование, иначе результат лечения не будет отвечать Вашим ожиданиям.

С уважением, врач акушер-гинеколог, директор
Клиники репродуктивной медицины
Канаева Елена Юрьевна

20.11.2007

Скажите, пожалуйста, чем, какими лекарствами обычно лечат дисбактериоз влагалища? Дарья

Если, Дарья, вы имеете в виду бактериальный вагиноз, то сначала назначаются препараты группы метронидазола, имеющие антианаэробную активность, затем назначают препараты для восстановления нормальной микрофлоры влагалища (ацилакт, «Жлемик»). Назначать лекарства должен врач на приеме.

С уважением, акушер-гинеколог,
директор Медицинского центра «Ты и Я» 
Коробченко Людмила Олеговна

20.11.2007

Здравствуйте! У меня такая проблема: мне 21год, есть ребенок, противозачаточные таблетки или какие либо препараты не принимаю (только однажды принела «постинор», еще задолго до рождения ребенка), а проблема в том, что у меня не регулярные месячные, идут они каждый месяц и ровно по 6 дней, но промежуток между ними всегда разный (колеблится от 32 до 21 дня), Менстр.цикл с 13 лет. Я никогда не знаю когда они должны начаться. Подскажите, пожалуйста, с чем это может быть связано? Посоветуйте что-нибудь! В остальном меня ничего не беспокоит. Зарание благодарю за ответ! Марина

Здравствуйте, Марина! Нужно показаться врачу. Скорее всего если на осмотре не будет найдено каких-нибудь внешних отклонений, для регуляции цикла и с целью контрацепции вам можно назначить КОК (комбинированные оральные контрацептивы, они же противозачаточные таблетки). Название сказать не могу. Так как назначать их желательно индивидуально с учетом вашего фенотипа (комплекса внешних и внутренних признаков).

С уважением, акушер-гинеколог,
директор Медицинского центра «Ты и Я» 
Коробченко Людмила Олеговна

19.11.2007

Зравствуйте! Спустя 1г. и 6мес. после родов мне поставили повторный диагноз эрозия шейки матки (незначительная)- проводили кольпоскопию, т.е. эрозия была и до беременности (незначительная). сдала кучу анализов и в итоге назначили лечение — виферон-2. затем сделали повторную кольпоскопию — эрозии не выявили. спустя 3 мес. мне поставили снова диагноз — эрозия шейки матки. разве эрозия может снова появится? и поддается ли она лечению? Екатерина

Уважаемая Екатерина!
Вероятнее всего, у Вас имеется хронический цервицит. Именно он может так себя вести — то появляются изменения на шейке матки, то отсутствуют. Кроме того, то, что Вам назначали виферон — также подтверждает что имелись воспалительные изменения шейки матки. Если лечение проводится недостаточно активно или не выявлен этиологический фактор — инфекция (хламидии, уреаплазмы, герпес, вирус папилломы человека) Вы так и будете постоянно сталкиваться с этой проблемой. Оптимальным является проведение полного обследования и полноценное лечение (при необходимости с использованием современных методов — химической или радиоволновой терапии).

С уважением, врач акушер-гинеколог, директор
Клиники репродуктивной медицины
Канаева Елена Юрьевна

16.11.2007

Здравствуйте. Мне 20 лет, пользуюсь оральной контрацепцией. В последнии дни появилась боль во время полового акта. На следущий день, после полового акта, появлись обильные водянистые выделения. Подскажите, пожалуйста, с чем это может быть связанно. Ранее никаких болезней не было. Ольга

Здравствуйте Ольга.
Заочно ответить на Ваш вопрос не представляется возможным. т.к. симтомы, которые Вы описываете могут сопровождать разные патологические процессы. Нужна консультация и осмотр врача гинеколога.
на приём Вы можете записаться по телефону:232-99-68.

С уважением, врач акушер-гинеколог
Шталь Мария Петровна
Медицинский центр «Аист»

15.11.2007

На приеме у гинеколога мне поставили диагноз «эрозия шейки матки», это произошло через 2 месяца после начала половой жизни. Не лечила год, на следующий год пошла к врачу, оказалось, эрозия стала больше и захватила всю шейку. Сдала анализы, показали молочницу и повышенное содержание лейкоцитов. Принимала Итразол и Полижинакс, после лечения никаких инфекций, в т.ч. и молочницы, не обнаружено, но уровень лейкоцитов вновь сильно повысился. При этом наблюдаются выделения, как при молочнице. Что это может быть? Не является ли причиной этого прием ретиноидов или антибиотиков типа Доксициклина? В чем может быть причина такого состояния? Анна

Анна! У Вас на фоне эндоцервицита (эрозии шейки матки) скорее всего есть дисбактериоз влагалища. Конечно, на прием антибиотиков может быть обострение кандидозного кольпита (молочницы), поэтому Вам необходимо обратиться к гинекологу чтобы Вам сделали кольпоскопию, взяли анализы и назначили лечение.

С уважением, врач акушер-гинеколог, врач УЗИ
директор МЦ «Репродуктивное здоровье»
Родионов Александр Сергеевич

06.11.2007

Здравствуйте. Скажите, пожалуйста, нормально ли то, что по прошествии двух месяцев после криодеструкции у меня появились необильные выделения с запахом, похожим на запах сразу после криодеструкции. Сейчас этот запах слабо выражен. И что делает врач на повторном после процедуры приеме? Могу ли не ходить на этот прием? Ведь процедура лечения уже выполнена. Дарья

Дарья! Возможно у Вас явления дисбактериоза слизистой влагалища, а поэтому, наверное, все же следует показаться гинекологу для уточнения диагноза и возможного лечения.

С уважением, врач акушер-гинеколог, врач УЗИ
директор МЦ «Репродуктивное здоровье»
Родионов Александр Сергеевич

01.11.2007

Здравствуйте! мне 20 лет, не рожавшая. Обратилась в клинику с альгоменореей, начались обследования. По узи КИЯ с обеих сторон, смещение тела матки (под вопросом спаечный процесс), потом расширенная колькоскопия ШМ, обнаружена небольшая эрозия ШМ, взята биопсия ШМ на патологогистологическое исследование. Ее заключение: плоская кондилома ШМ, эктопия цилиндрического эпителия ШМ (заживающий эндоцервикоз), ассоциированная с хроническим неспецифическим цервитом в фазе минимальной активности воспалительного процесса. Косвенные признаки папилломовирусной инфекции ШМ. Затем прошла ИФА, ПЦР, РИФ диагностики-ничего не обнаружено.
после был перерыв, связанный с каникулами, после которого я попала в больницу с пиелонефритом, в заключении лечения прошла 10дневный курс офлоксина.
В клинике оказалось, что у меня сменился врач, который после колькоскопии полипы не обнаружил, объянив это тем, что прошла курс антибиотиков в больнице, сразу же мне назначил ОК Линденет 20 и 10 дневное лечение в клинике, заключающееся (описываю как мне объясняли) в ванночка, обработка чем-то с серебром и тампон на 6 часов с «болтушкой». После взят мазок на цитологию, цитограмма без особенностей, ШМ-плоский эпителей, ЦК-кубический эпителий. Сделали прижигание ШМ, назначили 10дней Гексикона. Через месяц пришла, снова мой 2 врач уволился, 3 врач провел колькоскопию, эрозия не зажила, а перешла из заживающего эндоцервикоза в «обычную эрозию». Снова прижигание, 10 дней Гексикона, 10дн Поликсидония и 5дн Изопринозина, визит через полтора месяца.
Вопрос в том, что первый врач назначал только обследованмя не говоря о лечении, второй возмутился, почему меня до сих пор не лечат, третий говорит о том, что необходимо лечить кондиломы (видя только заключение гистологического исследования) какими-то инъекциями за 18 тыс (1 раз в 2 месяца по 6 тыс) иначе через 10 лет у меня будет рак. После такого количества лечения, какие нужно пройти исследования перед этими инъекциями, для подтверждения диагноза. И если вероятность того, что мне необходимо родить как можно раньше, чтоб не поддвергнуть нас опасности. Беременность не планируется еще 3 года минимум (окончание университета), но очень хочется.
Спасибо, что смогли все прочитать, постаралась все описать подробно. Надеюсь на Вашу помощь. Полина

Полина! В народе говорят: сколько людей, столько и мнений. В медицине точно так же, хотя и существуют определенные стандарты и принципы лечения, но тактику и способ лечения выбирает все же Ваш лечащий врач, беда только в том, что доктора в этой клинике меняются как перчатки. Конечно папиломовирусная инфекция является одним из фактров развития рака шейки матки и в настоящее время создана вакцина «Гардафил», которая направлена на профилактику этой инфекции, но для того чтобы ее поставить необходимо сдать анализы с целью определения серотипа ПВИ (а именно 6, 11,16,18). И если у Вас их не обнаружено, то тогда можно вакцинироваться. Мне также не совсем понятно каким способом Вам делали «прижигание» и зачем, ведь лечение плоской кондиломы заключается в хирургическом ее иссечении, что по — видимому и было сделано во время первой кольпоскопии. Вообще-то мне из вашей истории понятно только одно, что все лечение было собрано в кучу и контрольного гистологического заключения у Вас так и не было сделано. Наверное Полина, Вам все же стоит выбрать медицинский центр или женскую консультацию и ходить все же к одному доктору. Что же касается беременности, то Вы ее можете планировать когда Вам это будет нужно, а не когда это требует Ваш доктор, временных показателей тут нет, тем более в Вашем возрасте.

С уважением, врач акушер-гинеколог, врач УЗИ
директор МЦ «Репродуктивное здоровье»
Родионов Александр Сергеевич

30.10.2007

Просьба растолковать анализ микроскопического исследования (урогенитальные выделения):
U — эпителий плоский в умеренном количестве, лейкоциты 2-4 в п/зрения, микрофлора смешанная в умеренном количестве.
C — эпителий цилиндрический в умеренном количестве, лейкоциты 15-25 местами до 35 в п/зрения, слизь в умеренном количестве, микрофлора смешанная в незначительном количестве.
V — эпителий плоский в значительном количестве, лейкоциты 2-5 в п/зрения, микрофлора смешанная в значительном количестве. Трихомонады, гонококки, дрожжевые грибы, «ключевые» клетки не обнаружены.
Примечание: 4 недели назад прошла лечение от хламидиоза, контрольный анализ на хламидиоз — отрицательный. Месяц назад сдавала также анализы на уреаплазму, микоплазму, ТОРЧ- инфекции — отрицательные. Можно ли планировать беременность?
Спасибо. Екатерина

Здравствуйте, Екатерина! Для интерпретации мазка нужно знать ваш возраст и день менструального цикла, когда брали мазок. В любом случае описанный мазок нельзя назвать идеальным. 1. Количество лейкоцитов в ЦК (цервикальном канале) до 35 в скоплениях (повышено). 2. Флора во влагалище смешанная в значительном количестве ( во влагалище здоровой женщины должны преобладать палочки Дедерлейна, они же молочнокислые палочки или лактобациллы или умеренная смешанная флора). Данный мазок соответствует III степени чистоты влагалищного содержимого по основным параметрам, кроме тех, о которых я написала выше. III степень встречается у половозрелых здоровых женщин, живущих половой жизнью, в начале и в конце менструального цикла.
Чтобы разобраться, рекомендую провести комбинированную провокацию и 3 раза сдать мазки. В любом случае после лечения инфекции нужно восстановить микрофлору влагалища и кишечника. И планировать беременность.

С уважением, акушер-гинеколог,
директор Медицинского центра «Ты и Я» 
Коробченко Людмила Олеговна

17.10.2007

Добрый день! У меня нарушение цикла — 2 месяца нет месячных. На УЗИ обнаружили: многокамерное образование 69 х 36 с толстыми перегородками. Поставили диагноз: кистома яичника (? ) или гидросальпинкс. Врач предлагает сразу оперативное лечение, ссылаясь на то, что в гинекологии нет мест, чтобы провести медикаментозное лечение, говорит что оно все равно не дает результатов. На операцию соглашатся не хочется (лапараскопию у нас не делают), у меня уже было 4 операции. Посоветуйте как мне поступить. Ирина

Ирина! Мне очень трудно ответить на Ваш вопрос, так как я не могу, опираясь лишь на Ваши слова и непонятные данные УЗИ, поставить Вам диагноз. Если это кистома яичника, то конечно надо оперировать, а если это гидросальпинкс, то полостная операция ни к чему не приведет, так как сама вызывает спаечный процесс. К тому же Вы не указали какие операции уже перенесли. Приедте к нам в центр, ко мне на консультацию, чтобы попробовать разобраться в сложившейся ситуации. Записаться можно по тел. (351) 263-46-00, 265-21-39.

С уважением, врач акушер-гинеколог, врач УЗИ
директор МЦ «Репродуктивное здоровье»
Родионов Александр Сергеевич

03.10.2007

Здравствуйте! Обратилась к врачу с жалобой на зуд влагалища и области анального отверстия и выделений из влагалища. Сдала анализы на все инфекции — ничего не обнаружено, на гормоны — все в норме, но выявлено нарушение микрофлоры, врач прописал лечение от дисбактериоза (трихопол — 7дн, промывание влагалища 3% перекисью водорода — 5 д, свечи нео-пенотран — 14 дн., хилак форте — 10 дн, свечи полиоксидоний — 10дн.). После лечения симптомы не исчезли. Может быть эта схема не эффективна, подскажите, пожалуйста. Планирую вторую беременность, очень хочу вылечиться. Что Вы можете сказать о преператах Биовестин и Биовестин-лакто, помогут ли они, и как их можно использовать. Заранее спасибо за ответ. Наталья

Уважаемая Наталья!
После проведения лечения необходимо провести контроль на излеченность (восстановление микрофлоры влагалища). Если дисбактериоз сохраняется, необходимо провести дальнейшее лечение. Если с микрофлорой все в порядке, а зуд продолжает беспокоить — необходимо исключить более серьезное заболевание — зуд вульвы (или крауроз), которое уже имеет другие причины и лечится по-другому.

С уважением, врач акушер-гинеколог, директор
Клиники репродуктивной медицины
Канаева Елена Юрьевна

03.10.2007

Здравствуйте! у меня такая ситуация: я заболела молочницей, начала недавно обследование. но пока еще не все анализы готовы и вся картина не ясна. Мой парень очень чистоплотный, после каждого полового акта принимает душ.
Месяц назад начала принимать «Патентекс-Овал». Скажите, пожалуйста, возможно ли появление молочницы результатом использования свечей? Могла ли я заразиться от него? Если принять дефлюкан или флюкостат, нужно еще промывание? Марина

Уважаемая Марина!
Лучше всего дождаться результатов обследования, после чего предпринимать уже какие-то действия. Иногда наблюдается реакция на использование препаратов для местной контрацепции — в виде аллергии или появления молочницы, в таких ситуациях лучше на время прекратить использование патентекс-овала и перейти на другой вид контрацепции. Ежедневный душ не всегда является гарантией отсутствия каких-либо инфекций. Окончательное лечение Вам назначит доктор по результатам анализов.

С уважением, врач акушер-гинеколог, директор
Клиники репродуктивной медицины
Канаева Елена Юрьевна

02.10.2007

Здравствуйте! Мне 17 лет. УЗИ показало хроническое воспаление яичников. На данный момент меня ничего не беспокоит и врач сказала, что раз ничего не беспокоит, то волноваться пока не о чем. Чем вообще грозит этот диагноз? Какие признаки его проявления (выделения, запах, боли)? Можно ли без осложнений в будущем иметь ребенка? Наталия

Наталья! Основным симптомом обострения хр. аднексита являются боли или дискомфорт внизу живота. Другой вопрос как Вы в 17 лет заработали такой диагноз? Наверное все же если Вас беспокоят боли, то следует пройти обследования на инфекции передающиеся половым путем. Конечно любой воспалительный процесс органов малого таза (матки, труб, яичников, мочевого пузыря) может привести к бесплодию, поэтому не стоит доводить до этого, а обследоваться и вовремя пролечиться.

С уважением, врач акушер-гинеколог, врач УЗИ
директор МЦ «Репродуктивное здоровье»
Родионов Александр Сергеевич

25.09.2007

Здраствуйте! Я сейчас принимаю Диане 35 (3мес.), беременность планием через 3 месяца (стимуляция). У меня обнаружили дрожжевые клетки Candida (но никаках проявлений молочницы я не чувствую), у мужа тоже Candida, а также Гарднерелла, и еще неспецифический уретрит (сейчас лечится). Подскажите, пожалуйста, надо ли мне лечить молочницу и можно ли после всех наших лечений планировать беременность через 3 месяца. Заранее спасибо за ответ. Вероника

Вероника, лечить молочницу (наличие воспалительного компонента определяется как по субъективным данным, так и по результатам обследования), необходимо. Судя по всему у Вас и Вашего супруга выражен генитальный дисбактериоз. Лечение молочницы ни в какой степени не влияет на планирование беременности через 3 мес. А вот во время беременности справится с ней будет значительно сложнее.

С уважением, врач-гинеколог, директор
Клиники репродуктивной медицины
Канаева Елена Юрьевна

24.09.2007

Добрый день! Хотим с мужем ребенка. Беременность не наступала, после чего я обратилась к врачам.
Выявили гиперплазию надпочечников и поставили АГС под вопросом. Эндокринолог направила к генетику. Генетик скептически посмотрела на меня, мол-чего явилась???
Беременностей прежде не было, с мужем живем 2 года, не предохраняемся 9 месяцев. Но генетик дала (только вчера) направление на сдачу анализа крови на АГС. Объясните, пожалуйста, что может выявится данным анализом и права ли генетик, что причины обращения к ней нет??? Любовь

Уважаемая Любовь! Кто беседовал с Вами из генетиков? АГС — достаточно серьезный диагноз, требует коррекции серьезными гормональными препаратами. Возможны осложнения, связанные с приемом препаратов, в том числе во время беременности. Поэтому врачи так реагируют на Ваш диагноз. Но поддается лечению он хорошо. Необходимо более подробное обследование.

С уважением, врач-гинеколог, директор
Клиники репродуктивной медицины
Канаева Елена Юрьевна

24.09.2007

Мне назначил лечащий врач-гинеколог «солковагин» для того чтобы прижеч эрозию шейки матки, но у меня сомнения, мне сказали что нерожавшим лучше избежать прижегания. А ещё этого лекарства нет в аптеках. К своему гинекологу за консультацией на прием попасть к сожалению не могу (учеба), может есть какие-нибудь свечки или таблетки, которые могут заменить «солковагин» (прижегание) или же мне лучше все-таки обратиться к своему врачу? но позже. Стоит ли тянуть с таким заболеванием? Валентина

Валентина! По вопросам лечения цервицита (эрозии шейки матки) Вам наверное надо все же обратиться к своему лечащему врачу, так как он делал Вам кольпоскопию и знает данные гистологического исследования. Я думаю, что не будет ничего страшного если Вы дождетесь своего лечащего доктора и с ним решите все свои проблемы.

С уважением, врач акушер-гинеколог, врач УЗИ
директор МЦ «Репродуктивное здоровье»
Родионов Александр Сергеевич

Какие анализы ежегодно сдавать женщине

Если вы пришли на плановое ежегодное обследование, и вас ничего не беспокоит, то вам достаточно сдать мазок на флору и цитологию. Если результаты этих исследований в норме — отлично! Впрочем, дополнительно можно сдать анализ на половые инфекции. На всякий случай. 🙂

Мазок на флору

Итак, сначала мазок на флору. Это вроде бы и формальность, но при правильном обращении является очень информативное исследование. Разберёмся?

  • Главное, что показывает мазок (а точнее количество лейкоцитов в мазке) — это наличие воспаления во влагалище и цервикальном канале. Присутствие большого количества лейкоцитов говорит нам о том, что воспаление есть. В свою очередь воспаление вызывается присутствием бактерии или вируса. Кстати, бактерии чаще живут во влагалище, а вирусы — в цервикальном канале. 
  • Наличие спор и мицелий грибов. Тут речь идёт о всеми нами нелюбимой молочнице. 
  • Ключевые клетки — показатель изменения микрофлоры в сторону развития бактериального вагиноза (это когда в большом количестве размножается gardnerella и иже с ними).
  • Флора в норме должна быть палочковая, так как основная масса бактерий влагалища — лактобактерии, а они по форме в виде палочек.
  • Трихомонады — простейшие одноклеточные патогены — сейчас встречаются не так часто, но тем не менее бывают кокки и диплококки. Наличие кокковой флоры может говорить о воспалении или бактериальном вагинозе. Диплококки — это кокки в виде кофейных зёрнышек. Это плохо, потому что это специфическое строение гонококка, а он, как известно, вызывает гонорею. 

Цитология

Далее, цитология. Это исследование клеточного состава эпителия шейки матки и цервикального канала. Оно помогает выявить раковые и предраковые состояния на раннем этапе. Существует несколько методик исследования: на данный момент самым современным и информативным является жидкостная цитология. Здоровой женщине достаточно сдавать цитологическое исследование 1 раз в год.

Анализы на инфекции

Анализ на инфекции (ЗППП и условно-патогенную флору). Далеко не все бактерии и вирусы, обнаруживающиеся во влагалище, необходимо лечить. Например, у вас обнаружилась уреаплазма. Она относится к условно-патогенной флоре, которая имеет право находиться во влагалище. При благоприятных условиях ее наличие не вызывает воспаления и лечить её не надо (то же самое относится к другим у/п бактериям). Обязательно лечить лишь хламидии и микоплазму гениталиум. Это истинные патогены, и даже в небольшом количестве их быть не должно. А все остальное нуждается в лечении лишь при наличии воспаления и дискомфорта.

Итак: если обнаружилась условно-патогенная флора, она нуждается в лечении лишь при сопутствующем воспалении. Если воспаления нет — живите спокойно и не ешьте горстями лишние лекарства! 

 Яна Александровна Никитенко, врач акушер-гинеколог специалист УЗ-диагностики.

Кокки в мазке мужчин — симптомы и лечение

На коже и слизистых оболочках каждого человека обитает разнообразная кокковая флора. Гонококки, пневмококки и другие являются патогенными. Стрептококки и стафилококки, которые представляют большинство данной флоры, считаются условно-патогенными. Эти микроорганизмы присутствуют в небольших количествах и в своих обычных состояниях не вредны для микрофлоры человека. Однако из-за различных неблагоприятных факторов число стрептококков и других микроорганизмов стремительно растет и провоцирует воспалительный процесс. 

Симптоматика

Если в мазке у мужчин обнаружено большое количество кокков, могут проявляться такие симптомы:

  • жжение во время мочеиспускания;
  • болезненность нижней части живота;
  • слизь или слизисто-гнойные выделения из уретры.

Но эти признаки характерны не для единичных заболеваниях. Перечисленные симптомы могут быть при уретрите (воспалении мочеиспускательного канала). Поэтому без проведения анализов установить причину воспаления невозможно. Также стоит учесть, что при осложнениях уретрита палочка кокки может находиться в предстательной железе, семенных пузырьках, яичках, а не только в уретре. 

Факторы, которые сопутствуют кокобацилярной флоре:

  • плохая гигиена;
  • дисбактериоз кишечника;
  • регулярная смена половых партнеров;
  • ухудшение иммунитета;
  • плохое питание.

Грамположительные кокки в мазке у мужчин выявляются после передачи инфекции половым путем.

Диагностика заболевания

После обнаружения кокков в мазке у мужчин, необходимо пройти более тщательное обследование и лечение. Если воспаление ярко-выражено, кроме кокобацилярной флоры в поле зрения обнаруживается более 20 лейкоцитов, а также более 10 клеток эпителия. 

Мазок, взятый из уретры, исследуют следующими методами:

  • ПЦР позволяет определить ЗППП. Этот анализ важен, так как заболевания, передающиеся половым путем, достаточно распространены, и многие из них вызывают опасные осложнения;
  • бактериологический посев на питательные среды позволяет определить чувствительность к антибиотикам. Этот анализ дает понимание о бактериальной нагрузке, другими словами, о количестве кокков.

Как правильно сдавать анализ?

Чтобы получить достоверный результат, необходимо:

  1. Не мочиться за 2 часа до взятия мазка.
  2. За 1–2 дня до проведения обследования не иметь половых контактов.
  3. Не делать лечебные инстилляции в уретру.
  4. Необходимо перенести сдачу анализа, если мужчина принимает антибактериальные препараты.

Как быстро вылечить заболевание (кокки в мазке у мужчин)?

Если в мазке у мужчин в большом количестве обнаружены полиморфные кокки, необходимо срочно принимать меры. Обратитесь за консультацией и назначением лечения к специалисту, если норма кокков превышена. Помните, что самолечение категорически не рекомендуется. 

Автор статьи — Мельников Сергей Юрьевич, главный врач, дерматовенеролог, уролог, миколог, андролог высшей врачебной категории.

Читайте также:

Состав влагалищной микробиоты коррелирует между микроскопией мазка Папаниколау и секвенированием следующего поколения и взаимосвязями с социально-экономическим статусом

  • 1.

    van de Wijgert, J. H. et al . Микробиота влагалища: что мы узнали после десятилетия молекулярной характеристики? PloS one 9 , e105998, https://doi.org/10.1371/journal.pone.0105998 (2014).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 2.

    Равель, Дж. и др. . Микробиом влагалища женщин репродуктивного возраста. Proc. Natl. Акад. Sci. 108 , 4680–4687, https://doi.org/10.1073/pnas.1002611107 (2011).

    ADS Статья PubMed Google Scholar

  • 3.

    Петрова М. И., Рид Г., Ваничутт М. и Лебеер С. Lactobacillus iners: друг или враг? Trends Microbiol. 25 , 182–191, https://doi.org/10.1016 / j.tim.2016.11.007 (2017).

    CAS Статья PubMed Google Scholar

  • 4.

    Gajer, P. et al. . Временная динамика вагинальной микробиоты человека. Sci . Перевод . Medicine 4, 132ra52–132ra52, https://doi.org/10.1126/scitranslmed.3003605 (2012).

    Артикул Google Scholar

  • 5.

    Macklaim, J.М., Клементе, Дж. К., Найт, Р., Глор, Г. Б. и Рид, Г. Изменения микробиоты влагалища после терапии антимикробными препаратами и пробиотиками. Микроб . Ecol . Вылечить . и Dis ., Https://doi.org/10.3402/mehd.v26.27799 (2015).

  • 6.

    Феррер, М., Мендес-Гарсия, К., Рохо, Д., Барбас, К. и Мойя, А. Использование антибиотиков и функция микробиома. Biochem. Pharmacol. журнал 134 , 114–126, https://doi.org/10.1016/j.bcp.2016.09.007 (2017).

    CAS Статья Google Scholar

  • 7.

    Брукс, Дж. П. и др. . Влияние комбинированных пероральных контрацептивов, депо ацетата медроксипрогестерона и внутриматочной системы, высвобождающей левоноргестрел, на микробиом влагалища. Контрацепт. 95 , 405–413, https://doi.org/10.1016/j.contraception.2016.11.006 (2017).

    CAS Статья Google Scholar

  • 8.

    Нойес, Н., Чо, К.-К., Равель, Дж., Форни, Л. Дж. И Абдо, З. Взаимосвязи между сексуальными привычками, практикой менструальной гигиены, демографией и микробиомом влагалища, выявленные с помощью анализа байесовской сети. PLOS ONE 13 , e0191625, https://doi.org/10.1371/journal.pone.0191625 (2018).

    CAS Статья PubMed PubMed Central Google Scholar

  • 9.

    Hellberg, D., Nilsson, S. & Mårdh, P.-А. Бактериальный вагиноз и курение. Внутр. J. ЗППП и СПИД 11 , 603–606, https://doi.org/10.1258/0956462001916461 (2000).

    CAS Статья Google Scholar

  • 10.

    Brotman, R.M. et al. . Связь между курением сигарет и микробиотой влагалища: пилотное исследование. BMC Infect. Дис. 14 , 471, https://doi.org/10.1186/1471-2334-14-471 (2014).

    Артикул PubMed PubMed Central Google Scholar

  • 11.

    Фетерс, К. А., Фэрли, К. К., Хокинг, Дж. С., Гуррин, Л. К. и Брэдшоу, С. С. Факторы сексуального риска и бактериальный вагиноз: систематический обзор и метаанализ. Clin. Заразить. Дис. 47 , 1426–1435, https://doi.org/10.1086/592974 (2008).

    Артикул PubMed Google Scholar

  • 12.

    Пепин, Дж. и др. . Сложная микрофлора влагалища женщин Западной Африки с бактериальным вагинозом. PLoS One 6 , e25082, https://doi.org/10.1371/journal.pone.0025082 (2011).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 13.

    Швебке, Дж. Р., Ричи, К. М. и Вайс, Х. Л. Корреляция поведения с микробиологическими изменениями во влагалищной флоре. J. Infect. Дис. 180 , 1632–1636 (1999).

    CAS Статья Google Scholar

  • 14.

    Low, N. et al. . Интравагинальные практики, бактериальный вагиноз и ВИЧ-инфекция у женщин: метаанализ данных отдельных участников. PLoS Med 8 , https://doi.org/10.1371/journal.pmed.1000416 (2011).

  • 15.

    Borgdorff, H. et al. . Связь между этнической принадлежностью и составом микробиоты влагалища в Амстердаме, Нидерланды. PloS one 12 , e0181135, https://doi.org/10.1371/journal.pone.0181135 (2017).

    CAS Статья PubMed PubMed Central Google Scholar

  • 16.

    Амсел, Р. и др. . Неспецифический вагинит. Ам. J . Медицина 74, 14–22, https://doi.org/10.1016/0002-9343(83)

    -9 (1983).

    CAS Статья Google Scholar

  • 17.

    Ньюджент, Р. П., Крон, М. А. и Хиллиер, С.L. Надежность диагностики бактериального вагиноза повышается за счет стандартизированного метода интерпретации окраски по Граму. J. Клиническая микробиология 29 , 297–301 (1991).

    CAS Google Scholar

  • 18.

    Eriksson, K., Forsum, U., Bjørnerem, A., Platz-Christensen, J. J. & Larsson, P. G. Подтверждение использования мазков из влагалища, окрашенных Папаниколау, для диагностики бактериального вагиноза. Apmis 115 , 809–813, https: // doi.org / 10.1111 / j.1600-0463.2007.apm607.x (2007).

    CAS Статья PubMed Google Scholar

  • 19.

    Donders, G.G. et al. . Аэробный вагинит: патология вагинальной флоры, отличная от бактериального вагиноза. Внутр. Congr. Сер. 1279 , 118–129, https://doi.org/10.1016/j.ics.2005.02.064 (2005).

    Артикул Google Scholar

  • 20.

    Kaambo, E., Africa, C., Chambuso, R. & Passmore, J.-A. S. Микробиомы влагалища, связанные с аэробным вагинитом и бактериальным вагинозом. Фронт. общественное здравоохранение 6 , 78, https://doi.org/10.3389/fpubh.2018.00078 (2018).

    Артикул PubMed PubMed Central Google Scholar

  • 21.

    Lambert, Ja et al . Новые методы на основе ПЦР улучшают характеристику влагалищной микробиоты у пациента с бактериальным вагинозом до и после лечения. заявл. экологическая микробиология 79 , 4181–5, https://doi.org/10.1128/AEM.01160-13 (2013).

    CAS Статья Google Scholar

  • 22.

    Srinivasan, S. et al . Больше, чем кажется на первый взгляд: ассоциации вагинальных бактерий с морфотипами окраски по Граму с использованием молекулярного филогенетического анализа. PloS one 8 , 1–11, https://doi.org/10.1371/journal.pone.0078633 (2013).

    CAS Статья Google Scholar

  • 23.

    Долс, Дж. А. М. и др. . Молекулярная оценка бактериального вагиноза по численности и видовому разнообразию Lactobacillus. BMC Инфекционные болезни 16 , 180, https://doi.org/10.1186/s12879-016-1513-3 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 24.

    Gardner, H. L. & Dukes, C. D. Haemophilus vaginalis vaginitis. г. J. Obstet. Гинеколь. 69 , 962–976, https: // doi.org / 10.1016 / 0002-9378 (55)

    -8 (1955).

    CAS Статья PubMed Google Scholar

  • 25.

    Виртанен, С., Каллиала, И., Ниеминен, П. и Салонен, А. Сравнительный анализ образцов вагинальной микробиоты с использованием анализа гена 16S рРНК. PLOS ONE 12 , e0181477, https://doi.org/10.1371/journal.pone.0181477 (2017).

    CAS Статья PubMed PubMed Central Google Scholar

  • 26.

    Muhleisen, A. L. & Herbst-Kralovetz, M. M. Менопауза и микробиом влагалища, https://doi.org/10.1016/j.maturitas.2016.05.015 (2016).

    Артикул Google Scholar

  • 27.

    Romero, R. et al. . Состав и стабильность микробиоты влагалища здоровых беременных женщин отличаются от таковых у небеременных женщин. Microbiome 2 , 4, https://doi.org/10.1186/2049-2618-2-4 (2014).

    Артикул PubMed PubMed Central Google Scholar

  • 28.

    Датку, Р. и др. . Микробиом влагалища у женщин из Гренландии оценивается с помощью микроскопии и количественной ПЦР. BMC Инфекционные болезни 13 , 480, https://doi.org/10.1186/1471-2334-13-480 (2013).

    Артикул PubMed PubMed Central Google Scholar

  • 29.

    Чен, Х.-М. и др. . Вариации микробиома влагалища в группах образцов, классифицированных по клиническим критериям бактериального вагиноза. BMC Genomics 19 , 876, https://doi.org/10.1186/s12864-018-5284-7 (2018).

    Артикул PubMed PubMed Central Google Scholar

  • 30.

    Tokyol,., Aktepe, O. C., Cevriolu, A. S., Altındiş, M. & Dilek, F. H. Бактериальный вагиноз: сравнение результатов мазка Папаниколау и микробиологических тестов. Мод. Патол. 17 , 857–860, https://doi.org/10.1038/modpathol.3800132 (2004).

    Артикул PubMed Google Scholar

  • 31.

    Карани, А. и др. . Мазок Папаниколау для выявления бактериального вагиноза. Внутр. J. Gynecol. & Акушерство. 98 , 20–23, https://doi.org/10.1016/j.ijgo.2007.03.010 (2007).

    CAS Статья Google Scholar

  • 32.

    Ондердонк, А. Б., Делани, М. Л., Фичорова, Р. Н. Микробиом человека во время бактериального вагиноза. Clin. обзоры микробиологии 29 , 223–38, https://doi.org/10.1128/CMR.00075-15 (2016).

    CAS Статья Google Scholar

  • 33.

    Альберт, А. Ю. К. и др. . Исследование микробиома влагалища у здоровых канадских женщин с использованием молекулярного профилирования на основе cpn60 выявило различные типы состояния сообщества подгруппы Gardnerella. PloS one 10 , e0135620, https://doi.org/10.1371/journal.pone.0135620 (2015).

    CAS Статья PubMed PubMed Central Google Scholar

  • 34.

    Балашов, С. В., Мордехай, Э., Адельсон, М. Э. и Гайгакс, С. Э. Идентификация, количественная оценка и субтипирование Gardnerella vaginalis в некультивируемых клинических образцах влагалища с помощью количественной ПЦР. J. Медицинская микробиология 63 , 162–75, https: // doi.org / 10.1099 / jmm.0.066407-0 (2014).

    CAS Статья Google Scholar

  • 35.

    Nayar, R. & Wilbur, DC The Bethesda System for Reporting Cervical Cytology , https://doi.org/10.1007/978-3-319-11074-5 (Springer International Publishing, Cham, 2015).

    Google Scholar

  • 36.

    Donders, G. G. G., Bellen, G., Grinceviciene, S., Ruban, K. & Vieira-Baptista, P.Аэробный вагинит: уже не чужой. Res. Microbiol. 168 , 845–858, https://doi.org/10.1016/j.resmic.2017.04.004 (2017).

    Артикул PubMed Google Scholar

  • 37.

    Ventolini, G., Schrader, C. & Mitchell, E. Vaginal Lactobacillosis. J. Clin. Гинеколь. Акушерство. 3 , 81–84, https://doi.org/10.14740/JCGO.V3I3.294 (2014).

    Артикул Google Scholar

  • 38.

    Бегини, Дж., Линьярес, И. М., Хиральдо, П. С., Леджер, В. Дж. И Виткин, С. С. Дифференциальная экспрессия изомеров молочной кислоты, индуктора металлопротеиназы внеклеточного матрикса и металлопротеиназы-8 матрикса во влагалищной жидкости женщин с вагинальными расстройствами. BJOG: Int. J. Obstet. Gynaecol. 122 , 1580–1585, https://doi.org/10.1111/1471-0528.13072 (2015).

    CAS Статья Google Scholar

  • 39.

    Drell, T. et al. . Характеристика вагинального микро- и микобиома у бессимптомных эстонских женщин репродуктивного возраста. PLoS ONE 8 , e54379, https://doi.org/10.1371/journal.pone.0054379 (2013).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 40.

    Шипицына, Е. и др. . Возможен ли состав микробиоты влагалища у женщин репродуктивного возраста — возможна ли специфическая молекулярная диагностика бактериального вагиноза? PloS one 8 , e60670, https: // doi.org / 10.1371 / journal.pone.0060670 (2013).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 41.

    Wiik, J. et al. . Микробиота шейки матки у женщин с интраэпителиальной неоплазией шейки матки до и после местного эксцизионного лечения, норвежское когортное исследование. BMC Women’s Heal. 19 , 30, https://doi.org/10.1186/s12905-019-0727-0 (2019).

    Артикул Google Scholar

  • 42.

    Tuominen, H., Rautava, S., Syrjänen, S., Collado, M. C. & Rautava, J. Инфекция HPV и бактериальная микробиота в плаценте, шейке матки и слизистой оболочке полости рта. Sci. отчеты 8 , 9787, https://doi.org/10.1038/s41598-018-27980-3 (2018).

    ADS CAS Статья Google Scholar

  • 43.

    Букуси, Э.А. и др. . Бактериальный вагиноз: факторы риска среди кенийских женщин и их партнеров-мужчин. Секс. Трансм. Дис. 33 , 361–367, https://doi.org/10.1097/01.olq.0000200551.07573.df (2006).

    Артикул PubMed Google Scholar

  • 44.

    Динг Т. и Шлосс П. Д. Динамика и ассоциации типов микробных сообществ в организме человека. Nat. 509 , 357–360, https://doi.org/10.1038/nature13178 (2014).

    ADS CAS Статья Google Scholar

  • 45.

    Галлей, Дж. Д., Бейли, М., Камп Даш, К., Шоппе-Салливан, С. и Кристиан, Л. М. Материнское ожирение связано с изменениями в микробиоме кишечника у детей раннего возраста. PLoS ONE 9 , e113026, https://doi.org/10.1371/journal.pone.0113026 (2014).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 46.

    Bowyer, R.C.E. et al. . Социально-экономический статус и микробиом кишечника: когортное исследование TwinsUK. Микроорг . 7 , https://doi.org/10.3390/microorganisms7010017 (2019).

    Артикул Google Scholar

  • 47.

    Финский онкологический регистр. Статистика регистра рака Финляндии, http://stats.cancerregistry.fi/joukkistilastot/kohtu.html. Дата обращения: 21 декабря 2017 г.

  • 48.

    Притчард, К. и Уоллес, М.С. Сравнение расходов на здравоохранение в Великобритании и других западных странах, относительной бедности и детской смертности: вдвойне ли находятся в неблагоприятном положении британские дети? Ребенок.Soc. 29 , 462–472, https://doi.org/10.1111/chso.12079 (2015).

    Артикул Google Scholar

  • 49.

    Eklund, C. et al. . Глобальное профессиональное исследование 2010 г. по генотипированию вируса папилломы человека в вакцинологии. J. Клиническая микробиология 50 , 2289–98, https://doi.org/10.1128/JCM.00840-12 (2012).

    Артикул Google Scholar

  • 50.

    Illumina. Руководство по подготовке библиотеки метагеномного секвенирования 16S. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry{_}documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf Дата обращения: 04.04.2017. -01 (2013).

  • 51.

    Козич, Дж. Дж., Весткотт, С. Л., Бакстер, Н. Т., Хайлендер, С. К. и Шлосс, П. Д. Разработка стратегии двухиндексного секвенирования и конвейера курирования для анализа данных последовательностей ампликонов на платформе секвенирования MiSeq Illumina.Прил. экологическая микробиология 79 , 5112–20, https://doi.org/10.1128/AEM.01043-13 (2013).

    CAS Статья Google Scholar

  • 52.

    Эрен, А. М., Вайн, Дж. Х., Моррисон, Х. Г. и Согин, М. Л. Метод фильтрации для создания высококачественных коротких считываний с использованием технологии парных соединений Illumina. PLOS ONE 8 , 1–6, https://doi.org/10.1371/journal.pone.0066643 (2013).

    CAS Статья Google Scholar

  • 53.

    Эрен, А.М. и др. . Минимальное разложение энтропии: неконтролируемое олиготипирование для чувствительного разделения последовательностей высокопроизводительных маркерных генов. Isme J 9 , 968–979, https://doi.org/10.1038/ismej.2014.195 (2014).

    CAS Статья PubMed Central Google Scholar

  • 54.

    Шеннон, К. Э. Математическая теория коммуникации. Bell Syst. Tech. J. 4 , 379–423 (1948).

    MathSciNet Статья Google Scholar

  • 55.

    Camacho, C. et al . BLAST plus: архитектура и приложения. BMC Bioinforma. 10 , 1, https://doi.org/10.1186/1471-2105-10-421 (2009).

    CAS Статья Google Scholar

  • 56.

    Корпела, К. Маре: Анализ микробиоты в R легко. Пакет R версии 1.0., Https: // doi.org / 10.5281 / zenodo.50310 (2016).

  • 57.

    Edgar, R.C. Поиск и кластеризация на порядки быстрее, чем BLAST. Bioinforma. 26 , 2460–2461, https://doi.org/10.1093/bioinformatics/btq461 (2010).

    CAS Статья Google Scholar

  • 58.

    Эдгар Р. С. Точность предсказания таксономии для 16S рРНК и ITS последовательностей грибов. PeerJ 6 , e4652, https: // doi.org / 10.7717 / peerj.4652 (2018).

    Артикул PubMed PubMed Central Google Scholar

  • 59.

    R Основная команда. R: язык и среда для статистических вычислений . R Фонд статистических вычислений, Вена, Австрия (2018).

  • 60.

    Оксанен, Дж. и др. . vegan: Пакет Community Ecology Package R, версия 2.4–6 (2018).

  • 61.

    Venables, W.Н. и Рипли, Б. Д. Современная прикладная статистика с S , четвертое изд. (Спрингер, Нью-Йорк, 2002).

  • 62.

    Бенджамини, Ю. и Хохберг, Ю. Контроль уровня ложного обнаружения: практичный и эффективный подход к множественному тестированию. J. Royal Stat. Soc. 57 , 289–300 (1995).

    MathSciNet МАТЕМАТИКА Google Scholar

  • 63.

    Брей, Дж. Р. и Кертис, Дж. Т. Ординация горных лесных сообществ южного Висконсина. Ecol. монографии 27 , 325–349 (1957).

    Артикул Google Scholar

  • Микрофлора неовлагалища, покрытого кожей полового члена, транссексуальных женщин

    Задний план: Микрофлора неовагина, выстланного кожей полового члена, у транссексуалов от мужчины к женщине представляет собой недавно созданную микробную нишу, которая до сих пор была охарактеризована лишь в очень ограниченной степени.Тем не менее, знание этой микрофлоры может считаться важным для наблюдения за женщинами-транссексуалами. Основная цель этого исследования состояла в том, чтобы составить карту неовагинальной микрофлоры в группе из 50 транссексуальных женщин, для которых неовагина была построена с помощью техники перевернутого кожного лоскута полового члена. Вторичные цели заключались в описании возможных корреляций этой микрофлоры с различными характеристиками пациентов, такими как сексуальная ориентация, частота раздражения влагалища и зловонные выделения из влагалища.

    Результаты: На основе окрашивания по Граму в большинстве мазков была обнаружена смешанная микрофлора, которая имела некоторое сходство с микрофлорой бактериального вагиноза (БВ) и содержала различное количество кокков, полиморфных грамотрицательных и грамположительных палочек, часто с веретенообразными и запятыми палочками. а иногда даже со спирохетами. Клетки Candida не были обнаружены ни в одном мазке.В среднем на одну женщину выращивали 8,6 особей. Наиболее часто встречались следующие виды: Staphylococcus epidermidis, Streptococcus anginosus group spp., Enterococcus faecalis, Corynebacterium sp., Mobiluncus curtisii и Bacteroides ureolyticus. Лактобациллы были обнаружены только у одной из 30 женщин. Не было никакой корреляции между привычками к расширению тела, половым актом, привычками полоскания и зловонными выделениями из влагалища, с одной стороны, и присутствием определенного вида — с другой. Однако между присутствием E.faecalis, с одной стороны, и сексуальная ориентация и коитус — с другой (p = 0,003 и p = 0,027 соответственно). Соответственно 82%, 58% и 30% образцов показали ампликон после амплификации с наборами праймеров M. curtisii, Atopobium vaginae и Gardnerella vaginalis.

    Вывод: Наше исследование является первым, которое описывает микрофлору неовлагалища, покрытого кожей полового члена, транссексуальных женщин.Он выявляет смешанную микрофлору аэробных и анаэробных видов, которые обычно встречаются либо на коже, либо в микрофлоре кишечника, либо в микрофлоре BV.

    Бактериальный вагиноз как смешанная инфекция — полимикробные заболевания

    Влагалище представляет собой уникальную среду для бактериальной колонизации. Он подвержен резким изменениям в течение жизни, вызванным изменениями в развитии и гормональными изменениями. При рождении он выстлан многослойным плоским эпителием, который регрессирует по мере ослабления влияния материнского эстрогена.В детстве микрофлора влагалища содержит кожные комменсалы и кишечные организмы. Во время менархе pH падает с нейтрального примерно до 4, и во флоре преобладают лактобациллы. Многие другие организмы могут присутствовать в более низких концентрациях, включая анаэробные и факультативные анаэробные бактерии и Candida spp. Гормональная среда меняется ежемесячно, что приводит к дополнительным нарушениям экосистемы, вызванным менструацией, мытьем и гигиеной. Сексуальная активность может привести к появлению ряда новых видов и патогенов, а также к изменению pH.Беременность и кормление грудью вызывают более длительные колебания гормонального баланса. В климактерическом периоде эпителий влагалища постепенно атрофируется, pH повышается, и флора, более похожая на кожную, может восстановиться.

    Бактериальный вагиноз (БВ) можно рассматривать как нарушение в этой вагинальной экосистеме, в котором лактобациллы заменяются чрезмерным ростом вагинальных комменсальных организмов. Это может быть временным или постоянным. Он признан наиболее частой причиной аномальных выделений из влагалища у женщин детородного возраста.Симптомы жидких, белых или желтых выделений, сопровождающихся рыбным запахом, настолько характерны, что удивительно, что BV не получил широкого признания до тех пор, пока Гарднер и Дьюкс не описали его как неспецифический вагинит в 1955 г. (11). В 1920-х годах Шредер из Германии описал три класса вагинальной флоры и изменения бактериального состава влагалища, которые в целом соответствуют нашему нынешнему пониманию нормальной, промежуточной флоры и флоры БВ (36).

    Распространенность

    Сообщаемая распространенность БВ широко варьируется от 5 до 51% между различными группами населения.В Соединенных Штатах, Bump и Buesching сообщили о распространенности примерно 13% среди девочек-подростков (8). Мы сообщили об аналогичной распространенности в гинекологической клинике (16) и женской консультации (14) в Соединенном Королевстве. Заболеваемость выше у женщин, прерывающих беременность (28%) (5), и в группе женщин, проходящих курс лечения экстракорпоральным оплодотворением (24,6%) (31). В Соединенных Штатах высокий уровень заболеваемости был зарегистрирован для некоторых групп населения, например среди беременных женщин в городских районах (32,5%) (21). Однако самый высокий уровень заболеваемости был зарегистрирован в Ракаи в сельской местности Уганды, где их было 50.9% женщин имели БВ, при этом распространенность Trichomonas vaginalis составляла 23,8% (27). У восьмидесяти процентов этих женщин не было симптомов.

    Физиология влагалища и BV

    Во время менархе под влиянием эстрогена во влагалище развивается многослойный плоский эпителий. Лактобациллы становятся доминирующим организмом. Источник вагинальных лактобацилл у отдельной женщины не определен. Молочная кислота вырабатывается как бактериальным метаболизмом, так и метаболизмом эпителия, а рН влагалища обычно падает до уровня 4.0 и 4.5. Физиологические выделения состоят из слизи, слущенных эпителиальных клеток и лактобацилл. Уровень pH может подниматься выше 4,5 во время менструации, когда концентрация лактобацилл снижается. Слизь шейки матки и сперма имеют pH от 7 до 8. У мышей экзогенная обработка прогестероном изменяет флору до той, которая напоминает BV (40). Насколько сильно гормональные изменения менструального цикла влияют на флору у женщин?

    Если развивается BV, pH повышается до уровня от 4,5 до 7.0. Анаэробные или факультативные анаэробные организмы, которые обычно присутствуют в небольшом количестве, увеличиваются в 100–1000 раз, значительно превышая численность лактобацилл, которые в конечном итоге могут исчезнуть. Триметиламин и полиамины путресцин и кадаверин вырабатываются анаэробным метаболизмом, и считается, что они ответственны за рыбный запах. Микроскопия влагалищной жидкости показывает множество мелких бактерий и эпителиальных клеток с большим количеством прикрепившихся бактерий. Гарднер и Дьюкс назвали эти ключевые клетки, поскольку они дали ключ к диагностике неспецифического вагинита (11).

    Диагноз

    Неспецифический вагинит определялся как клиническое проявление, распознаваемое по симптомам выделений из влагалища с рыбным запахом, подтвержденное обнаружением жидкой однородной влагалищной жидкости, прилипшей к стенкам влагалища, и подтвержденное обнаружением ключевых клеток при микроскопии. Первоначально считалось, что это простая инфекция, вызванная одним организмом, который теперь называется Gardnerella vaginalis. Впоследствии другие бактерии были идентифицированы как часть флоры BV. В 1983 году был введен термин BV, с учетом того, что существует множество бактериальных spp.способствуют этому состоянию, и что воспаление обычно отсутствует. Тест КОН или «запах» был добавлен в качестве четвертого критерия диагностики, как показано в (2).

    Таблица 1

    Составные критерии (критерии Амселя), используемые для диагностики БВ в клинической практике a .

    В последнее время системы оценки для интерпретации мазков из влагалища, окрашенных по Граму, стали использоваться для диагностики БВ (14, 23). Можно использовать вагинальные мазки, которые вводятся самостоятельно, что делает возможным неинвазивный скрининг.Их намазывают на предметное стекло, которое сушат на воздухе, а затем считывают в центральной лаборатории. Составные критерии определяют дихотомию BV или нормальной флоры. Системы оценки для интерпретации мазков, окрашенных по Граму, позволяют градацию для размещения промежуточных образцов.

    Лечение и осложнения

    Причина, по которой некоторые женщины болеют БВ часто, а другие либо никогда не болеют, либо заболевают нечасто, еще не полностью определена. Об этом будет сказано ниже. Лечение антибиотиками для подавления чрезмерного анаэробного роста обычно успешно устраняет BV, но не обязательно устраняет основное нарушение, которое в первую очередь позволило ему развиться.У некоторых женщин БВ может рецидивировать в течение 2–3 недель после лечения антибиотиками. Стандартные методы лечения показаны на.

    Женщины с БВ имеют повышенный риск многих акушерских и гинекологических осложнений. К ним относятся выкидыш во втором триместре и преждевременные роды, ранняя неудача экстракорпорального оплодотворения, повышенный риск инфекции верхних отделов половых путей после прерывания беременности и повышенный риск инфекционных осложнений после гистерэктомии. Кроме того, в проспективных исследованиях BV оказался фактором риска заражения инфекциями, передаваемыми половым путем, включая инфекцию вируса иммунодефицита человека (ВИЧ) (18).

    Естественная история и эпидемиология

    У многих женщин вагинальная экосистема находится в постоянном движении, изменяясь на разных стадиях менструального цикла. В четырех исследованиях изучались самостоятельно собранные мазки из влагалища, окрашенные по Граму, для изучения естественной истории вагинальной флоры. Schwebke и его коллеги наблюдали за 51 женщиной с низким риском инфекций, передаваемых половым путем, в течение до 6 недель (38). Только 11 из этих женщин имели нормальную флору на протяжении всего периода, 25 имели промежуточный паттерн в какой-то момент, а у 13 развивался BV.Пять из 13 зарегистрированных симптомов. Были выявлены значимые ассоциации между развивающимся BV и предшествующим BV (44 против 12%), средним числом партнеров на протяжении всей жизни (13,4 против 7,15) и более высоким средним числом эпизодов рецептивного куннилингуса (3,6 против 1,4). Из них только куннилингус оставался значимым при многомерном анализе. Изменения флоры также были связаны с менструациями и использованием вагинальных препаратов или спермицидов.

    Повышенные аномалии влагалищной флоры возникают в течение первых 9 дней цикла, и исследования пришли к выводу, что аномальная флора возникает у большинства женщин в какое-то время, и поэтому нам, возможно, придется пересмотреть нашу концепцию того, что является нормальным.В одном исследовании изучались ежедневные мазки 18 женщин с рецидивирующим БВ (17). Опять же, БВ обычно спонтанно развивался в начале менструального цикла и спонтанно разрешался во второй половине цикла, если он действительно разрешался. Интересно, что у некоторых женщин начало наступило после эпизодов вагинального кандидоза, и, если уж на то пошло, БВ с большей вероятностью исчезнет, ​​чем появится после незащищенного секса с постоянным партнером. У некоторых женщин начало исчезновения BV произошло в течение 2 или 3 дней, обычно после промежуточной стадии.Связь с разрешением кандидоза представляет интерес в свете исследования in vitro, которое продемонстрировало подавление кандидозного роста путресцином и кадаверином (33). Эти амины продуцируются Gardnerella и другими организмами, обнаруженными на BV. В более раннем исследовании также сообщалось о связи между Candida и рецидивирующим BV (32). Изменения микрофлоры влагалища в течение 3 месяцев у женщины с рецидивирующим БВ показаны в (17). Другая женщина в исследовании имела частые симптоматические рецидивы БВ в течение 10-месячного периода (17).За это время она получила стандартное лечение от БВ и один курс доксициклина и метронидазола от воспалительных заболеваний органов малого таза. В последующие 4 года рецидивов не было. Неясно, что случилось, чтобы предотвратить повторение BV.

    Рисунок 1

    Изменения во влагалищной флоре в течение 3 месяцев у женщины с рецидивирующим БВ (17). День менструального цикла, лечение метронидазолом (Met) или пессариями клотримазола (Canesten), менструация (Period) и незащищенный половой акт (подробнее…)

    Для результатов, показанных в, субъект ежедневно готовил самостоятельно собранные вагинальные мазки. Впоследствии они были окрашены по Граму. Используется оценка Nugent, в которой от 0 до 3 считается нормальной флорой, от 4 до 6 — промежуточной, а от 7 до 10 — за BV. Для кандидоза использовалась произвольная система баллов: 0 — отсутствие Candida, , 2 — наличие спор и 4 — наличие гиф. В целом, у субъекта был BV, который разрешился после лечения метронидазолом.Во время следующего периода у нее развился кандидоз. Это разрешилось лечением, за которым следует БВ. BV спонтанно разрешился в середине цикла, но вскоре после этого кандидоз и BV рецидивировали, а BV снова повторился в последний месяц.

    Во время беременности влагалище не подвержено частым изменениям уровня гормонов, связанным с менструальным циклом. Во время беременности было проведено несколько обсервационных исследований, но, по-видимому, БВ разрешается спонтанно примерно у 50% женщин, у которых он присутствует примерно на 16 неделе беременности, и может развиться у 2–3% тех, у кого его не было на 16 неделе. беременность (15).

    Эпидемиология

    Большинство исследований выявили повышенную распространенность БВ у женщин черной расы по сравнению с женщинами белой расы и у тех, кто сообщает о куннилингусе, курении и использовании внутриматочных противозачаточных средств. В исследованиях на уровне сообщества БВ чаще встречается у женщин с хламидийной инфекцией, а также у тех, кто прерывает беременность. Это также было связано со сменой половых партнеров и образом жизни с высоким риском (22). Эти ассоциации предполагают, что он ведет себя как заболевание, передающееся половым путем (ЗППП), но раннее исследование Bump и Buesching не обнаружило разницы в распространенности между девственными и не девственными женщинами-подростками, при этом клетки-подсказки были обнаружены в 9% обеих групп (8).Таким образом, БВ, по-видимому, связан с половым актом и риском ЗППП, но сам по себе не является ЗППП. Более того, БВ, по-видимому, часто встречается у лесбиянок, группы с низким риском развития большинства ЗППП. В одном исследовании наблюдалась тенденция к тому, что у обоих членов пар была либо нормальная флора, либо BV, что предполагало передачу этиологического агента (4).

    Недавно было опубликовано большое проспективное исследование 1 248 женщин, у которых не было БВ на исходном уровне (М. А. Крон и др., Встреча Международного общества по исследованию болезней, передаваемых половым путем, презентация, июнь 2001 г.).Развитие БВ было связано с курением, спринцеванием и отказом от противозачаточных средств. В многофакторном анализе независимыми факторами риска были представители небелой расы, промежуточная флора по окраске по Граму, отсутствие лактобацилл, продуцирующих H 2 O 2 , наличие двух или более половых партнеров за предыдущие 4 месяца и более трех половых сношений. /неделя.

    Факторы, снижающие количество лактобацилл

    Вагинальное спринцевание или другие методы промывания часто упоминаются как причина нарушения влагалищной флоры, ведущей к развитию БВ.В проспективном исследовании спринцевание было связано с потерей защитных лактобацилл, продуцирующих H 2 O 2 , и приобретением BV (13). В исследовании случай-контроль с участием 200 женщин, посещающих клинику мочеполовой медицины в Лондоне, Соединенное Королевство, изучалась связь между промыванием вульвы, промыванием влагалища и спринцеванием и БВ (30). БВ чаще встречается у чернокожих карибских женщин, чем у белых (отношение шансов 2,1; 95% доверительный интервал 1,1–4,1). Женщины с БВ чаще использовали пенную ванну, антисептический раствор и спринцевание.Предыдущий анамнез BV был самым сильным предиктором текущего BV (отношение шансов 13,4; 95% доверительный интервал от 5,5 до 32,6). В многофакторном анализе, после контроля практики мытья, не было этнических различий в заболеваемости БВ. Напротив, в исследовании 842 женщин в начале третьего триместра беременности в Северной Каролине сообщалось, что расовая принадлежность оставалась связанной с BV после контроля многих возможных мешающих переменных, включая спринцевание (35). BV был обнаружен у 22.3% чернокожих женщин по сравнению с 8,5% белых женщин. Темнокожие женщины также чаще имели наивысшие баллы по Ньюдженту — 9 или 10, взвешенные по наличию большого количества морфотипов Mobiluncus .

    Изящная новая гипотеза, объясняющая возникновение BV, состоит в том, что лактобациллы убиваются фаговой инфекцией (6). Известно, что фаги Lactobacillus влияют на йогуртовые культуры в пищевой промышленности. Они могут оставаться в умеренном (неактивном) состоянии или стать литическими, когда может погибнуть до 99% популяции лактобацилл.Эти фаги были выделены из лактобацилл человека из влагалища (25) и кишечника, а также из лактобацилл в йогурте. Было показано, что последние подавляют вагинальные лактобациллы (39). Блэквелл предполагает, что фаги могут передаваться половым путем, молочными продуктами или фекально-оральным путем (6). Более того, канцерогены, такие как эпоксид бензо [ a ] пирендиола (26), который присутствует в сигаретном дыме, могут вызывать лизогению в культурах. Если партнер-мужчина вызвал BV путем передачи фага lactobacillus, неудивительно, что лечение антибиотиками не влияет на частоту последующих рецидивов у его партнера.Очевидно, что необходимы дальнейшие проспективные исследования.

    Microbiology

    Организмы, наиболее часто связанные с BV, — это G. vaginalis, Bacteroides ( Prevotella ) spp., Mobiluncus spp. И Mycoplasma hominis. Высокие концентрации Gardnerella, > 100 раз превышающие норму, обнаруживаются почти у 95% женщин с BV, но Gardnerella также был обнаружен более чем у 50% женщин без BV, поэтому посев был плохим. специфичность.Количественный посев, показывающий высокие концентрации, лучше коррелирует с BV в научных исследованиях, но посев не должен использоваться для рутинной диагностики. Сообщаемая распространенность других организмов часто отражает чувствительность метода культивирования к конкретному организму. Например, Fusobacter spp., Пептострептококки и стрептококки группы non-viridans также были связаны с BV.

    В одном исследовании изучались изменения бактериальной флоры, которые происходят при переходе от нормальной к промежуточной и БВ (34).На промежуточной стадии Gardnerella и Bacteroides присутствовали в умеренных концентрациях, но высокие концентрации этих организмов и M. hominis не наблюдались до тех пор, пока не развился полный BV. Присутствие высоких концентраций Mobiluncus, , видимых на окрашивании по Граму, было использовано для определения наиболее аномальной флоры с оценкой Nugent 9 или 10. Недавно с использованием ПЦР Mobiluncus spp. были обнаружены у 84,5% женщин с БВ и у 38% женщин без БВ (37).

    Взаимодействие с бактериями

    После выделения Haemophilus vaginalis (теперь называемого G. vaginalis ) Гарднер и Дьюкс исследовали его роль в экспериментах по инокуляции (11). Тринадцать добровольцев были заражены чистой культурой H. vaginalis. Десять из них не смогли развить клинических доказательств болезни или положительных культур. Культуры были положительными для двух субъектов в течение 2 или 3 месяцев, но ни у одного из них не развилось заболевание.У одного пациента развились клинические проявления, и организм был восстановлен в чистой культуре. Еще 15 женщинам, 4 из которых были беременными, были сделаны прививки непосредственно от инфицированных пациентов. У одиннадцати (73%) из этих субъектов развились клинические признаки «неспецифического вагинита», и у всех из них организм выздоровел. У восьми из этих женщин синдром развился в течение 1 недели после вакцинации. Это говорит о том, что инокуляция полным коктейлем бактерий, обнаруженных в BV, с большей вероятностью вызовет состояние, чем инокуляция одним организмом.Это подтверждается исследованиями in vitro.

    Анаэробный метаболизм производит янтарную, а не молочную кислоту. В одном исследовании изучались симбиотические отношения между Gardnerella, факультативным аэробом и Prevotella bivia (29). Первый производит аминокислоты, которые используются вторыми. В свою очередь, Prevotella производит аммиак, который утилизируется Gardnerella симбиотическим образом. Эта же группа также продемонстрировала другие симбиотические отношения in vitro с P.bivia , делая аминокислоты доступными для Peptostreptococcus anaerobius (28).

    Множество ферментов, расщепляющих слизь, вырабатываются различными бактериями, участвующими в BV. Таким образом, присутствуют муциназы, сиалидазы и нейраминидазы. Они разрушают цервикальную и вагинальную слизь. Вероятно, это объясняет тонкие однородные выделения, которым не хватает сцепления, обычно вызываемого слизью. Дополнительные факторы вирулентности расщепляют иммуноглобулин A (IgA) и IgM, снижая способность хозяина предотвращать инфекции (9).Другие защитные медиаторы, такие как ингибитор секреторной лейкоцитарной протеазы (SLPI), также снижаются (10).

    Lactobacilli

    Lactobacilli продуцируют различные вещества, такие как бактериоцины и лактоцины, которые токсичны для других видов бактерий и лактобацилл, соответственно. Подкисление влагалища — важный защитный механизм. H 2 O 2 также является важным ингибитором анаэробного роста, и считается, что Lactobacillus spp.продуцирование высоких уровней H 2 O 2 обеспечивает защиту от BV и заражения инфекциями, передаваемыми половым путем. Таким образом, in vitro при pH <4,5 лактобациллы, продуцирующие H 2 O 2 , эффективно подавляют рост BV-ассоциированных организмов, но при более высоких pH эффект ослабевает (20). Ингибирование также снижается добавлением миелопероксидазы, которая расщепляет H 2 O 2 .

    Является ли изменение pH, которое происходит во время менструации и после незащищенного полового акта, достаточным для запуска БВ? В качестве альтернативы, если во влагалище будет введено достаточное количество бактерий от партнера, разовьется ли БВ? Другой возможный триггер — это что-то, что снижает количество или качество лактобацилл.Интересно, что антибиотики широкого спектра действия, ингибирующие лактобациллы, по-видимому, не вызывают BV (1), возможно, потому, что они также ингибируют некоторые организмы BV.

    Отсутствие здоровых лактобацилл, продуцирующих H 2 O 2 , может способствовать частым рецидивам БВ у некоторых женщин. Один из исследуемых подходов заключается в повторном заселении влагалища здоровыми лактобактериями. В недавнем исследовании 215 сексуально активных женщин использовались пробы цельной хромосомной ДНК для определения наиболее распространенных штаммов вагинальных лактобацилл.Наиболее распространенным видом был Lactobacillus crispatus (32%), за ним следуют L. jensenii (23%) и ранее не описанный вид sp. обозначен как Lactobacillus sp. штамм 1086V (15%) (3). В исследовании in vitro изучали скорость продукции кислоты Lactobacillus spp. (7). Среду для выращивания подкисляли до асимптотического значения pH от 3,2 до 4,8. Напротив, BV-ассоциированные организмы, такие как G. vaginalis, P. bivia, и Peptostreptococcus anaerobius , достигли асимптотического уровня при pH 4.От 7 до 6,0, что соответствует уровням pH, обнаруженным в BV. Авторы подсчитали, что 3 мл спермы будут подкислены со скоростью от 0,56 до 0,75 единиц pH / час. К сожалению, они не размышляют о том, может ли временное изменение pH, вызванное единичным эпизодом незащищенного полового акта, способствовать росту организмов BV в достаточной степени, чтобы вызвать изменение бактериальной флоры. Однако повторные половые акты в течение 24 часов могут привести к более длительному периоду благоприятных условий для роста.

    В небольшом исследовании из Бельгии 32 женщины с BV или промежуточной флорой получали вагинальные таблетки, содержащие 50 мг лиофилизата жизнеспособного, H 2 O 2 — продуцирующего L.acidophilus и 0,03 мг эстриола в течение 6 дней (24). Было отмечено значительное улучшение: показатель излечения через 6 недель составил 88% в группе лечения по сравнению с 22% в группе плацебо.

    Осложнения

    Полное обсуждение осложнений БВ выходит за рамки данной главы. Осложнения беременности в виде позднего выкидыша и преждевременных родов опосредованы развитием хориоамнионита (12). Опять же, это смешанная инфекция, вызванная различными микроорганизмами, связанными с BV, вырабатывающими смесь ферментов, которые разрушают цервикальную слизь, проникают в мембраны и вырабатывают ферменты, которые могут ослабить мембраны, увеличивая риск преждевременного разрыва.Исследования in vitro оценили уровни таких факторов вирулентности, вызываемых различными бактериями. Хотя во многих исследованиях только один организм может быть изолирован от мембран, вполне вероятно, что с улучшенными средствами обнаружения будет обнаружено множество организмов.

    BV также был связан с заражением ВИЧ. H 2 O 2 снижает способность ВИЧ инфицировать клетки in vitro (19), и его отсутствие при BV является одним из предполагаемых механизмов. Другими возможными факторами являются расщепление IgA, снижение SLPI и ингибирование хемотаксиса лейкоцитов (18).

    Выводы

    Наше понимание BV улучшается благодаря наблюдениям и изучению взаимодействий между бактериями в лаборатории. Экосистема влагалища подвержена различным гормональным изменениям, которые влияют на баланс между лактобациллами и анаэробами. Вполне вероятно, что нормальная флора лактобацилл может быть подавлена ​​такими факторами, как длительное изменение pH влагалища после спринцевания или частых половых сношений. Инстилляция большого количества организмов от полового партнера мужского или женского пола может вызвать БВ.Альтернативные гипотезы включают введение литической бактериофаговой инфекции, уменьшающей популяцию лактобацилл. После того, как организмы BV получают возможность процветать, они используют метаболиты друг друга симбиотическим образом и продолжают поддерживать pH> 4,5.

    . по факту осаждение БВ.Неспособность восстановить H 2 O 2 — продуцирующую флору лактобацилл после того, как антибиотики подавили анаэробный рост, может быть причиной частых рецидивов у некоторых женщин. Есть еще много женщин, которых беспокоят частые симптоматические рецидивы БВ, и нам необходимо более глубокое понимание причин, вызывающих его, чтобы мы могли им помочь. Настоятельно необходимо определить, как эффективно предотвратить неблагоприятные исходы беременности, связанные с БВ. Если бы мы могли контролировать BV, мы могли бы дополнительно снизить риск ВИЧ-инфекции, для которой BV является важным фактором риска.Перспективным подходом является повторное заселение влагалища лактобактериями, которые являются продуцентами высокого уровня H 2 O 2 и могут лучше подавлять рост анаэробов, чем нативная флора лактобацилл.

    Ссылки

    1.
    Агнью К. Дж., Хиллиер С. Л. Влияние схем лечения вагинита и цервицита на колонизацию влагалища лактобактериями. Секс. Трансм. Дис. 1995. 22: 269–273. [PubMed: 7502179]
    2.
    Амсел Р., Тоттен П. А., Шпигель К. А., Чен К. С., Эшенбах Д., Холмс К. К. Неспецифический вагинит. Диагностические критерии и микробно-эпидемиологические ассоциации. Являюсь. J. Med. 1983; 74: 14–22. [PubMed: 6600371]
    3.
    Антонио М. А., Хоуз С. Э., Хиллиер С. Л. Идентификация вагинальных видов Lactobacillus и демографические и микробиологические характеристики женщин, колонизированных этими видами. J. Infect. Дис. 1999; 180: 1950–1956. [PubMed: 10558952]
    4.
    Бергер Б. Дж., Колтон С., Зенилман Дж. М., Каммингс М. К., Фельдман Дж., Мак-Кормак В. М. Бактериальный вагиноз у лесбиянок: заболевание, передающееся половым путем. Clin. Заразить. Дис. 1995; 21: 1402–1405. [PubMed: 8749623]
    5.
    Блэквелл А. Л., Томас П. Д., Уэрхэм К., Эмери С. Дж. Улучшение здоровья от скрининга на инфекцию нижних отделов половых путей у женщин, посещающих прерывание беременности. Ланцет. 1993; 342: 206–210. [PubMed: 8100930]
    6.
    7.
    Boskey E. R., Telsch K. M., Whaley K. J., Moench T. R., Cone R. A. Производство кислоты вагинальной флорой in vitro согласуется со скоростью и степенью закисления влагалища. Заразить. Иммун. 1999. 67: 5170–5175. [Бесплатная статья PMC: PMC96867] [PubMed: 10496892]
    8.
    Bump R. C., Buesching W. J. Бактериальный вагиноз у девственных и сексуально активных девочек-подростков: доказательства против исключительно половой передачи. Являюсь. J. Obstet. Гинеколь. 1988; 158: 935–939. [PubMed: 3259076]
    9.
    Cauci S., Monte R., Driussi S., Lanzafame P., Quadrifoglio F. Нарушение иммунной системы слизистых оболочек: расщепление IgA и IgM обнаружено в смывах из влагалища у подгруппы пациентов с бактериальным вагинозом. J. Infect. Дис. 1998; 178: 1698–1706. [PubMed: 9815222]
    10.
    Дрейпер Д. Л., Ландерс Д. В., Крон М. А., Хиллиер С. Л., Визенфельд Х. С., Хайне Р. П. Уровни вагинального ингибитора секреторной лейкоцитарной протеазы снижены у женщин с инфекциями нижних половых путей.Являюсь. J. Obstet. Гинеколь. 2000; 183: 1243–1248. [PubMed: 11084573]
    11.
    Гарднер Х. Л., Дьюкс К. Д. Haemophilus vaginalis вагинит. Недавно определенная специфическая инфекция, ранее классифицированная как «неспецифический» вагинит. Являюсь. J. Obstet. Гинеколь. 1955; 69: 962–976. [PubMed: 14361525]
    12.
    Голденберг Р. Л., Хаут Дж. С., Эндрюс В. В. Внутриутробная инфекция и преждевременные роды. N. Engl. J. Med. 2000; 342: 1500–1507. [PubMed: 10816189]
    13.
    Хоуз С. Э., Хиллиер С. Л., Бенедетти Дж., Стивенс К. Э., Кутски Л. А., Вольнер-Ханссен П., Холмс К. К. Лактобациллы, продуцирующие перекись водорода, и приобретение вагинальных инфекций. J. Infect. Дис. 1996; 174: 1058–1063. [PubMed: 8896509]
    14.
    Hay P. E., Lamont R. F., Taylor-Robinson D., Morgan D. J., Ison C., Pearson J. Аномальная бактериальная колонизация половых путей и последующие преждевременные роды и поздний выкидыш. Br. Med. J. 1994; 308: 295–298. [Бесплатная статья PMC: PMC2539287] [PubMed: 8124116]
    15.
    Hay P. E., Morgan D. J., Ison C. A., Bhide S. A., Romney M., McKenzie P. et al. Продольное исследование бактериального вагиноза во время беременности. Br. J. Obstet. Gynaecol. 1994; 101: 1048–1053. [PubMed: 7826957]
    16.
    Хэй П. Э., Тейлор-Робинсон Д., Ламонт Р. Ф. Диагностика бактериального вагиноза в гинекологической клинике. Br. J. Obstet. Gynaecol. 1992; 99: 63–66. [PubMed: 1547176]
    17.
    Hay P. E., Ugwumadu A., Chowns J. Секс, молочница и бактериальный вагиноз.Int. J. ЗППП, СПИД. 1997. 8: 603–608. [PubMed: 9310218]
    18.
    Хиллер С. Л. Микробная экосистема влагалища и устойчивость к ВИЧ. AIDS Res. Гм. Ретровир. 1998; 14 (Приложение 1): S17 – S21. [PubMed: 9581879]
    19.
    Клебанофф С. Дж., Кумбс Р. В. Вирицидное действие Lactobacillus acidophilus на вирус иммунодефицита человека типа 1: возможная роль в гетеросексуальной передаче. J. Exp. Med. 1991; 174: 289–292. [Бесплатная статья PMC: PMC2118880] [PubMed: 1647436]
    20.
    Клебанофф С. Дж., Хиллиер С. Л., Эшенбах Д. А., Вальтерсдорф А. М. Контроль микробной флоры влагалища с помощью H 2 O 2 -производящих лактобацилл. J. Infect. Дис. 1991. 164: 94–100. [PubMed: 1647428]
    21.
    McGregor JA, French JI, Parker R., Draper D., Patterson E., Jones W., Thorsgard K., McFee J. Профилактика преждевременных родов путем скрининга и лечения общих инфекции половых путей: результаты проспективной контролируемой оценки.Являюсь. J. Obstet. Гинеколь. 1995. 173: 157–167. [PubMed: 7631673]
    22.
    Нильссон У., Хеллберг Д., Шубникова М., Нильссон С., Мард П. А. Факторы риска сексуального поведения, связанные с бактериальным вагинозом и инфекцией Chlamydia trachomatis . Секс. Трансм. Дис. 1997. 24: 241–246. [PubMed: 9153730]
    23.
    Ньюджент Р. П., Крон М. А., Хиллиер С. Л. Надежность диагностики бактериального вагиноза повышается с помощью стандартизированного метода интерпретации окраски по Граму.J. Clin. Microbiol. 1991; 29: 297–301. [Бесплатная статья PMC: PMC269757] [PubMed: 1706728]
    24.
    Parent D., Bossens M., Bayot D., Kirkpatrick C., Graf F., Wilkinson FE, Kaiser RR Терапия бактериального вагиноза с использованием экзогенно- применяли Lactobacilli acidophili и низкую дозу эстриола: плацебо-контролируемое многоцентровое клиническое испытание. Arzneimittel-Forschung. 1996. 46: 68–73. [PubMed: 8821521]
    25.
    26.
    Павлова С. И., Тао Л.Индукция вагинальных фагов Lactobacillus химическим бензо [а] пирендиол эпоксидом сигаретного дыма. Мутат. Res. 2000. 466: 57–62. [PubMed: 10751726]
    27.
    Пакстон Л. А., Севанкамбо Н., Грей Р., Сервадда Д., МакНэрн Д., Ли К., Вавер М. Дж. Бессимптомные неязвенные инфекции половых путей в сельской местности Уганды. Секс. Трансм. Заразить. 1998. 74: 421–425. [Бесплатная статья PMC: PMC1758159] [PubMed: 10195051]
    28.
    Pybus V., Onderdonk A.B. Комменсальный симбиоз между Prevotella bivia и Peptostreptococcus anaerobius включает аминокислоты: потенциальное значение для патогенеза бактериального вагиноза. ФЭМС Иммунол. Med. Microbiol. 1998. 22: 317–327. [PubMed: 9879923]
    29.
    Пибус В., Ондердонк А. Б. Доказательства комменсальных симбиотических отношений между Gardnerella vaginalis и Prevotella bivia с участием аммиака: потенциальное значение для бактериального вагиноза.J. Infect. Дис. 1997; 175: 406–413. [PubMed: 9203662]
    30.
    Раджаманохаран С., Лоу Н., Джонс С. Б., Позняк А. Л. Бактериальный вагиноз, этническая принадлежность и использование средств для чистки половых органов: исследование случай-контроль. Секс. Трансм. Дис. 1999; 26: 404–409. [PubMed: 10458635]
    31.
    Ральф С. Г., Резерфорд А. Дж., Уилсон Дж. Д. Влияние бактериального вагиноза на зачатие и выкидыш в первом триместре: когортное исследование. Br. Med. J. 1999; 319: 220–223. [Бесплатная статья PMC: PMC28171] [PubMed: 10417083]
    32.
    Редондо-Лопес В., Мериуэзер К., Шмитт К., Опиц М., Кук Р., Собель Дж. Д. Вульвовагинальный кандидоз, осложняющий рецидивирующий бактериальный вагиноз. Секс. Трансм. Дис. 1990; 17: 51–53. [PubMed: 2305336]
    33.
    Rodrigues AG, Mardh PA, Pina-Vaz C., Martinez-de-Oliveira J., da Fonseca AF Объясняется ли отсутствие совпадения бактериального вагиноза и вагинального кандидоза наличием бактериальные амины? Являюсь. J. Obstet. Гинеколь. 1999; 181: 367–370. [PubMed: 10454684]
    34.
    Розенштейн И. Дж., Морган Д. Дж., Шихан М., Ламонт Р. Ф., Тейлор-Робинсон Д. Бактериальный вагиноз во время беременности: распределение видов бактерий в различных категориях окраски по Граму влагалищной флоры. J. Med. Microbiol. 1996. 45: 120–126. [PubMed: 8683547]
    35.
    Ройс Р. А., Джексон Т. П., Торп, мл. Дж. М., Хиллиер С. Л., Рабе Л. К., Пастор Л. М., Савиц Д. А. Расовая / этническая принадлежность, структура вагинальной флоры и pH во время беременности. Секс. Трансм. Дис. 1999; 26: 96–102. [PubMed: 10029984]
    36.

    Schroder R. Zur Pathogenese und Klinik des vaginalen Fluors. Zentbl. Гынаколь. 1921; 38: 1350–1361.

    37.
    Schwebke J. R., Lawing L. F. Распространенность Mobiluncus spp. среди женщин с бактериальным вагинозом и без него по данным полимеразной цепной реакции. Секс. Трансм. Дис. 2001; 28: 195–199. [PubMed: 11318249]
    38.
    Schwebke J. R., Morgan S. C., Weiss H. L. Использование последовательных самостоятельных вагинальных мазков для обнаружения изменений во влагалищной флоре.Секс. Трансм. Дис. 1997. 24: 236–239. [PubMed: 36]
    39.
    Тао Л., Павлова С. И., Моу С. М., Ма В. Г., Килич А. О. Анализ продуктов Lactobacillus на фаги и бактериоцины, которые ингибируют вагинальные лактобациллы. Заразить. Дис. Акушерство. Гинеколь. 1997. 5: 244–251. [Бесплатная статья PMC: PMC2364545] [PubMed: 18476145]
    40.

    Тейлор-Робинсон Д., Хей П. Э. Патогенез клинических признаков бактериального вагиноза и возможные причины его возникновения.Int. J. ЗППП, СПИД. 1997; 8 (Приложение 1): 35–37.

    Что такое вагинальная флора? Бактерии, обитающие во влагалище.

    Влагалищная флора — это бактерии, которые живут во влагалище. В нормальной влагалищной флоре преобладают различные виды лактобацилл.

    Лактобациллы помогают сохранить здоровье влагалища, вырабатывая молочную кислоту, перекись водорода и другие вещества, подавляющие рост дрожжей и других нежелательных организмов. Они поддерживают уровень pH во влагалище около 4.

    Эта умеренно кислая среда помогает защитить от инфекции. То же самое и с другими веществами, которые они производят. Эти бактерии являются важной частью здоровой экосистемы влагалища.

    Portra / Getty Images

    Почему важна флора влагалища

    Отличительным признаком бактериального вагиноза (БВ) является нарушение нормальной микрофлоры влагалища и потеря лактобацилл. Это может быть неприятно не только само по себе. Это также может сделать женщину более восприимчивой к ВИЧ и другим инфекциям, передаваемым половым путем.

    Бактериальный вагиноз на самом деле вызван чрезмерным ростом бактерий, которые обычно существуют в небольших количествах во влагалище. Когда популяция лактобацилл нарушается, эти бактерии вступают во владение.

    Бактерии, связанные с BV, образуют ряд летучих аминов. Эти химические вещества являются причиной характерного запаха, связанного с BV. Этот запах имеет тенденцию усиливаться после секса, особенно незащищенного секса, потому что амины становятся более пахнущими при более высоком pH, связанном со спермой.

    Однако, несмотря на ассоциацию, BV не вызывается спермой. Фактически, наибольшее доказательство передачи бактериального вагиноза половым путем есть у лесбиянок.

    Неясно, может ли БВ передаваться во время вагинального полового акта. БВ чаще всего диагностируется с помощью теста, называемого мокрым креплением.

    Восстановление здоровой флоры влагалища

    Одна из трудностей при лечении БВ и связанных с ним состояний, таких как дрожжевые инфекции, заключается в том, чтобы выяснить, как восстановить нормальную микрофлору влагалища.Иногда после лечения популяции бактерий возвращаются к нормальным размерам. В других случаях они этого не делают.

    Чтобы помочь восстановить флору, в которой преобладают лактобациллы, ряд исследователей изучают пробиотические таблетки и свечи. Эти обработки будут содержать виды лактобацилл.

    Есть надежда, что эти бактерии вырастут и заново заселят влагалище. На сегодняшний день результаты, хотя и предварительные, были в некоторой степени положительными. Тем не менее, если они подтвердятся, пробиотики могут стать новым способом улучшить здоровье влагалища и восстановить здоровую микрофлору влагалища.

    Бактериальный вагиноз — Better Health Channel

    О бактериальном вагинозе

    Бактериальный вагиноз (БВ) вызывается дисбалансом бактерий, обычно присутствующих во влагалище. У женщин с БВ нормальные здоровые бактерии (в частности, лактобациллы) заменяются чрезмерным ростом других смешанных бактерий. Точная причина БВ неизвестна.

    Симптомы BV

    Симптомы BV могут включать:

    • водянистые, белые или серые выделения из влагалища
    • сильный или необычный запах из влагалища, часто описываемый как «рыбный запах».

    Бактериальный вагиноз может возникать одновременно с инфекциями, передаваемыми половым путем (ИППП).

    Как передается BV

    Хотя неясно, как передается BV, он чаще встречается у женщин, ведущих половую жизнь. Иногда он развивается вскоре после полового акта с новым партнером. Женщины, имеющие половых партнеров-женщин, могут подвергаться более высокому риску, чем женщины, имеющие половые контакты только с партнерами-мужчинами.

    Исследования не обнаружили окончательно связь между БВ и конкретными сексуальными практиками или действиями.Однако недавние данные подтверждают использование презервативов для снижения риска этой инфекции.

    Диагностика BV

    Диагноз ставится на основании признаков и симптомов, а также лабораторных тестов. Во время медицинского осмотра ваш врач может заметить:

    • обильные выделения из влагалища
    • запах из влагалища
    • снижение кислотности влагалищной жидкости при тестировании pH.

    Лечение BV

    Если у вас нет симптомов, лечение обычно не требуется, поскольку это состояние самоограничено (пройдет само).

    Обратитесь за медицинской помощью, если:

    • вам предстоит медицинская процедура, которая может привести к попаданию бактерий в матку — например, введение ВМС или прерывание беременности
    • вы беременны — БВ может вызвать раннее начало родов . Поговорите со своим терапевтом, акушером или акушеркой о лечении BV, если вы беременны.
    • Симптомы BV влияют на качество вашей жизни, и из-за этого вы избегаете секса.

    Антибиотики используются для лечения BV

    Для лечения инфекции можно использовать антибиотик метронидазол.Если ваш врач прописал вам метронидазол, вам необходимо:

    • Принимать антибиотик два раза в день в течение семи дней.
    • Принимайте таблетки после еды — это может уменьшить тошноту и расстройство желудка, которые иногда ассоциируются с метронидазолом.
    • Избегайте употребления алкоголя во время лечения.

    Ваш врач может назначить вагинальный крем (например, клиндамицин), если вы не можете принимать метронидазол. Клиндамицин наносят на влагалище на семь ночей.

    Рецидивы BV

    Даже после лечения примерно у половины женщин с BV состояние восстанавливается в течение 6–12 месяцев. Похоже, что лечение партнера инфицированной женщины не снижает риск рецидива, но в этой области проводятся дальнейшие исследования.

    Профилактика BV

    Большинство случаев BV, по-видимому, связано с сексуальной активностью. Доказано, что презервативы защищают от инфекции, и безопасные половые отношения рекомендуются всем женщинам, независимо от пола их партнеров.

    Куда обратиться за помощью

    Микрофлора неовлагалища, выстланного кожей полового члена транссексуальных женщин | BMC Microbiology

    Популяция пациентов

    Для целей этого исследования 70 голландскоязычных транссексуальных женщин, у которых был минимальный интервал 6 месяцев с момента проведения SRS, и которые консультировались с одним из членов гендерной группы для лечения или последующего наблюдения. до 2006 года были приглашены к участию. Через 4 недели наш целевой уровень участия 50 был достигнут, и никаких дальнейших усилий по увеличению размера выборки не предпринималось.

    Процедуры исследования

    Это исследование соответствует рекомендациям Хельсинкской декларации и было одобрено этическим комитетом нашего учреждения (университетская больница Гента) под номером 2006/375. После письменного и устного информированного согласия все женщины, согласившиеся на участие, завершили весь протокол исследования в период с марта по июнь 2007 года.

    Пациенты были проинструктированы избегать любых половых сношений и воздерживаться от использования средств гигиены влагалища (мыла, лосьонов и т. Д.) .) не менее чем за три дня до экзаменов.

    При включении в исследование медсестра-исследовательница запросила следующие вопросы: медицинский и хирургический анамнез, сексуальная ориентация, статус текущих отношений и наличие частых эпизодов (определяемых как один раз в месяц или чаще) раздражения влагалища и / или дизурии. Все участники также заполнили обширные анкеты относительно общего, психического и сексуального здоровья, результаты которых были опубликованы ранее [21]. Был взят образец крови натощак для определения концентрации эстрадиола и тестостерона в сыворотке крови.

    Осмотр зеркала проводил гинеколог. Исследование зеркала проводилось с использованием зеркала Коллинза длиной 10 см и шириной 2,5 см. Если введение этого зеркала считалось невозможным или если пациент указывал, что введение было слишком болезненным, использовалось более тонкое (шириной 2 см) зеркало. Зеркало было минимально смазано несколькими каплями стерильной воды. Мы сознательно воздерживались от использования чего-либо, кроме стерильной воды, чтобы не мешать микрофлоре влагалища.Установив зеркало на место, тампон с ватным наконечником катали по средней части одной боковой стенки, чтобы получить мазок из влагалища. Затем тампон немедленно мазали по простому предметному стеклу и давали ему высохнуть при комнатной температуре. Второй стерильный тампон для посева и молекулярного анализа наматывали на ту же боковую стенку средней части влагалища, а затем помещали в жидкую транспортную среду Эмиса (Eswab, Nuova Aptaca, Canelli, Италия, ) и обрабатывали в лаборатории. в течение 4 часов.Для оценки pH нового влагалища использовались две коммерческие (нитразиновые) pH-полоски: одна с диапазоном pH от 1 до 10 (с точностью до 1,0), а другая с диапазоном pH от 4 до 7 (с точностью до 0,1) ( Merck, Дармштадт, Германия ). Эти полоски прикладывали к стенке влагалища до достаточного увлажнения и сравнивали со стандартом производителя одним наблюдателем (SW). У одной пациентки установка зеркала была невозможна из-за почти полной облитерации влагалища.У этой пациентки все вагинальные мазки и pH-полоски были взяты поверхностно в точке «входа». Chlamydia определяли в образце мочи с использованием коммерческого ПЦР-анализа в реальном времени (Abbott RealTime CT, Abbott Laboratories, Иллинойс, США).

    После завершения исследования у нас остались некоторые дополнительные вопросы, которые, как мы думали, могут иметь влияние на микрофлору влагалища. Поэтому пациенткам была отправлена ​​дополнительная анкета, в которой их спрашивали о регулярном использовании средств вагинальной гигиены (один раз в месяц или чаще) и о наличии неприятных выделений из влагалища (один раз в месяц или чаще).

    Окрашивание слайдов

    Мазки окрашивали по Граму (Mirastainer, Merck-Belgolabo, Overijse, Бельгия) и исследовали под масляной иммерсией при увеличении 1000 с помощью одного наблюдателя (GC).

    Культивирование и идентификация культивируемых изолятов с помощью тДНК-ПЦР

    Первым 30 женщинам 100 мкл жидкой транспортной среды Эми были нанесены штрихами на 5 различных чашек с агаром по прибытии в микробиологическую лабораторию. Питательной средой для восстановления аэробных бактерий был триптический соевый агар с добавлением 5% овечьей крови (Becton Dickinson, Franklin Lakes, NJ).Стафилококки выделяли на солевом агаре с маннитолом (Becton Dickinson, Franklin Lakes, NJ). Обе среды инкубировали в аэробных условиях при 37 ° C в течение 24 часов. Питательной средой для культивирования анаэробных бактерий был агар на основе Колумбии с 5% овечьей крови (Becton Dickinson, Franklin Lakes, NJ). Чашки с агаром MRS (Oxoid, Hampshire, UK) использовали для культивирования лактобацилл. Обе среды инкубировали в анаэробных условиях при 37 ° C в течение 5 дней на анаэробной рабочей станции (BugBox Plus, LedTechno, Heusden-Zolder, Бельгия).Селективные чашки с агаром GC-Lect (Becton Dickinson, Franklin Lakes, NJ) для выделения Neisseria gonorrhoeae инкубировали в атмосфере 5% CO 2 в течение двух дней. После инкубации для идентификации были отобраны все изоляты с разной морфологией колоний. ДНК экстрагировали простым щелочным лизисом: одну колонию суспендировали в 20 мкл лизирующего буфера (0,25% додецилсульфат натрия-0,05 н. NaOH), нагревали при 95 ° C в течение 15 минут и разбавляли 180 мкл дистиллированной воды. тДНК-ПЦР и капиллярный электрофорез проводили, как описано ранее [22, 23].Изоляты были идентифицированы путем сравнения их отпечатков пальцев тДНК-ПЦР с отпечатками из библиотеки отпечатков пальцев тДНК-ПЦР, полученными от эталонных штаммов, с использованием собственной программы [22]. Библиотека отпечатков тДНК-ПЦР доступна по адресу http://allserv.ugent.be/~mvaneech/All_C.txt, а программное обеспечение можно получить по запросу.

    Секвенирование

    генов 16S рРНК

    Секвенирование проводили, как описано ранее [7], и последовательности сравнивали с последовательностями 16S рРНК, присутствующими в Genbank, с помощью BLAST.Последовательности, которые имели менее 98% сходства с ранее известными видами бактерий, были отправлены в Genbank, и им были присвоены номера доступа FM945400 – FM945411.

    Экстракция ДНК из образцов вагинальных мазков

    Для экстракции ДНК из сухих вагинальных мазков 800 мкл буфера для лизиса NucliSens EasyMAG добавляли к 200 мкл жидкой транспортной среды Эмиса, инкубировали в течение 10 минут при комнатной температуре и хранили при -80 ° C до экстракции проводили на платформе NucliSens EasyMag (BioMérieux, Marcy l’Etoile, Франция) в соответствии с рекомендациями производителя.ДНК элюировали в 110 мкл буфера для элюции NucliSens EasyMAG, и ДНК-экстракты хранили при -20 ° C и использовали для целей ПЦР с точки зрения видоспецифичности.

    Видоспецифическая ПЦР для

    Gardnerella vaginalis

    G. vaginalis видоспецифичные праймеры (G Z ), разработанные Zariffard et al. [24]. Вкратце, 20 мкл смеси для ПЦР содержали соответственно 0,05 мкМ праймеров, 10 мкл мастер-смеси Promega (Promega, Madison, WI), 2 мкл ДНК-экстракта Easymag образцов и дистиллированную воду.Термоциклирование с праймерами G Z состояло из начальной денатурации в течение 10 минут при 94 ° C, затем 50 циклов по 5 секунд при 94 ° C, 45 секунд при 55 ° C и 45 секунд при 72 ° C, а затем продление 10 мин при 72 ° C. Пять мкл амплифицированного продукта визуализировали на 2% агарозном геле.

    Видоспецифическая ПЦР для

    Atopobium vaginae

    Набор праймеров ato167f (5 ‘GCGAATATGGGAAAGCTCCG) и ato587r (5’ GAGCGGATAGGGGTTGAGC), который позволил специфическую амплификацию гена 9000 рРНК A.vaginae использовали, как описано ранее [7].

    Видоспецифическая ПЦР для BVAB

    Видоспецифическая ПЦР для бактерий, ассоциированных с бактериальным вагинозом (BVAB1-3), была проведена, как описано ранее [17].

    Специфическая ПЦР для

    Mobiluncus

    Родоспецифическая ПЦР для Mobiluncus spp. с использованием праймеров Mob-s 5’GTGAACTCCTTTTTCTCGTGAA и Mob-as 5’CGCAGAAACACAGGATTGCATCC и видоспецифической ПЦР для Mobiluncus curtisii с использованием праймеров Mob-V3 5’GCCAGCCTTCGGGG’TGGTGCC1 и др., описанных в. [25] с небольшими изменениями. Вкратце, 20 мкл смеси для ПЦР содержали по 1 мкМ каждого из праймеров, 10 мкл MasterStart PCR master (Roche), 2 мкл ДНК-экстракта Easymag образцов и дистиллированную воду.

    Термоциклирование состояло из начальной денатурации в течение 2 минут при 94 ° C, за которыми следовали 35 циклов по 30 секунд при 94 ° C, 30 секунд при 60 ° C и 1 минута при 72 ° C, с последующим продлением 10 минут. при 72 ° C и охлаждении до 10 ° C.

    Обнаружение и идентификация грибов с использованием анализа длины флуоресцентного фрагмента ITS2-PCR ампликона и секвенирования

    Амплификацию ITS2-области и последующий капиллярный электрофорез выполняли, как описано ранее [26, 27].

    Ампликоны, имеющие длину фрагмента, отсутствующую в существующей библиотеке ITS2, которая содержит большинство клинически важных видов дрожжей, секвенировали, как описано ранее [26].

    Анализ данных

    Распределения непрерывных и дискретных переменных были суммированы как средние и стандартные отклонения. Двумерные корреляции представлены коэффициентом R Пирсона, если наблюдаемое распределение приближается к нормальному распределению, либо коэффициентом ранговой корреляции Спирмена rho при непараметрическом предположении.

    Статистическая значимость была принята на стандартном двустороннем уровне значимости α = 0,05. Все анализы были выполнены с помощью пакета статистических программ SPSS 15.0 (Чикаго, Иллинойс).

    Влияние пробиотиков на клиренс вируса папилломы человека высокого риска и качество мазка из шейки матки: рандомизированное плацебо-контролируемое исследование | BMC Women’s Health

  • 1.

    Hawes SE, Hillier SL, Benedetti J, Stevens CE, Koutsky LA, Wolner-Hanssen P, Holmes KK.Лактобациллы, продуцирующие перекись водорода, и приобретение вагинальных инфекций. J Infect Dis. 1996. 174 (5): 1058–63.

    CAS Статья Google Scholar

  • 2.

    Гупта К., Стэплтон А.Е., Хутон TM, Робертс П.Л., Феннелл К.Л., Штамм В.Е. Обратная связь лактобацилл, продуцирующих h3O2, и колонизации вагинальной кишечной палочки у женщин с рецидивирующими инфекциями мочевыводящих путей. J Infect Dis. 1998. 178 (2): 446–50.

    CAS Статья Google Scholar

  • 3.

    da Silva CS, Adad SJ, Hazarabedian de Souza MA, Macedo Barcelos AC, Sarreta Terra AP, Murta EF. Повышенная частота бактериального вагиноза и хламидии трахоматис у беременных с папилломавирусной инфекцией. Gynecol Obstet Investig. 2004. 58 (4): 189–93.

    Артикул Google Scholar

  • 4.

    Мао К., Хьюз Дж. П., Кивиат Н., Кайперс Дж., Ли С. К., Адам Д. Э., Коутски Л. А.. Клинические данные среди молодых женщин с генитальной инфекцией папилломы человека.Am J Obstet Gynecol. 2003. 188 (3): 677–84.

    Артикул Google Scholar

  • 5.

    Gillet E, Meys JF, Verstraelen H, Bosire C, De Sutter P, Temmerman M, Broeck DV. Бактериальный вагиноз связан с инфицированием вирусом папилломы человека шейки матки: метаанализ. BMC Infect Dis. 2011; 11: 10.

    Артикул Google Scholar

  • 6.

    Castellsague X. Естественная история и эпидемиология инфекции ВПЧ и рака шейки матки.Gynecol Oncol. 2008; 110 (3 Suppl 2): ​​S4–7.

    Артикул Google Scholar

  • 7.

    Huh WK. Инфекция вируса папилломы человека: краткий обзор естествознания. Obstet Gynecol. 2009. 114 (1): 139–43.

    Артикул Google Scholar

  • 8.

    Reid G, Bruce AW, Fraser N, Heinemann C, Owen J, Henning B. Пероральные пробиотики могут вылечить урогенитальные инфекции. FEMS Immunol Med Microbiol.2001. 30 (1): 49–52.

    CAS Статья Google Scholar

  • 9.

    Cianci A, Giordano R, Delia A, Grasso E, Amodeo A, De Leo V, Caccamo F. ​​Эффективность Lactobacillus Rhamnosus GR-1 и Lactobacillus Reuteri RC-14 в лечении и профилактике вагинозов и рецидивы бактериального вагинита. Минерва Гинекол. 2008. 60 (5): 369–76.

    CAS PubMed Google Scholar

  • 10.

    Chew SY, Cheah YK, Seow HF, Sandai D, Than LT. Пробиотики Lactobacillus rhamnosus GR-1 и Lactobacillus reuteri RC-14 обладают сильным противогрибковым действием против изолятов Candida glabrata, вызывающих вульвовагинальный кандидоз. J Appl Microbiol. 2015; 118 (5): 1180–90.

    CAS Статья Google Scholar

  • 11.

    Хо М., Чанг Й.Й., Чанг В.С., Линь Х.С., Ван М.Х., Лин В.С., Чиу TH. Устные Lactobacillus rhamnosus GR-1 и Lactobacillus reuteri RC-14 для уменьшения колонизации стрептококками группы B у беременных женщин: рандомизированное контролируемое исследование.Тайвань J Obstet Gynecol. 2016; 55 (4): 515–8.

    Артикул Google Scholar

  • 12.

    Рид Г. Пробиотические средства для защиты урогенитального тракта от инфекции. Am J Clin Nutr. 2001; 73 (2 доп.): 437С – 43С.

    CAS Статья Google Scholar

  • 13.

    Anukam KC, Osazuwa EO, Osadolor HB, Bruce AW, Reid G. Йогурт, содержащий пробиотики Lactobacillus rhamnosus GR-1 и L.reuteri RC-14 помогает устранить умеренную диарею и увеличивает количество CD4 у пациентов с ВИЧ / СПИДом. J Clin Gastroenterol. 2008. 42 (3): 239–43.

    PubMed Google Scholar

  • 14.

    Anukam KC, Hayes K, Summers K, Reid G. Пробиотики Lactobacillus rhamnosus GR-1 и Lactobacillus reuteri RC-14 могут способствовать подавлению TNF-альфа, IL-6, IL-8, IL-10 и IL -12 (p70) в нейрогенном мочевом пузыре спинного мозга у пациента с инфекциями мочевыводящих путей: исследование с двумя случаями.Adv Urol. 2009; 2009: 680363.

    Артикул Google Scholar

  • 15.

    Ван Баарлен П., Трост Ф., ван дер Меер С., Хойвельд Г., Бекшотен М., Браммер Р. Дж., Клееребезем М. Ответ транскриптома слизистой оболочки человека in vivo на три лактобациллы указывает на то, как пробиотики могут модулировать клеточные пути человека. Proc Natl Acad Sci U S. A. 2011; 108: 4562–9.

    Артикул Google Scholar

  • 16.

    Cadieux P, Burton J, Gardiner G, Braunstein I, Bruce AW, Kang CY, Reid G. Штаммы лактобацилл и экология влагалища. ДЖАМА. 2002. 287 (15): 1940–1.

    Артикул Google Scholar

  • 17.

    Ча М.К., Ли Д.К., Ан Х.М., Ли С.В., Шин Ш., Квон Дж. Х., Ким К.Дж., Ха-Нью-Джерси. Противовирусная активность Bifidobacterium adolescentis SPM1005-a в отношении вируса папилломы человека 16 типа. BMC Med. 2012; 10: 72.

    CAS Статья Google Scholar

  • 18.

    Palma E, Recine N, Domenici L, Giorgini M, Pierangeli A, Panici PB. Долгосрочное применение Lactobacillus rhamnosus BMX 54 для восстановления сбалансированной экосистемы влагалища: многообещающее решение против ВПЧ-инфекции. BMC Infect Dis. 2018; 18 (1): 13.

    Артикул Google Scholar

  • 19.

    Верховен В., Ренард Н., Макар А., Ван Ройен П., Богерс Дж. П., Лардон Ф. и др. Пробиотики улучшают выведение шейки матки из поражений, связанных с вирусом папилломы человека: проспективное контролируемое пилотное исследование.Eur J Cancer Пред. 2013; 22 (1): 46–51.

    Артикул Google Scholar

  • 20.

    Акамацу С., Кодама С., Химеджи Ю., Икута Н., Шимагаки Н. Сравнение жидкостной цитологии с традиционной цитологией при скрининге рака шейки матки. Acta Cytol. 2012. 56 (4): 370–4.

    Артикул Google Scholar

  • 21.

    Castle PE, Bulten J, Confortini M, Klinkhamer P, Pellegrini A, Siebers AG, et al.Возрастные особенности неудовлетворительных результатов обычных мазков Папаниколау и жидкостной цитологии: данные двух рандомизированных клинических испытаний. BJOG. 2010. 117 (9): 1067–73.

    CAS Статья Google Scholar

  • 22.

    Siebers AG, Klinkhamer PJ, Vedder JE, Arbyn M, Bulten J. Причины и актуальность неудовлетворительных и удовлетворительных, но ограниченных мазков на жидкой основе по сравнению с традиционной цитологией шейки матки. Arch Pathol Lab Med.2012. 136 (1): 76–83.

    Артикул Google Scholar

  • 23.

    Kwak YK, Daroczy K, Colque P, Kühn I., Möllby R, Kopp Kallner H. Персистентность лактобацилл у женщин в постменопаузе — двойное слепое рандомизированное пилотное исследование. Gynecol Obstet Investig. 2017; 82 (2): 144–50.

    CAS Статья Google Scholar

  • 24.

    Kim JM, Park YJ. Пробиотики в профилактике и лечении вагинальных инфекций в постменопаузе: обзорная статья.J Menopausal Med. 2017; 23 (3): 139–45.

    Артикул Google Scholar

  • 25.

    Bisanz JE, Seney S, McMillan A, Vongsa R, Koenig D, Wong L, et al. Подход системной биологии, изучающий влияние пробиотиков на вагинальный микробиом и реакцию хозяина в двойном слепом плацебо-контролируемом клиническом исследовании женщин в постменопаузе. PLoS One. 2014; 9 (8): e104511.

    Артикул Google Scholar

  • 26.

    Perisic Z, Perisic N, Golocorbin Kon S, Vesovic D, Jovanovic AM, Mikov M. Влияние пробиотиков на качество диагностики злокачественных новообразований шейки матки. Vojnosanit Pregl. 2011. 68 (11): 956–60.

    Артикул Google Scholar

  • 27.

    Stoler MH, Wright TC Jr, Sharma A, Apple R, Gutekunst K, Wright TL; ATHENA (Обращение к потребности в расширенной диагностике ВПЧ) Исследовательская группа по ВПЧ. Тестирование на вирус папилломы человека высокого риска у женщин с цитологией ASC-US: результаты исследования THE ATHENA HPV.Am J Clin Pathol 2011; 135 (3): 468–475.

  • 28.

    Arbyn M, Xu L, Verdoodt F, Cuzick J, Szarewski A, Belinson JL, et al. Генотипирование вируса папилломы человека 16 и 18 типов у женщин с незначительными поражениями шейки матки: систематический обзор и метаанализ. Ann Intern Med. 2017; 166 (2): 118–27.

    Артикул Google Scholar

  • 29.

    Нанно М., Като И., Кобаяши Т., Шида К. Биологические эффекты пробиотиков: какое влияние на нас оказывает Lactobacillus casei shirota? Int J Immunopathol Pharmacol.2011; 24 (1 доп.): 45С – 50С.

    CAS PubMed Google Scholar

  • 30.

    van der Weele P, van Logchem E, Wolffs P, van den Broek I, Feltkamp M, de Melker H, et al. Корреляция между вирусной нагрузкой, множественностью инфекции и устойчивостью инфекции HPV16 и HPV18 в когорте молодых женщин из Голландии. J Clin Virol. 2016; 83: 6–11.

    Артикул Google Scholar

  • 31.
  • Leave a Reply

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    2021 © Все права защищены.